AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

Obesity is a chronic low-grade inflammation and a risk factor for diseases such as diabetes， hypertension， dyslipidemia， and malignant tumors， demonstrating an increasingly grim development situation. The nuclear factor-kappa B （NF-κB） signaling pathway is a key signaling pathway involved in the immune response and inflammatory response. In obese individuals， the expression of NF-κB is overactivated， which leads to abnormal inflammatory responses in the body. Therefore， it is expected to alleviate inflammation and treat obesity by regulating the NF-κB signaling pathway， which has been proven effective by a large number of studies. The available studies on the NF-κB signaling pathway mostly focus on tumors， and there is no systematic review of the mechanism of this pathway in mediating obesity and the traditional Chinese medicine （TCM） treatment. We reviewed the research progress in the pathological and physiological processes of obesity mediated by NF-κB signaling pathway and TCM treatment， aiming to give insights into the clinical treatment of obesity with TCM and provide reference targets and research directions for exploring the biological foundations and the development of new TCM preparations.

To summarize the clinical experience of Professor LIU Jinmin in treatment for epilepsy. It is believed that main pathogenesis of epilepsy is yangming failure to close and vital activity loss control， so a therapeutic approach focused on restoring the closure of yangming and regaining vital activity was proposed for the treatment of epilepsy. For excess syndrome， the treatment focuses on draining excess and descending qi， promoting purgation and restoring spirit. When yangming dryness-heat predominates， the approach involves unblock the bowels and regulating the spirit， descending qi and reducing fire， with modified Chengqi Decoction （承气汤） as prescription； when yangming phlegm-fire predominates， the treatment focuses on clearing heat and resolving phlegm， calming mind and suppressing fright， with modified Qingxin Wendan Decoction （清心温胆汤） as prescription； when yangming blood stasis predominates， the approach involves breaking up blood stasis and promoting purgation， eliminating stasis and awakening the mind， with Taoren Chengqi Decoction （桃核承气汤） as prescription. For deficiency syndrome， the treatment emphasizes tonifying deficiency and raising qi， strengthening the stomach and nourishing the spirit. When center qi deficiency and sinking of clear qi of the nutrients from food， the approach involves replenishing and uplifting qi while nourishing vital activity， with modified Liujunzi Decoction （六君子汤） as prescription； when yin deficiency and fluid consumption， the treatment focuses on nourishing stomach and tonifying yin， promoting fluid production and calming the spirit， with modified Maimendong Decoction （麦门冬汤） combined with Yiwei Decoction （益胃汤） as prescriptions. In clinical situations of deficiency-excess complex， it is essential to distinguish the primary condition from the secondary， applying both supplementing and draining methods flexibly to achieve optimal treatment.

ObjectiveTo explore the coercive experience of involuntarily hospitalized adolescents with mental disorders during the admission process and hospitalization， providing references for formulating targeted nursing interventions. MethodsSemi-structured interviews were conducted with 15 involuntarily hospitalized adolescents with mental disorders selected from October to December 2023， and the themes were summarized and extracted by content analysis. ResultsA total of 3 themes and 10 sub-themes were extracted， which were used to elaborate the essential contents， causes， and improvement methods of coercive experience. These encompassed the multi-dimensional content of coercive experience （complex emotional experience， different physical sensations， and contradictory cognitive evaluation）， the multi-faceted causes of coercive experience （insufficient personal preparation， inadequate parental communication， and strict medical management system）， as well as the phased improvement of coercive experience （adequate communication before hospitalization， patient notification before coercive intervention， respecting for demands during coercive intervention， and comforting explanation after coercive intervention）. ConclusionThe essential content of the coercive experience of involuntarily hospitalized adolescents with mental disorders is complex and has various causes， which require cooperation from multiple parties to improve. Therefore， parents should respect the expression of their children’s self-will， and medical staff should respect patients’ autonomy， establishing a protection-constrained doctor-patient relationship model and collaborating to reduce the use of coercive interventions， to improve the overall medical satisfaction of adolescents with mental disorders.

ObjectiveTo observe the inhibitory effect of the Weiliuan mixture （WLAHJ） on the subcutaneous xenograft tumor of MKN-74 gastric cancer cells， and explore the potential anti-gastric cancer mechanism of WLAHJ by using transcriptomic sequencing technology to reveal related genes and pathways. Methods30 Balb/c nude mice were randomly divided into model， low-， medium-， and high-dose（15，30，45 g·kg^-1） WLAHJ and 5-FU （0.025 g·kg^-1） groups to build a subcutaneous xenograft tumor model with MKN-74 human gastric cancer cells. After modeling，each group was continuously treated with the corresponding drugs for 28 days. During the treatment period， the body weight and tumor size of the mice were observed and recorded every 2 days. At the end of the treatment， the mice were sacrificed， and required samples were collected to calculate the tumor inhibition rate of WLAHJ on the subcutaneous xenograft tumor. High-throughput transcriptomic sequencing （RNA-seq） technology was used to analyze the differentially expressed genes in the subcutaneous tumor tissues of the model group and the medium-dose WLAHJ group， thus exploring the potential mechanism of WLAHJ in gastric cancer intervention. Immunofluorescence experiments were conducted to detect the protein expression levels of glutathione peroxidase 4 （GPX4）， solute carrier family 7 member 11 （SLC7A11）， transferrin receptor protein-1 （TFR-1）， and acyl-CoA synthetase long-chain family member 4 （ACSL4） in subcutaneous xenograft tumors of each group. Cell counting kit-8（CCK-8） and colony formation assays were used to detect the viability and anti-proliferative ability of human gastric cancer AGS and MKN-74 cells at different concentrations of WLAHJ. Kits were used to detect the levels of Fe²⁺， reactive oxygen species （ROS）， malondialdehyde （MDA）， and superoxide dismutase （SOD） activity in cells. Western blot was used to detect the expression levels of GPX4， SLC7A11， TRF-1， ACSL4， spermidine/spermine N1-acetyltransferase 1 （SAT1）， arachidonic acid 15-lipoxygenase （ALOX15）， and key proteins in the phosphatidylinositol 3-kinase （PI3K）/protein kinase B （Akt）/mammalian target of rapamycin （mTOR） signaling pathway. ResultsThe mechanism of WLAHJ in gastric cancer intervention may be related to ferroptosis and the PI3K/Akt /mTOR signaling pathway. The growth of subcutaneous xenograft tumors in nude mice of the WLAHJ and 5-FU groups（P<0.05，P<0.01）， GPX4， and SLC7A11 dropped significantly（P<0.01）， while TFR-1， ACSL4， SAT1， and ALOX15（P<0.05，P<0.01）increased significantly compared with those in the model group. The levels of ROS， Fe²⁺， and MDA increased in the WLAHJ and 5-FU groups and the proliferation of gastric cancer cells， SOD activity， the ratios of phosphorybation （p）-mTOR/mTOR， p-PI3K/PI3K， and p-Akt/Akt protein expressions（P<0.05，P<0.01）decreased compared with those in the blank group. ConclusionThe mechanism of WLAHJ in treating gastric cancer may be related to the regulation of the PI3K/ Akt /mTOR signaling pathway to intervene in ferroptosis.

ObjectiveBased on the theory of "gut-prostate" axis， this study explored the effects and mechanisms of Zishen Tongguan formula and Cinnamomi Cortex in the formula in treating rats with chronic non-bacterial prostatitis（CNP） by detecting the levels of inflammatory factors， and the composition and structure of intestinal flora in CNP rats. MethodsEight out of 42 SD rats were randomly selected as the normal group， and the remaining rats were injected with carrageenan to prepare the CNP model. After successful modeling， 32 rats were randomly divided into the model group， Ningmitai capsule group（0.50 g·kg^-1）， Zishen Tongguan formula group（2.00 g·kg^-1）， and the Phellodendri Chinensis Cortex-Anemarrhenae Rhizoma pair group（PCC-AR group， 2.00 g·kg^-1）， with 8 rats in each group. The administered groups were given the corresponding medicinal solution by gavage， and the normal and model groups were intragastrically administered with an equal volume of normal saline， once a day for 14 consecutive days. The prostate tissues of rats were collected and subjected to hematoxylin-eosin（HE） staining and Masson staining to observe the pathological changes of the tissues in each group. Enzyme-linked immunosorbent assay（ELISA） was used to detect the levels of related inflammatory factors in rat serum， and 16S rDNA sequencing was used to analyze the abundance and diversity changes of gut microbiota before and after administration， and species difference analysis was performed. ResultsAll the administered groups could alleviate the inflammatory symptoms of CNP rats， increase the expression levels of anti-inflammatory factors and decrease the expression levels of pro-inflammatory factors， with the most sIgnificant effect observed in the Zishen Tongguan formula group. Compared with the normal group， the expression levels of interleukin（IL）-8， hypersensitive C-reactive protein（hs-CRP）， immunoglobulin（Ig）M， secretory IgA （sIgA）， and inducible nitric oxide synthase（iNOS） were sIgnificantly increased in the model group（P<0.01）. Compared with the model group， the expression levels of the above inflammatory factors in all administered groups were significantly reduced（P<0.01）. When compared with the PCC-AR group， the Zishen Tongguan formula group showed a significant decrease in transforming growth factor（TGF）-β₁ expression level（P<0.05） and a significant increase in IgM expression level（P<0.01）. The results of gut microbiota analysis showed that， compared with the PCC-AR group， at the order level， the Zishen Tongguan formula group significantly reduced the relative abundance of conditional pathogens such as Bacteroidales， Acidaminococcales， Rhodospirillales， Clostridiales， and Elusimicrobiales（P<0.01）. And at the genus level， the Zishen Tongguan formula group significantly decreased the relative abundance of pathogenic microbiota such as Lachnospira and Bacteroides（P<0.01） and significantly increased the relative abundances of beneficial microbiota such as Ruminococcus and Lactobacillus（P<0.01）. ConclusionZishen Tongguan formula can reduce the level of harmful intestinal bacteria， increase the level of beneficial intestinal bacteria， down-regulate the expression of serum inflammatory factors， and the small amount of Cinnamomi Cortex in the formula may play a key role in the treatment of CNP with this formula.

ObjectiveBased on the theory of "gut-prostate" axis， this study explored the effects and mechanisms of Zishen Tongguan formula and Cinnamomi Cortex in the formula in treating rats with chronic non-bacterial prostatitis（CNP） by detecting the levels of inflammatory factors， and the composition and structure of intestinal flora in CNP rats. MethodsEight out of 42 SD rats were randomly selected as the normal group， and the remaining rats were injected with carrageenan to prepare the CNP model. After successful modeling， 32 rats were randomly divided into the model group， Ningmitai capsule group（0.50 g·kg^-1）， Zishen Tongguan formula group（2.00 g·kg^-1）， and the Phellodendri Chinensis Cortex-Anemarrhenae Rhizoma pair group（PCC-AR group， 2.00 g·kg^-1）， with 8 rats in each group. The administered groups were given the corresponding medicinal solution by gavage， and the normal and model groups were intragastrically administered with an equal volume of normal saline， once a day for 14 consecutive days. The prostate tissues of rats were collected and subjected to hematoxylin-eosin（HE） staining and Masson staining to observe the pathological changes of the tissues in each group. Enzyme-linked immunosorbent assay（ELISA） was used to detect the levels of related inflammatory factors in rat serum， and 16S rDNA sequencing was used to analyze the abundance and diversity changes of gut microbiota before and after administration， and species difference analysis was performed. ResultsAll the administered groups could alleviate the inflammatory symptoms of CNP rats， increase the expression levels of anti-inflammatory factors and decrease the expression levels of pro-inflammatory factors， with the most sIgnificant effect observed in the Zishen Tongguan formula group. Compared with the normal group， the expression levels of interleukin（IL）-8， hypersensitive C-reactive protein（hs-CRP）， immunoglobulin（Ig）M， secretory IgA （sIgA）， and inducible nitric oxide synthase（iNOS） were sIgnificantly increased in the model group（P<0.01）. Compared with the model group， the expression levels of the above inflammatory factors in all administered groups were significantly reduced（P<0.01）. When compared with the PCC-AR group， the Zishen Tongguan formula group showed a significant decrease in transforming growth factor（TGF）-β₁ expression level（P<0.05） and a significant increase in IgM expression level（P<0.01）. The results of gut microbiota analysis showed that， compared with the PCC-AR group， at the order level， the Zishen Tongguan formula group significantly reduced the relative abundance of conditional pathogens such as Bacteroidales， Acidaminococcales， Rhodospirillales， Clostridiales， and Elusimicrobiales（P<0.01）. And at the genus level， the Zishen Tongguan formula group significantly decreased the relative abundance of pathogenic microbiota such as Lachnospira and Bacteroides（P<0.01） and significantly increased the relative abundances of beneficial microbiota such as Ruminococcus and Lactobacillus（P<0.01）. ConclusionZishen Tongguan formula can reduce the level of harmful intestinal bacteria， increase the level of beneficial intestinal bacteria， down-regulate the expression of serum inflammatory factors， and the small amount of Cinnamomi Cortex in the formula may play a key role in the treatment of CNP with this formula.

Intraoperative cell salvage (IOCS) has been widely applied as an important blood conservation measure in surgical operations. However, there is currently a lack of clinical practice guidelines for the implementation of IOCS in patients with malignant tumors. This report aims to provide clinicians with recommendations on the use of IOCS in patients with malignant tumors based on the review and assessment of the existed evidence. Data were derived from databases such as PubMed, Embase, the Cochrane Library and Wanfang. The guideline development team formulated recommendations based on the quality of evidence, balance of benefits and harms, patient preferences, and health economic assessments. This study constructed seven major clinical questions. The main conclusions of this guideline are as follows: 1) Compared with no perioperative allogeneic blood transfusion (NPABT), perioperative allogeneic blood transfusion (PABT) leads to a more unfavorable prognosis in cancer patients (Recommended); 2) Compared with the transfusion of allogeneic blood or no transfusion, IOCS does not lead to a more unfavorable prognosis in cancer patients (Recommended); 3) The implementation of IOCS in cancer patients is economically feasible (Recommended); 4) Leukocyte depletion filters (LDF) should be used when implementing IOCS in cancer patients (Strongly Recommended); 5) Irradiation treatment of autologous blood to be reinfused can be used when implementing IOCS in cancer patients (Recommended); 6) A careful assessment of the condition of cancer patients (meeting indications and excluding contraindications) should be conducted before implementing IOCS (Strongly Recommended); 7) Informed consent from cancer patients should be obtained when implementing IOCS, with a thorough pre-assessment of the patient's condition and the likelihood of blood loss, adherence to standardized internally audited management procedures, meeting corresponding conditions, and obtaining corresponding qualifications (Recommended). In brief, current evidence indicates that IOCS can be implemented for some malignant tumor patients who need allogeneic blood transfusion after physician full evaluation, and LDF or irradiation should be used during the implementation process.