AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo observe the changes in the levels of different subtypes of epidermal growth factor receptor （ErbB）， namely ErbB1， ErbB2， ErbB3， and ErbB4， in the spinal dorsal horn of inflammatory pain model rats， and to explore their mechanism of mediating hyperalgesia as well as the intervention mechanism of electroacupuncture at "Zusanli （ST 36）" and "Kunlun （BL 60）". MethodsThe study was divided into five parts. In experiment 1， 14 Sprague Dawley （SD） rats were randomly divided into control and inflammatory pain group （7 rats each group） to observe the pain behavior and the protein expression of different ErbB receptor subtypes in the spinal dorsal horn. In experiment 2， 30 rats were randomly divided into control group 1， inflammatory pain group 1， and low-， medium-， and high-concentration TX1-85-1 groups， with 6 rats in each group， to observe the effect of inhibiting spinal ErbB3 on inflammatory pain. In experiment 3， 12 rats were randomly divided into control virus group and ErbB3 knockdown virus group， with 6 rats in each group， to observe the effect of knocking down ErbB3 in the spinal dorsal horn on inflammatory pain. In experiment 4， 44 rats were randomly divided into control group 2， inflammatory pain group 2， electroacupuncture group， and sham electroacupuncture group， with 11 rats in each group， to observe the effect of electroacupuncture. In experiment 5， 40 rats were randomly divided into control group 3， inflammatory pain group 3， electroacupuncture group 1， and electroacupuncture + NRG1 group， with 10 rats in each group， to observe the effect of activating ErbB3 on electroacupuncture. A rat model of inflammatory pain was established by subcutaneous injection of 100 μl of complete Freund's adjuvant into the sole of the unilateral hind foot of SD rats. Rats in the low-， medium-， and high-concentration TX1-85-1 groups were intrathecally injected with ErbB3 inhibitor TX1-85-1 on day 5 to day 7 after modeling. Rats in the ErbB3 knockdown virus group were injected with ErbB3 knockdown virus packaged with adenovirus vector-based short hairpin RNA （shRNA） into the spinal dorsal horn in situ 3 weeks before modeling. Rats in each electroacupuncture group received electroacupuncture at bilateral "Zusanli （ST 36）" and "Kunlun （BL 60）" from day 1 to day 7 after modeling， with dense-sparse waves at a frequency of 2 Hz/100 Hz and a current of 0.5-1.5 mA for 30 minutes once a day. Rats in the electroacupuncture + NRG1 group were intrathecally injected with ErbB3 ligand recombinant human neuregulin-1 （NRG1） after electroacupuncture intervention from day 5 to day 7 after modeling. The mechanical withdrawal threshold and thermal withdrawal latency of rats were measured on day 1， 3， 5， and 7 after modeling to evaluate behavior， and Western Blot was used to detect the protein and phosphorylation levels of each ErbB subtype in the spinal dorsal horn. ResultsCompared with the control group， rats in the inflammatory pain group showed decreased mechanical withdrawal threshold and thermal withdrawal latency of rats， and increased expression of phosphorylated ErbB3 （p-ErbB3） protein in the spinal dorsal horn on days 1， 3， 5， and 7 after modeling （P＜0.01）. On day 5 and day 7 after modeling， compared with the inflammatory pain group 1， the mecha-nical withdrawal threshold and thermal withdrawal latency of rats in the medium- and high-concentration TX1-85-1 groups increased， and the expression of p-ErbB3 protein decreased （P＜0.05）. On day 1， 3， 5， and 7 after modeling， compared with the control virus group， the mechanical withdrawal threshold and thermal withdrawal latency of rats in the ErbB3 knockdown virus group increased （P＜0.05）. On day 5 and day 7 after modeling， compared with the inflammatory pain group 2 and the sham electroacupuncture group， the mechanical withdrawal threshold and thermal withdrawal latency of rats in the electroacupuncture group increased， and the expression of p-ErbB3 protein decreased （P＜0.05）. On day 5 and day 7 after modeling， compared with the electroacupuncture + NRG1 group， the mechanical withdrawal threshold and thermal withdrawal latency of rats in the electroacupuncture group 1 increased （P＜0.05）. ConclusionThe p-ErbB3 in the spinal dorsal horn involved in hyperalgesia in rats with inflammatory pain， and electroacupuncture at "Zusanli （ST 36）" and "Kunlun （BL 60）" can alleviate inflammatory pain by inhibiting the expression of p-ErbB3 protein in the spinal dorsal horn of rats.

Objective: To analyze the epidemiological characteristics and influencing factors of severe fever with thrombocytopenia syndrome (SFTS) in Zhejiang Province from 2019 to 2023, so as to provide the reference for strengthening SFTS prevention and control. Methods: Data on laboratory-confirmed SFTS cases in Zhejiang Province from 2019 to 2023 were collected through the Infectious Disease Reporting Information System of Chinese Disease Prevention and Control Information System. Meteorological data, geographic environment and socioeconomic factors during the same period were collected from the fifth-generation European Centre for Medium-Range Weather Forecasts, Geospatial Data Cloud, and Zhejiang Statistical Yearbook, respectively. Descriptive epidemiological methods were used to analyze the epidemiological characteristics of SFTS from 2019 to 2023, and a Bayesian spatio-temporal model was constructed to analyze the influencing factors of SFTS incidence. Results: A total of 578 SFTS cases were reported in Zhejiang Province from 2019 to 2023, with an annual average incidence of 0.23/105. The peak period was from May to July, accounting for 52.60%. There were 309 males and 269 females, with a male-to-female ratio of 1.15∶1. The cases were mainly aged 50-<80 years, farmers, and in rural areas, accounting for 82.53%, 77.34%, and 75.43%, respectively. Taizhou City and Shaoxing City reported more SFTS cases, while Shaoxing City and Zhoushan City had higher annual average incidences of SFTS. The Bayesian spatio-temporal interaction model showed good goodness of fit. The results showed that mean temperature (RR=1.626, 95%CI: 1.111-2.378) and mean wind speed (RR=1.814, 95%CI: 1.321-2.492) were positively correlated with SFTS risk, while altitude (RR=0.432, 95%CI: 0.230-0.829) and population density (RR=0.443, 95%CI: 0.207-0.964) were negatively correlated with SFTS risk. Conclusions SFTS in Zhejiang Province peaks from May to July. Middle-aged and elderly people and farmers are high-risk populations. Taizhou City, Shaoxing City, and Zhoushan City are high-incidence areas. Mean temperature, mean wind speed, altitude, and population density can all affect the risk of SFTS incidence.

Objective:To explore the clinical characteristics, diagnosis and treatment strategies, and prognosis of pulmonary embolism (PE) complicating childhood rheumatic diseases.Methods:A retrospective case series study was performed on the demographic data, laboratory indicators, imaging features, treatment regimens, and follow-up data of 8 children with rheumatic diseases complicated by PE who were admitted to the Department of Rheumatology and Immunology, Capital Center for Children′s Health, Capital Medical University from January 2014 to October 2023.Results:Among the 8 children, there were 4 boys and 4 girls, with an age of 12.0 (7.5, 13.0) years. Among the primary diseases, there were 3 cases of systemic lupus erythematosus, 2 cases of Beh?et′s disease, 2 cases of Takayasu arteritis, and 1 case of antiphospholipid syndrome. All children developed PE during the active phase of the primary disease. PE was detected at the onset of the primary disease in 3 cases, and the median time from the diagnosis of the primary disease to the development of PE was 10.0 (6.0, 25.0) months in the remaining 5 cases. Fever was present in all 8 children, 4 cases were accompanied by chest tightness, dyspnea, etc., and 2 cases only presented with fever. Laboratory examinations revealed the following results: erythrocyte sedimentation rate was 42.0 (17.0, 78.0) mm/1 h, high-sensitivity C-reactive protein was 12.7 (2.6, 78.7) mg/L, white blood cell count was 9.6 (7.2, 18.7)×10 9/L; D-dimer was 2.3 (0.9, 6.2) mg/L; and hemoglobin was (109±16) g/L.Imaging examinations revealed that 5 cases had involvement of the bilateral lower pulmonary arteries, 5 cases had peripheral embolism, and 3 cases had central PE. Complications included 3 cases of deep vein thrombosis, 2 cases of intracranial venous sinus thrombosis, and 1 case of mild pulmonary hypertension.In terms of treatment, 7 cases received anticoagulation with heparin followed by warfarin. Immunomodulation was mainly based on glucocorticoids combined with immunosuppressants, and 4 cases were combined with biological agents. The follow-up time of 4.17 (1.75, 7.17) years, the time for complete absorption of PE was 10.5 (6.0, 18.0) months; all 8 children had no target events, with no recurrence or chronic thromboembolic pulmonary hypertension, and the pulmonary artery remodeling was good. Conclusions:PE complicating childhood rheumatic diseases is closely related to the activity of the primary disease. The clinical manifestations are insidious, with fever as the main symptom. Imaging examination is the key to diagnosis.Early adoption of heparin followed by warfarin anticoagulation and glucocorticoids combined with immunosuppressants and (or) biological agents to control the primary disease can achieve a favorable prognosis.

OBJECTIVE To form an expert consensus on the clinical application of parenteral direct thrombin inhibitors （DTIs） in patients during the perioperative period. METHODS Led by Sichuan Academy of Medical Sciences & Sichuan Provincial People’s Hospital （the Affiliated Hospital of UESTC）， a multidisciplinary working group was established. Through literature review and the Delphi method， clinical questions related to the rational perioperative use of parenteral DTIs were identified. A structured design was adopted using the “Population-Intervention-Comparison-Outcome” framework； systematic searches were conducted in CNKI， Medline， Embase and other databases. Relevant evidence from randomized controlled trials and cohort studies was included and synthesized. Evidence quality was assessed using the Grades of Recommendations Assessment，Development and Evaluation （GRADE） approach， and recommendations were formulated through multiple rounds of Delphi surveys and expert consensus meetings. RESULTS &CONCLUSIONS Seven recommendations （each with an expert consensus rate exceeding 90%） on the use of parenteral DTIs in perioperative patients were developed. These recommendations specify drug selection， dosing ranges， key monitoring points， and safety management strategies for parenteral DTIs in various scenarios， including the perioperative period of ventricular assist device implantation， the perioperative period of cardiac surgery， perioperative patients with lower-extremity atherosclerotic disease， the perioperative period of percutaneous coronary intervention in patients with acute coronary syndrome， the perioperative period of carotid artery stenting in patients with carotid stenosis， the perioperative period of patients with right heart thrombosis， and patients who develop related thrombosis and dysfunction after a central venous catheter insertion. In addition， warning and management pathways for perioperative bleeding and thrombotic events were proposed. This expert consensus， which is formulated based on the best available evidence， provides evidence-based guidance for standardized and individualized use of parenteral DTIs in perioperative period.

Gorham-Stout disease(GSD) is a rare osteolytic disorder characterized by spontaneous and progressive osteolysis, along with abnormal angiogenesis and lymphangiogenesis, with no new bone formation. We present a case of a 15-year-old female admitted due to " recurrent right leg pain for 5 years, 11 months after undergoing right femoral fracture surgery". Through comprehensive integration of the patient's clinical phenotype, laboratory tests, imaging findings, pathological examinations, and molecular biological test results, GSD was considered highly likely. A multidisciplinary treatment approach was conducted, including a combination of zoledronic acid and sirolimus to inhibit osteolysis, along with rehabilitation training and orthopedic intervention, providing a personalized and comprehensive treatment strategy.

To analyze the disease burden of acute lymphoid leukemia(ALL) and its changing trends in China and globally from 1990 to 2021, aiming to provide a theoretical basis for disease prevention, treatment, and policy formulation.

ObjectiveAngelicae Sinensis Radix， a commonly used medicinal herb with both medicinal and edible properties， is frequently adulterated in the market， severely affecting the clinical efficacy of preparations. While qualitative identification techniques for adulterants and counterfeits are now relatively mature， quantitative detection methods for adulterated processed products remain unexplored. Quantitative detection research of Angelicae Sinensis Radix and its primary closely related adulterant， "Tu Danggui" （Angelica gigas）， was conducted to establish a herbal quantitative molecular detection （Herb-Q） method for Angelicae Sinensis Radix and its processed products， providing a model for the establishment of quantitative detection technologies for Angelicae Sinensis Radix and related health products. MethodsThe specific single-nucleotide polymorphism （SNP） loci of Angelicae Sinensis Radix and Angelica gigas Nakai were screened based on the complete chloroplast genome sequence. The specific SNP loci of Angelicae Sinensis Radix were selected for quantitative methodological investigations （linearity， limit of quantification， limit of detection， and reproducibility） by mixing the powder of the herbs with different adulteration ratios. Huoxue Zhitong powder with three distinct adulteration ratios （15%， 25%， and 35%） was utilized to ascertain the precision of the Herb-Q method for the quantitative detection of Chinese patent medicines containing Angelicae Sinensis Radix. ResultsBy comparing the 123 chloroplast genome sequences of Angelicae Sinensis Radix， based on the principles of intraspecies conservation， interspecies specificity， and meeting the requirements of pyrophosphate high-throughput sequencing， it was determined that 9 674^th locus （A/G） in the chloroplast genome sequence NC_042826.1 and 38 592^nd locus （T/C） in the chloroplast genome sequence NC_029393.1 could be the exclusive molecular identification loci of Angelicae Sinensis Radix and Angelica gigas Nakai， respectively. The linear relationship R² of the Herb-Q method established by selecting the specific 9 674^th locus （A/G） of Angelicae Sinensis Radix was 0.997 4 （R²>0.99）， indicating an excellent linear relationship. The limits of quantification and detection were established at 2.0%， exhibiting excellent reproducibility ［relative standard deviation（RSD）<2.0%］. The established quantitative system based on the Herb-Q method detected the adulteration amount of counterfeit A. gigas in the Huoxue Zhitong powder， with an average deviation of 1.3% for three molecular quantitative replicates. ConclusionThis research demonstrates that the Herb-Q quantitative detection method established based on the 9 674^th locus （A/G） in the chloroplast genome sequence NC_042826.1 of Angelicae Sinensis Radix has good applicability， objectivity， and accuracy for Angelicae Sinensis Radix and A. gigas， and its processed products. This method has the capacity to provide technical support for the quantitative detection of commercially available Angelicae Sinensis Radix derivatives， including traditional Chinese medicinal preparations， dietary supplements， and nutraceuticals.

AIM:To evaluate the optimal timing of preoperative intravitreal anti vascular endothelial growth factor(VEGF)therapy in proliferative diabetic retinopathy(PDR)using intraoperative fluorescein angiography(IOFA).METHODS:A retrospective case series study was conducted on patients who underwent vitrectomy for PDR with vitreous hemorrhage(VH)at Sichuan Provincial People's Hospital from January 2023 to February 2025. Patients were divided into three groups according to the interval between intravitreal conbercept injection and surgery: Group A(3 d before surgery), Group B(7 d before surgery), and Group C(14 d before surgery). IOFA was used to assess the number and size of retinal neovascularization(NV). Additional data were collected including preoperative best corrected visual acuity(BCVA), vitreous hemorrhage grading, operative time, frequency of intraoperative endodiathermy, duration of high perfusion pressure, vitreoretinal adhesion grade, postoperative BCVA, and central macular thickness(CMT). Multidimensional analyses were performed.RESULTS:This study enrolled a total of 91 patients(94 eyes)with PDR accompanied by vitreous hemorrhage. Among them, Group A consisted of 31 patients(31 eyes; 18 males, 13 females; mean age 53.26±12.38 y), Group B consisted of 34 patients(37 eyes; 21 males, 13 females; mean age 51.61±14.16 y), and Group C consisted of 26 patients(26 eyes; 18 males, 8 females; mean age 51.00±12.02 y), with baseline characteristics comparable among the three groups(all P>0.05). Comparative analysis of NV visualized via IOFA revealed that both the number and size of NVs were significantly lower in Groups B and C than in Group A(all P<0.0167), while no statistically significant differences were observed between Groups B and C(both P>0.05). No significant differences were found among the three groups regarding other intraoperative parameters, including operation time, frequency of electrocoagulation application, duration of high perfusion pressure, or grading of vitreoretinal adhesion(all P>0.05).CONCLUSION:IOFA confirms that preoperative anti-VEGF therapy administered 7 or 14 d before surgery is more effective than a 3 d interval in suppressing retinal NV activity in PDR patients.

ObjectiveAngelicae Sinensis Radix， a commonly used medicinal herb with both medicinal and edible properties， is frequently adulterated in the market， severely affecting the clinical efficacy of preparations. While qualitative identification techniques for adulterants and counterfeits are now relatively mature， quantitative detection methods for adulterated processed products remain unexplored. Quantitative detection research of Angelicae Sinensis Radix and its primary closely related adulterant， "Tu Danggui" （Angelica gigas）， was conducted to establish a herbal quantitative molecular detection （Herb-Q） method for Angelicae Sinensis Radix and its processed products， providing a model for the establishment of quantitative detection technologies for Angelicae Sinensis Radix and related health products. MethodsThe specific single-nucleotide polymorphism （SNP） loci of Angelicae Sinensis Radix and Angelica gigas Nakai were screened based on the complete chloroplast genome sequence. The specific SNP loci of Angelicae Sinensis Radix were selected for quantitative methodological investigations （linearity， limit of quantification， limit of detection， and reproducibility） by mixing the powder of the herbs with different adulteration ratios. Huoxue Zhitong powder with three distinct adulteration ratios （15%， 25%， and 35%） was utilized to ascertain the precision of the Herb-Q method for the quantitative detection of Chinese patent medicines containing Angelicae Sinensis Radix. ResultsBy comparing the 123 chloroplast genome sequences of Angelicae Sinensis Radix， based on the principles of intraspecies conservation， interspecies specificity， and meeting the requirements of pyrophosphate high-throughput sequencing， it was determined that 9 674^th locus （A/G） in the chloroplast genome sequence NC_042826.1 and 38 592^nd locus （T/C） in the chloroplast genome sequence NC_029393.1 could be the exclusive molecular identification loci of Angelicae Sinensis Radix and Angelica gigas Nakai， respectively. The linear relationship R² of the Herb-Q method established by selecting the specific 9 674^th locus （A/G） of Angelicae Sinensis Radix was 0.997 4 （R²>0.99）， indicating an excellent linear relationship. The limits of quantification and detection were established at 2.0%， exhibiting excellent reproducibility ［relative standard deviation（RSD）<2.0%］. The established quantitative system based on the Herb-Q method detected the adulteration amount of counterfeit A. gigas in the Huoxue Zhitong powder， with an average deviation of 1.3% for three molecular quantitative replicates. ConclusionThis research demonstrates that the Herb-Q quantitative detection method established based on the 9 674^th locus （A/G） in the chloroplast genome sequence NC_042826.1 of Angelicae Sinensis Radix has good applicability， objectivity， and accuracy for Angelicae Sinensis Radix and A. gigas， and its processed products. This method has the capacity to provide technical support for the quantitative detection of commercially available Angelicae Sinensis Radix derivatives， including traditional Chinese medicinal preparations， dietary supplements， and nutraceuticals.