1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Mechanism of Electroacupuncture Alleviating Inflammatory Pain in Rats by Regulating ErbB Subtypes in the Spinal Dorsal Horn
Yuxin WU ; Shuxin TIAN ; Zhengyi LYU ; Dingru JI ; Xingzhen LI ; Yue DONG ; Binyu ZHAO ; Yi LIANG ; Jianqiao FANG
Journal of Traditional Chinese Medicine 2026;67(1):69-78
ObjectiveTo observe the changes in the levels of different subtypes of epidermal growth factor receptor (ErbB), namely ErbB1, ErbB2, ErbB3, and ErbB4, in the spinal dorsal horn of inflammatory pain model rats, and to explore their mechanism of mediating hyperalgesia as well as the intervention mechanism of electroacupuncture at "Zusanli (ST 36)" and "Kunlun (BL 60)". MethodsThe study was divided into five parts. In experiment 1, 14 Sprague Dawley (SD) rats were randomly divided into control and inflammatory pain group (7 rats each group) to observe the pain behavior and the protein expression of different ErbB receptor subtypes in the spinal dorsal horn. In experiment 2, 30 rats were randomly divided into control group 1, inflammatory pain group 1, and low-, medium-, and high-concentration TX1-85-1 groups, with 6 rats in each group, to observe the effect of inhibiting spinal ErbB3 on inflammatory pain. In experiment 3, 12 rats were randomly divided into control virus group and ErbB3 knockdown virus group, with 6 rats in each group, to observe the effect of knocking down ErbB3 in the spinal dorsal horn on inflammatory pain. In experiment 4, 44 rats were randomly divided into control group 2, inflammatory pain group 2, electroacupuncture group, and sham electroacupuncture group, with 11 rats in each group, to observe the effect of electroacupuncture. In experiment 5, 40 rats were randomly divided into control group 3, inflammatory pain group 3, electroacupuncture group 1, and electroacupuncture + NRG1 group, with 10 rats in each group, to observe the effect of activating ErbB3 on electroacupuncture. A rat model of inflammatory pain was established by subcutaneous injection of 100 μl of complete Freund's adjuvant into the sole of the unilateral hind foot of SD rats. Rats in the low-, medium-, and high-concentration TX1-85-1 groups were intrathecally injected with ErbB3 inhibitor TX1-85-1 on day 5 to day 7 after modeling. Rats in the ErbB3 knockdown virus group were injected with ErbB3 knockdown virus packaged with adenovirus vector-based short hairpin RNA (shRNA) into the spinal dorsal horn in situ 3 weeks before modeling. Rats in each electroacupuncture group received electroacupuncture at bilateral "Zusanli (ST 36)" and "Kunlun (BL 60)" from day 1 to day 7 after modeling, with dense-sparse waves at a frequency of 2 Hz/100 Hz and a current of 0.5-1.5 mA for 30 minutes once a day. Rats in the electroacupuncture + NRG1 group were intrathecally injected with ErbB3 ligand recombinant human neuregulin-1 (NRG1) after electroacupuncture intervention from day 5 to day 7 after modeling. The mechanical withdrawal threshold and thermal withdrawal latency of rats were measured on day 1, 3, 5, and 7 after modeling to evaluate behavior, and Western Blot was used to detect the protein and phosphorylation levels of each ErbB subtype in the spinal dorsal horn. ResultsCompared with the control group, rats in the inflammatory pain group showed decreased mechanical withdrawal threshold and thermal withdrawal latency of rats, and increased expression of phosphorylated ErbB3 (p-ErbB3) protein in the spinal dorsal horn on days 1, 3, 5, and 7 after modeling (P<0.01). On day 5 and day 7 after modeling, compared with the inflammatory pain group 1, the mecha-nical withdrawal threshold and thermal withdrawal latency of rats in the medium- and high-concentration TX1-85-1 groups increased, and the expression of p-ErbB3 protein decreased (P<0.05). On day 1, 3, 5, and 7 after modeling, compared with the control virus group, the mechanical withdrawal threshold and thermal withdrawal latency of rats in the ErbB3 knockdown virus group increased (P<0.05). On day 5 and day 7 after modeling, compared with the inflammatory pain group 2 and the sham electroacupuncture group, the mechanical withdrawal threshold and thermal withdrawal latency of rats in the electroacupuncture group increased, and the expression of p-ErbB3 protein decreased (P<0.05). On day 5 and day 7 after modeling, compared with the electroacupuncture + NRG1 group, the mechanical withdrawal threshold and thermal withdrawal latency of rats in the electroacupuncture group 1 increased (P<0.05). ConclusionThe p-ErbB3 in the spinal dorsal horn involved in hyperalgesia in rats with inflammatory pain, and electroacupuncture at "Zusanli (ST 36)" and "Kunlun (BL 60)" can alleviate inflammatory pain by inhibiting the expression of p-ErbB3 protein in the spinal dorsal horn of rats.
3.Chinese Medicine Regulates JAK2/STAT3 Signaling Pathway to Treat Ovarian Cancer: A Review
Yue ZHANG ; Danni DING ; Jia LI ; Wenwen MA ; Fengjuan HAN
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(3):323-330
Ovarian cancer (OC) is one of the most common malignant tumors in women, with the mortality rate being the highest among gynaecological malignant tumors. As the atypical symptoms of OC are difficult to be detected in the early stage, most patients are already in the advanced stage when being diagnosed. As a result, the clinical treatment has limited effects. Currently, the main therapies for OC are surgery and chemotherapy, while their drug resistance and adverse reactions seriously reduce the quality of life of patients. In recent years, traditional Chinese medicine (TCM) has attracted the attention of clinicians and researchers because of its high efficacy, low toxicity, and mild side effects. According to the TCM philosophy of treatment based on syndrome differentiation, the Chinese medicines with multiple targets, wide range, and mild side effects can be screened based on the molecular targets involved in the occurrence and development of OC, which can bring out the unique advantages of TCM in the treatment of OC. Modern studies have shown that the occurrence and development of OC are closely related to the abnormal expression of multiple signaling pathways. The continued abnormal activation of the signal transducer and activator of transcription 3 (STAT3) signaling pathway can lead to abnormal proliferation and malignancy of OC. cause abnormal proliferation and malignant transformation of OC, which is closely related to the development of OC. In addition, studies have shown that Chinese medicine can inhibit the proliferation, angiogenesis, invasion, and metastasis and promote the autophagy and apoptosis of OC cells by regulating the Janus kinase 2 (JAK2)/STAT3 signaling pathway, providing new therapeutic strategies and ideas for the prevention and treatment of OC. This paper summarizes the role of JAK2/STAT3 signaling pathway in OC development by reviewing the relevant articles and reviews the mechanism and research progress of active components and compound prescriptions of Chinese medicine intervening in OC development by regulating the JAK2/STAT3 signaling pathway. This review is expected to provide a systematic reference for clinical research and drug development of OC.
4.Anti-tumor Mechanism of Traditional Chinese Medicine with Effect of Softening Hardness and Dissipating Mass: A Review
Yue HU ; Linfeng WANG ; Yue LI ; Rui LIU ; Baojin HUA
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(1):276-286
The global burden of malignant tumors keeps increasing, and the increased morbidity and mortality make malignant tumors one of the major challenges to global health. Currently, malignant tumors are mainly managed by surgical resection, radiotherapy, chemotherapy, targeted therapy, and immunotherapy, which, however, usually cause serious adverse reactions, such as tissue damage, immune function inhibition, and multidrug resistance, affecting the prognosis and quality of life of the patients. Traditional Chinese medicine with low toxic and side effects and multi-target, multi-system, and multi-pathway therapeutic effects has shown positive therapeutic potential in cancer treatment. In particular, the traditional Chinese medicine with the effects of softening hardness and dissipating mass, which contains a variety of active ingredients, have shown strong inhibitory effects on tumor cells. Such medicine can not only directly attack tumor cells and inhibit their proliferation and invasion but also exert therapeutic effects by inducing apoptosis, blocking tumor-related signaling pathways, and inhibiting tumor angiogenesis. In addition, traditional Chinese medicine can improve the overall efficacy of cancer treatment by regulating the immune status of the body and reversing the drug resistance of tumor cells. Traditional Chinese medicine can exert the anti-tumor effect by regulating intracellular signaling pathways, which is one of the research hotspots in this field. Signaling pathways such as signal transducer and activator of transcription 3 (STAT3), phosphatidylinositol 3-kinase (PI3K)/protein kinase B (Akt)/mammalian target of rapamycin (mTOR), and mitogen-activated protein kinase (MAPK) play a key role in the formation and development of tumors. Traditional Chinese medicine can regulate the growth, apoptosis, and metabolic process of tumor cells by affecting the activity of these signaling pathways, thus exerting the therapeutic effects on tumors. Based on these mechanisms, a large number of experimental studies and clinical trials have proved that traditional Chinese medicine has broad prospects in anti-tumor treatment. To further verify these research results and provide a basis for the clinical application of traditional Chinese medicine and the development of new drugs, a systematic review and integrated analysis of the research reports on the anti-tumor effect of traditional Chinese medicine was carried out to summarize the anti-tumor mechanisms of traditional Chinese medicine. This review is expected to promote the wide application of traditional Chinese medicine in anti-tumor treatment worldwide and bring more hope and possibility to cancer patients.
5.Optimization Strategy and Practice of Traditional Chinese Medicine Compound and Its Component Compatibility
Zhihao WANG ; Wenjing ZHOU ; Chenghao FEI ; Yunlu LIU ; Yijing ZHANG ; Yue ZHAO ; Lan WANG ; Liang FENG ; Zhiyong LI
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(1):299-310
Prescription optimization is a crucial aspect in the study of traditional Chinese medicine (TCM) compounds. In recent years, the introduction of mathematical methods, data mining techniques, and artificial neural networks has provided new tools for elucidating the compatibility rules of TCM compounds. The study of TCM compounds involves numerous variables, including the proportions of different herbs, the specific extraction parts of each ingredient, and the interactions among multiple components. These factors together create a complex nonlinear dose-effect relationship. In this context, it is essential to identify methods that suit the characteristics of TCM compounds and can leverage their advantages for effective application in new drug development. This paper provided a comprehensive review of the cutting-edge optimization experimental design methods applied in recent studies of TCM compound compatibilities. The key technical issues, such as the optimization of source material selection, dosage optimization of compatible herbs, and multi-objective optimization indicators, were discussed. Furthermore, the evaluation methods for component effects were summarized during the optimization process, so as to provide scientific and practical foundations for innovative research in TCM and the development of new drugs based on TCM compounds.
6.Imaging characteristics and surgical methods of pulmonary nodules located in external lung 1/3 group versus internal lung 2/3 group
Dehao LIU ; Liangzhong LIAO ; Puchen LI ; Yue LIU ; Lichun CHEN
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(02):180-184
Objective To compare the imaging characteristics and surgical methods of pulmonary nodules in the external 1/3 group and internal 2/3 group. Methods A retrospective analysis of clinical data from patients who underwent thoracoscopic preoperative CT-guided lung nodule localization at the Department of Radiology, the First Affiliated Hospital of Xiamen University from September 2020 to April 2022 was conducted. Results A total of 215 patients were enrolled (247 pulmonary nodules), including 70 males and 145 females, with a median age of 48 years. Based on the location of the nodules under CT guidance, those located in the external 1/3 area of the lung were classified into an external 1/3 group, while those located in the middle 1/3 and inner 1/3 areas were classified into an internal 2/3 group. There was no statistical difference between the two groups in terms of general clinical data, nature of pulmonary nodules, distribution of pulmonary nodules in lobes, localization time, or localization complications (P>0.05). However, there were statistical differences in the distance of pulmonary nodules from the pleura [0.6 (0.0-1.9) cm vs. 1.8 (0.0-4.5) cm, P<0.001], size of pulmonary nodules [0.7 (0.2-1.8) cm vs. 1.0 (0.2-2.0) cm, P<0.001], and surgical methods (P=0.002). In the external 1/3 group, 92.1% of nodules underwent thoracoscopic wedge resection, while fewer patients underwent other procedures; in the internal 2/3 group, 77.1% of nodules underwent thoracoscopic wedge resection, and 19.3% underwent segmentectomy. Conclusion The diameter of pulmonary nodules, the distance of pulmonary nodules from the pleura, and surgical methods differ between the external 1/3 group and internal 2/3 group. Thoracic surgeons can develop more precise surgical plans based on the location and size of pulmonary nodules.
7.Application of Aromatic Inhalation Therapy in Preventing Respiratory Infectious Diseases Based on the Theory of "Aromatics Acting on the Spleen"
Xinxin WU ; Yue ZHANG ; Xiaolei LI ; Haoyue LI ; Fang ZHANG ; Nanjiang YU ; ZHAOJING
Journal of Traditional Chinese Medicine 2025;66(4):432-436
Aromatic inhalation therapy is a key traditional Chinese medicine (TCM) approach for preventing respiratory infectious diseases. Its foundational theory, "aromatics acting on the spleen", is deeply rooted in TCM principles and supported by modern medical research. The theory posits that the aromatic properties of medicinals primarily act on the spleen, and the aromatic inhalation therapy achieved its protective effects by modulation of the spleen and spleen channel to enhance the regulation of wei qi, striae and interstices. In TCM, the spleen is considered the mother of the lungs, with the function of nurturing lung; it is also seen as the source of wei qi, responsible for external defense; and the root of healthy qi, forming the foundation of acquired (postnatal) constitution. Thus, preventive strategies for respiratory infectious diseases focus on strengthening the spleen. From a modern medical perspective, the spleen's role in regulating lung immune responses, the shared immune functions of the respiratory and gastrointestinal mucosa, and the spleen's overall immune modulation provide scientific evidence for using aromatic inhalation therapy to prevent respiratory infections. Additionally, aromatic inhalation therapy offers several advantages, including direct action, rapid onset, minimal side effects, controllable risks, convenience, and ease of dissemination, making it a practical and effective preventive measure for respiratory infectious diseases.
8.The mechanism of Prim-O-glucosylcimifugin in improving cholesterol metabolism in osteoarthritis chondrocytes via lncRNA NEAT1/miR-128-3p
Yanming LIN ; Haishui TU ; Shujie LAN ; Chao LI ; Shiyu LU ; Yue CHEN ; Changlong FU
Journal of Beijing University of Traditional Chinese Medicine 2025;48(1):55-67
Objective:
To investigate the mechanism of action of Prim-O-glucosylcimifugin (POG) to improve cholesterol metabolism in osteoarthritic (OA) chondrocytes based on the long noncoding RNA nuclear-enriched transcript 1 (lncRNA NEAT1)/microRNA-128-3p (miR-128-3p) pathway.
Methods:
For in vivo experiments, 60 mice were divided into the normal, sham operation, model, and POG groups using the random number table method, with 15 mice per group. The osteoarthritis mouse model was constructed using the modified Hulth method in the model and POG groups. Mice in the POG group were administered 30 mg/(kg·d)POG by gavage. The other groups were administered an equal amount of normal saline for 8 weeks. The cartilage tissue structure of mice in each group was observed using hematoxylin and eosin staining. Real-time PCR was used to detect changes in the lncRNA NEAT1 and miR-128-3p mRNA expression levels in the cartilage tissues of mice. Western blotting was used to detect the protein expressions of ATP-binding cassette transporter A1 (ABCA1), liver X receptor β (LXRβ), matrix metalloprotein-3 (MMP-3), and B-lymphoblastoma-2-associated X protein (Bax) in articular cartilage of mice. An enzyme-linked immunosorbent assay was used to measure the tumor necrosis factor-α (TNF-α) content in the synovial fluid of mice. A biochemical microplate assay was used to measure the total cholesterol level in the synovial fluid of mice. The in vitro experiments were divided into the negative control, interleukin-1β(IL-1β), IL-1β+ POG, IL-1β+ oe-lncRNA NEAT1, IL-1β+ oe-lncRNA NEAT1 + POG, IL-1β + miR-128-3p inhibition, and IL-1β+ miR-128-3p inhibition+ POG groups. An OA model was established by inducing chondrocytes with IL-1β for 24 h, and 90 mg/L of POG and miR-128-3p inhibitor(50 nmol/L) were administered for 48 h as an intervention. lncRNA NEAT1 expression in chondrocytes was detected using fluorescence in situ hybridization. A dual luciferase assay was used to detect the targeting relationship between lncRNA NEAT1 and miR-128-3p. Lentiviral plasmids overexpressing lncRNA NEAT1 were used to transfect mouse chondrocytes. Real-time PCR was used to detect the effect of lncRNA NEAT1 overexpression on the mRNA level of miR-128-3p in chondrocytes. Western blotting was used to detect ABCA1, LXRβ, MMP-3, and Bax protein expression in chondrocytes after lncRNA NEAT1 overexpression and miR-128-3p inhibition.
Results:
POG significantly reduced OA cartilage tissue damage. Compared with the model group, the lncRNA NEAT1 mRNA level decreased, whereas the miR-128-3p mRNA level increased in the cartilage tissue of the POG group (P<0.05). Compared with the model group, ABCA1 and LXRβ protein expression increased in the POG group, whereas MMP-3 and Bax protein expression decreased (P<0.05). The TNF-α levels decreased in the POG group compared to the model group (P<0.05). Compared with the model group, the total cholesterol level in the synovial fluid of the joint of mice in the POG group decreased (P<0.05). The mean fluorescence intensity of lncRNA NEAT1 in the IL-1β+ POG group decreased compared with the IL-1β group (P<0.05). The relative luciferase activity in the miR-128-3p mimics group bound to the lncRNA NEAT1-WT plasmid decreased compared with the miR-128-3p negative control group (P<0.05). The lncRNA NEAT1 mRNA levels decreased, whereas the miR-128-3p mRNA levels increased in the IL-1β+ oe-lncRNA NEAT1 + POG group compared with the IL-1β+ oe-lncRNA NEAT1 group (P<0.05). Compared with the IL-1β+ POG group, ABCA1 and LXRβ protein expression decreased, whereas MMP-3 and Bax protein expression increased (P<0.05).
Conclusion
POG mediates lncRNA NEAT1/miR-128-3p to improve cholesterol metabolism in OA chondrocytes.
9.Enzyme-directed Immobilization Strategies for Biosensor Applications
Xing-Bao WANG ; Yao-Hong MA ; Yun-Long XUE ; Xiao-Zhen HUANG ; Yue SHAO ; Yi YU ; Bing-Lian WANG ; Qing-Ai LIU ; Li-He ZHANG ; Wei-Li GONG
Progress in Biochemistry and Biophysics 2025;52(2):374-394
Immobilized enzyme-based enzyme electrode biosensors, characterized by high sensitivity and efficiency, strong specificity, and compact size, demonstrate broad application prospects in life science research, disease diagnosis and monitoring, etc. Immobilization of enzyme is a critical step in determining the performance (stability, sensitivity, and reproducibility) of the biosensors. Random immobilization (physical adsorption, covalent cross-linking, etc.) can easily bring about problems, such as decreased enzyme activity and relatively unstable immobilization. Whereas, directional immobilization utilizing amino acid residue mutation, affinity peptide fusion, or nucleotide-specific binding to restrict the orientation of the enzymes provides new possibilities to solve the problems caused by random immobilization. In this paper, the principles, advantages and disadvantages and the application progress of enzyme electrode biosensors of different directional immobilization strategies for enzyme molecular sensing elements by specific amino acids (lysine, histidine, cysteine, unnatural amino acid) with functional groups introduced based on site-specific mutation, affinity peptides (gold binding peptides, carbon binding peptides, carbohydrate binding domains) fused through genetic engineering, and specific binding between nucleotides and target enzymes (proteins) were reviewed, and the application fields, advantages and limitations of various immobilized enzyme interface characterization techniques were discussed, hoping to provide theoretical and technical guidance for the creation of high-performance enzyme sensing elements and the manufacture of enzyme electrode sensors.
10.Application of Recombinant Collagen in Biomedicine
Huan HU ; Hong ZHANG ; Jian WANG ; Li-Wen WANG ; Qian LIU ; Ning-Wen CHENG ; Xin-Yue ZHANG ; Yun-Lan LI
Progress in Biochemistry and Biophysics 2025;52(2):395-416
Collagen is a major structural protein in the matrix of animal cells and the most widely distributed and abundant functional protein in mammals. Collagen’s good biocompatibility, biodegradability and biological activity make it a very valuable biomaterial. According to the source of collagen, it can be broadly categorized into two types: one is animal collagen; the other is recombinant collagen. Animal collagen is mainly extracted and purified from animal connective tissues by chemical methods, such as acid, alkali and enzyme methods, etc. Recombinant collagen refers to collagen produced by gene splicing technology, where the amino acid sequence is first designed and improved according to one’s own needs, and the gene sequence of improved recombinant collagen is highly consistent with that of human beings, and then the designed gene sequence is cloned into the appropriate vector, and then transferred to the appropriate expression vector. The designed gene sequence is cloned into a suitable vector, and then transferred to a suitable expression system for full expression, and finally the target protein is obtained by extraction and purification technology. Recombinant collagen has excellent histocompatibility and water solubility, can be directly absorbed by the human body and participate in the construction of collagen, remodeling of the extracellular matrix, cell growth, wound healing and site filling, etc., which has demonstrated significant effects, and has become the focus of the development of modern biomedical materials. This paper firstly elaborates the structure, type, and tissue distribution of human collagen, as well as the associated genetic diseases of different types of collagen, then introduces the specific process of producing animal source collagen and recombinant collagen, explains the advantages of recombinant collagen production method, and then introduces the various systems of expressing recombinant collagen, as well as their advantages and disadvantages, and finally briefly introduces the application of animal collagen, focusing on the use of animal collagen in the development of biopharmaceutical materials. In terms of application, it focuses on the use of animal disease models exploring the application effects of recombinant collagen in wound hemostasis, wound repair, corneal therapy, female pelvic floor dysfunction (FPFD), vaginal atrophy (VA) and vaginal dryness, thin endometritis (TE), chronic endometritis (CE), bone tissue regeneration in vivo, cardiovascular diseases, breast cancer (BC) and anti-aging. The mechanism of action of recombinant collagen in the treatment of FPFD and CE was introduced, and the clinical application and curative effect of recombinant collagen in skin burn, skin wound, dermatitis, acne and menopausal urogenital syndrome (GSM) were summarized. From the exploratory studies and clinical applications, it is evident that recombinant collagen has demonstrated surprising effects in the treatment of all types of diseases, such as reducing inflammation, promoting cell proliferation, migration and adhesion, increasing collagen deposition, and remodeling the extracellular matrix. At the end of the review, the challenges faced by recombinant collagen are summarized: to develop new recombinant collagen types and dosage forms, to explore the mechanism of action of recombinant collagen, and to provide an outlook for the future development and application of recombinant collagen.


Result Analysis
Print
Save
E-mail