AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.

Objective To systematically evaluate the risk prediction models for anastomotic leakage (AL) in patients with esophageal cancer after surgery. Methods A computer-based search of PubMed, EMbase, Web of Science, Cochrane Library, Chinese Medical Journal Full-text Database, VIP, Wanfang, SinoMed and CNKI was conducted to collect studies on postoperative AL risk prediction model for esophageal cancer from their inception to October 1st, 2023. PROBAST tool was employed to evaluate the bias risk and applicability of the model, and Stata 15 software was utilized for meta-analysis. Results A total of 19 literatures were included covering 25 AL risk prediction models and 7373 patients. The area under the receiver operating characteristic curve (AUC) was 0.670-0.960. Among them, 23 prediction models had a good prediction performance (AUC>0.7); 13 models were tested for calibration of the model; 1 model was externally validated, and 10 models were internally validated. Meta-analysis showed that hypoproteinemia (OR=9.362), postoperative pulmonary complications (OR=7.427), poor incision healing (OR=5.330), anastomosis type (OR=2.965), preoperative history of thoracoabdominal surgery (OR=3.181), preoperative diabetes mellitus (OR=2.445), preoperative cardiovascular disease (OR=3.260), preoperative neoadjuvant therapy (OR=2.977), preoperative respiratory disease (OR=4.744), surgery method (OR=4.312), American Society of Anesthesiologists score (OR=2.424) were predictors for AL after esophageal cancer surgery. Conclusion At present, the prediction model of AL risk in patients with esophageal cancer after surgery is in the development stage, and the overall research quality needs to be improved.

Surgical treatment is one of the key approaches for non-small cell lung cancer (NSCLC). Regular postoperative follow-up is crucial for early detection and timely management of tumor recurrence, metastasis, or second primary tumors. A scientifically sound and reasonable follow-up strategy not only extends patient survival but also significantly improves quality of life, thereby enhancing overall prognosis. This consensus aims to build upon the previous version by incorporating the latest clinical research advancements and refining postoperative follow-up protocols for early-stage NSCLC patients based on different treatment modalities. It provides a scientific and practical reference for clinicians involved in the postoperative follow-up management of NSCLC. By optimizing follow-up strategies, this consensus seeks to promote the standardization and normalization of lung cancer diagnosis and treatment in China, helping more patients receive high-quality care and long-term management. Additionally, the release of this consensus is expected to provide insights for related research and clinical practice both domestically and internationally, driving continuous development and innovation in the field of postoperative management for NSCLC.

This article combined the pathogenic characteristics of "latent wind" with the theory of collateral diseases to clarify the pathological features of tumor blood vessels， including their active proliferation， high permeabi-lity， and promotion of metastasis. The theory framework of "latent wind in collaterals" as the tumor mechanism was proposed， which suggests that at the site of tumor lesions， the collaterals inherit the nature of latent wind to grow excessively， adopt an open and discharge nature to leak essence， and tumor toxins， characterized by their rapid movement and frequent changes， spread and metastasize， driving the progression of malignant tumors. Focusing on the fundamental pathogenesis of "latent wind in collaterals"， specific clinical treatment principles and methods centered on treating wind are proposed， including regulating qi and dispelling wind， clearing heat and extinguishing wind， unblocking collaterals and expelling wind， and reinforcing healthy qi to calm wind， so as to provide references for enhancing the precision of traditional Chinese medicine in treating malignant tumors.

On the premise of respecting the objective law of the occurrence and development of traditional Chinese medicine（TCM） dispensing granules， relevant national departments have gradually formed the research and formulation ideas of national drug standards for dispensing granules based on the experiences and lessons learned in the development process of quality standards， as well as the formation mechanism of national standards for dispensing granules. This has certain reference significance for the formulation path of TCM quality standards. Combined with the general situation of the published standards and specific cases， the research concepts of the national standards for dispensing granules were analyzed and summarized in this paper， and the analysis of the technical characteristics of the issued national standards was focused， including the introduction of standard decoction， the overall quality control of TCM， the whole process quality control and other research ideas. At the same time， it summarized the industry common problems in the research and development process of national standards for dispensing granules， such as the source and process control of medicinal materials， and strived to solve them together， encouraging the demonstration and application of new technological means in the field of TCM dispensing granules. Finally， based on the literature analysis， the shortcomings of the current national standards were discussed， and relevant suggestions were put forward to further improve the national standards for dispensing granules. Through the overall analysis， it is helpful to comprehensively understand the technical characteristics of the national standards for TCM dispensing granules， and provide reference for the scientific exploration and practice of quality control methods for TCM.

ObjectiveThis study leverages structural data from antigen-antibody complexes of the influenza A virus neuraminidase (NA) protein to investigate the spatial recognition relationship between the antigenic epitopes and antibody paratopes. MethodsStructural data on NA protein antigen-antibody complexes were comprehensively collected from the SAbDab database, and processed to obtain the amino acid sequences and spatial distribution information on antigenic epitopes and corresponding antibody paratopes. Statistical analysis was conducted on the antibody sequences, frequency of use of genes, amino acid preferences, and the lengths of complementarity determining regions (CDR). Epitope hotspots for antibody binding were analyzed, and the spatial structural similarity of antibody paratopes was calculated and subjected to clustering, which allowed for a comprehensively exploration of the spatial recognition relationship between antigenic epitopes and antibodies. The specificity of antibodies targeting different antigenic epitope clusters was further validated through bio-layer interferometry (BLI) experiments. ResultsThe collected data revealed that the antigen-antibody complex structure data of influenza A virus NA protein in SAbDab database were mainly from H3N2, H7N9 and H1N1 subtypes. The hotspot regions of antigen epitopes were primarily located around the catalytic active site. The antibodies used for structural analysis were primarily derived from human and murine sources. Among murine antibodies, the most frequently used V-J gene combination was IGHV1-12*01/IGHJ2*01, while for human antibodies, the most common combination was IGHV1-69*01/IGHJ6*01. There were significant differences in the lengths and usage preferences of heavy chain CDR amino acids between antibodies that bind within the catalytic active site and those that bind to regions outside the catalytic active site. The results revealed that structurally similar antibodies could recognize the same epitopes, indicating a specific spatial recognition between antibody and antigen epitopes. Structural overlap in the binding regions was observed for antibodies with similar paratope structures, and the competitive binding of these antibodies to the epitope was confirmed through BLI experiments. ConclusionThe antigen epitopes of NA protein mainly ditributed around the catalytic active site and its surrounding loops. Spatial complementarity and electrostatic interactions play crucial roles in the recognition and binding of antibodies to antigenic epitopes in the catalytic region. There existed a spatial recognition relationship between antigens and antibodies that was independent of the uniqueness of antibody sequences, which means that antibodies with different sequences could potentially form similar local spatial structures and recognize the same epitopes.

BACKGROUND:Titanium implants are widely used in clinical practice because of their high strength and good biocompatibility.However,during implantation,bacterial infection and tissue damage environment produce a large number of reactive oxygen species,which can easily lead to delayed tissue healing and surgical failure.Consequently,the development of titanium implants with antimicrobial and antioxidant properties becomes paramount. OBJECTIVE:Considering the potent antimicrobial attributes of copper ions and the remarkable antioxidant qualities of polyphenols,we proposed the fabrication of polyphenol-mediated copper ion coatings on titanium surfaces.These coatings were subsequently assessed for their in vitro antimicrobial and antioxidant properties. METHODS:Nanostructures were generated on the titanium surface using the alkali thermal method.The titanium was immersed in a solution containing tannic acid and copper ions to achieve polyphenol-mediated copper ion coatings.The surface morphology and water contact angle were detected.The loading and release of copper ions were examined using atomic absorption spectroscopy.Staphylococcus aureus was inoculated on the surface of pure titanium sheet(blank group),alkali heat treated titanium sheet(control group),and polyphenol mediated copper ion modified titanium sheet(experimental group)to observe the bacterial survival status.Osteoblast precursor cells MC3T3-E1 were co-cultivated on the surface of three groups of titanium sheets to assess their antioxidant properties and bioactivity. RESULTS AND CONCLUSION:(1)Scanning electron microscopy showed that the polyphenol-mediated copper ion modified titanium sheet had rod-like nanostructures and no cracks on the surface.The surface hydrophilicity of copper ion modified titanium sheet mediated by polyphenol was close to that of pure titanium sheet.Atomic absorption spectrometry results showed a 51%increase in the loading capacity of copper ions after polyphenol mediation,with a uniform release of copper ions.(2)The antibacterial rates of titanium sheets in the blank group,control group,and experimental group were 0%,21.65%,and 93.75%,respectively.The live/dead staining and CTC staining showed that the live bacteria on the surface of titanium plates in the blank group were the most,and the live bacteria on the surface of titanium plates in the experimental group were the least.(3)The results of live/dead staining and CCK-8 assay showed that the three groups of titanium sheets had good cytocompatibility,and the titanium sheets in the experimental group were more conducive to the proliferation of MC3T3-E1 cells.Active oxygen fluorescence probe detection exhibited that compared with the other two groups,the fluorescence intensity of active oxygen on the surface of the experimental group was significantly reduced.The results of alkaline phosphatase and alizarin red S staining showed that the osteogenic differentiation and extracellular matrix mineralization of MC3T3-E1 cells on the surface of titanium sheets in the experimental group were stronger than those in the other two groups.(4)These results show that the polyphenol-mediated copper ion coating has strong antibacterial and antioxidant properties and promotes osteogenic differentiation.

This study aims to investigate the potential effect of the water extract of fresh Rehmanniae Radix on hypercholesterolemia in mice that was induced by a high-fat and high-cholesterol diet and explore its possible mechanism from bile acid reabsorption. Male C57BL/6 mice were randomly assigned into the following groups: control, model, low-and high-dose(4 and 8 g·kg~(-1), respectively) fresh Rehmanniae Radix, and positive drug(simvastatin, 0.05 g·kg~(-1)). Other groups except the control group were fed with a high-fat and high-cholesterol diet for 6 consecutive weeks to induce hypercholesterolemia. From the 6th week, mice were administrated with corresponding drugs daily via gavage for additional 6 weeks, while continuing to be fed with a high-fat and high-cholesterol diet. Serum levels of total cholesterol(TC), triglycerides(TG), low density lipoprotein-cholesterol(LDL-c), high density lipoprotein-cholesterol(HDL-c), and total bile acid(TBA), as well as liver TC and TG levels and fecal TBA level, were determined by commercial assay kits. Hematoxylin-eosin(HE) staining, oil red O staining, and transmission electron microscopy were performed to observe the pathological changes in the liver. Three livers samples were randomly selected from each of the control, model, and high-dose fresh Rehmanniae Radix groups for high-throughput transcriptome sequencing. Differentially expressed genes were mined and KEGG pathway enrichment analysis was performed to predict the key pathways and target genes of the water extract of fresh Rehmanniae Radix in the treatment of hypercholesterolemia. RT-qPCR was employed to measure the mRNA levels of cholesterol 7α-hydroxylase(CYP7A1) and cholesterol 27α-hydroxylase(CYP27A1) in the liver. Western blot was employed to determine the protein levels of CYP7A1 and CYP27A1 in the liver as well as farnesoid X receptor(FXR), apical sodium-dependent bile acid transporter(ASBT), and ileum bile acid-binding protein(I-BABP) in the ileum. The results showed that the water extract of fresh Rehmanniae Radix significantly lowered the levels of TC and TG in the serum and liver, as well as the level of LDL-c in the serum. Conversely, it elevated the level of HDL-c in the serum and TBA in feces. No significant difference was observed in the level of TBA in the serum among groups. HE staining, oil red O staining, and transmission electron microscopy showed that the water extract reduced the accumulation of lipid droplets in the liver. Further mechanism studies revealed that the water extract of fresh Rehmanniae Radix significantly down-regulated the protein levels of FXR and bile acid reabsorption-related proteins ASBT and I-BABP. Additionally, it enhanced CYP7A1 and CYP27A1, the key enzymes involved in bile acid synthesis. Therefore, it is hypothesized that the water extract of fresh Rehmanniae Radix may exert an anti-hypercholesterolemic effect by regulating FXR/ASBT/I-BABP signaling, inhibiting bile acid reabsorption, and increasing bile acid excretion, thus facilitating the conversion of cholesterol to bile acids.
Animals ; Male ; Bile Acids and Salts/metabolism* ; Mice, Inbred C57BL ; Mice ; Diet, High-Fat/adverse effects* ; Cholesterol/metabolism* ; Drugs, Chinese Herbal/administration & dosage* ; Hypercholesterolemia/genetics* ; Receptors, Cytoplasmic and Nuclear/genetics* ; Rehmannia/chemistry* ; Liver/drug effects* ; Humans ; Cholesterol 7-alpha-Hydroxylase/genetics* ; Plant Extracts

The persistent high prevalence and poor survival outcomes of lung cancer underscore the urgent need for innovative therapeutic modalities. Here, we present a novel multifunctional delivery platform for the synergistic treatment of lung malignancies, combining in situ-triggerable photodynamic therapy (PDT) with radiotherapy. The new platform CLL was developed by loading a new reactive oxygen species (ROS)-triggerable photosensitizer, luminol-conjugated chlorin e6 (Ce6), into liposomes. CLL can be activated through the bioluminescence resonance energy transfer effect under oxidative stress, thereby producing singlet oxygen for targeted tumor treatment without external irradiation. In vitro studies showed significant cytotoxic effects of CLL in both 4T1 and A549 tumor cells. Furthermore, a PDT-radiopharmaceutical combination nanotherapy CLL-¹⁷⁷Lu was engineered by incorporating the radionuclide ¹⁷⁷Lu into CLL. CLL-¹⁷⁷Lu demonstrated synergistic antitumor effects in 4T1 and A549 tumor cells, as well as in mouse models of 4T1 breast cancer lung metastasis or A549 tumor xenografts. Mechanistically, CLL-¹⁷⁷Lu can induce singlet oxygen/ROS generation, enhance tumor cell apoptosis, and promote M1 macrophage-mediated immunotherapy. Preliminary assessments showed a favorable profile for CLL-¹⁷⁷Lu, highlighting its potential as a promising nanotherapy for cancer treatment. Additionally, CLL can serve as a versatile platform for delivering a range of therapies to achieve synergistic antitumor effects.