AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveThis paper aims to observe the protective effect of Huamoyan granules on knee osteoarthritis （KOA） and explore whether its protective effect is oriented toward an anti-inflammatory direction by regulation of macrophage polarization， which can effectively inhibit the progression of pathological inflammatory response， reduce the release of inflammatory pain mediators， and downregulate the protein expression level of transient receptor potential vanilloid 1 （TRPV1）， so as to provide experimental evidence for its clinical application and investigate its action mechanism. MethodsAfter adaptive feeding， Sprague-Dawley （SD） rats were randomly divided into six groups： sham group， model group， celecoxib group， and high， medium， and low-dose synovitis granule groups （9.6， 4.8， 2.4 g·kg^-1）. The administration dose of celecoxib capsules was 20 mg·kg^-1. There were 10 rats in the sham group and 12 rats in the model group and each administration group. A KOA animal model was established by means of intra-articular injection of sodium iodoacetate into the knee joint. From the 10^th day of the experiment， each administration group was given intragastric administration at a dose of 10 mL·kg^-1 for 4 weeks. General conditions of rats in each group were assessed daily. The pressure pain threshold （PPT） to mechanical stimulation and joint diameter were recorded. X-ray examination was performed on the right knee joints of rats for imaging analysis. Enzyme linked immunosorbent assay （ELISA） was performed to detect the tumor necrosis factor-α （TNF-α）， serum interleukin-1β （IL-1β）， and other pro-inflammatory cytokines in rat serum samples， as well as the expression levels of neurogenic inflammatory mediators such as nerve growth factor （NGF） and calcitonin gene-related peptide （CGRP）. Histopathological changes in the knee joint synovial tissues were examined by hematoxylineosin （HE） staining. Safranin O-fast green staining was performed to observe and evaluate the degree of knee cartilage lesions. Western blot was employed to quantitatively analyze TRPV1， p38 mitogen-activated protein kinase （p38 MAPK）， and phosphorylated （p）-p38 MAPK in rat knee synovial tissues. Immunofluorescence （IF） was used to measure and assess M1/M2 macrophage polarization. ResultsCompared with those in the sham group， the circumference and joint diameter of the right knee were markedly enlarged in the model group （P<0.01）， while PPTs of rats showed a significant reduction （P<0.01）. The contents of IL-1β， TNF-α， CGRP， and NGF in rats' serum were significantly elevated （P<0.01）， and the synovial Krenn score was increased （P<0.01）. The Mankin score of cartilage tissue was increased （P<0.01）， and the protein expressions of TRPV1 and p-p38 MAPK/p38 MAPK were significantly upregulated （P<0.01）. The experimental intervention significantly reduced the proportion of pro-inflammatory M1 macrophages in the total macrophage population （P<0.01）， and the percentage of M2 macrophages was decreased （P<0.01）. The M1/M2 macrophage ratio was significantly elevated （P<0.01）. Knee joint diameters of all dose groups of Huamoyan granules and the celecoxib group were reduced （P<0.01） compared with those of the model group， and the PPT recovery speeds in the high and medium-dose groups of Huamoyan granules were more obvious （P<0.05）. The contents of IL-1β， CGRP， and NGF in the rats' serum in all administration groups were significantly reduced （P<0.05， P<0.01）， and the content of TNF-α in rats' serum was significantly reduced （P<0.01）. All dose groups of Huamoyan granules demonstrated significant reductions in both synovial Krenn score （P<0.05， P<0.01） and protein expression of TRPV1 and p-p38 MAPK/p38 MAPK in rats' synovial tissues （P<0.01）. The percentage of M1 macrophages in the synovial tissues of the celecoxib group and all dose groups of Huamoyan granules was decreased （P<0.01）. The percentage of M2 macrophages was increased （P<0.05）， and the M1/M2 ratio was decreased （P<0.01）. ConclusionHuamoyan granules can alleviate the inflammatory response of KOA， reduce the release of inflammatory pain mediators， and downregulate TRPV1 protein expression by regulating macrophage polarization. Its mechanism may be related to the TRPV1/p38 MAPK signaling pathway， thereby achieving the effect of improving peripheral pain hypersensitivity in KOA.

Dry eye disease(DED)and depression(DEP), though anatomically and clinically distinct, show significant epidemiological, pathophysiological, and prognostic interplay. Their co-occurrence has risen sharply in recent years, yet the mechanisms driving this comorbidity remain under-investigated. This review systematically synthesizes current evidence, highlighting that pro-inflammatory cytokines, neuro-regulatory imbalance, mitochondrial dysfunction, and gut-microbiota dysbiosis constitute a shared molecular network, while sleep deprivation and antidepressant use further amplify the vicious cycle. By identifying limitations in existing studies, this review proposes future research directions to offer new theoretical and clinical insights for managing DED-DEP comorbidity.

AIM: To explore the factors associated with significant corneal astigmatism during the perioperative period in patients with pterygium. METHODS: Patients with primary pterygium presenting at Shanxi Eye Hospital between February and June 2025 were enrolled. All patients underwent medical history collection. Pre- and postoperative data were obtained using Pentacam, anterior segment photography, Image J software, and anterior segment optical coherence tomography(AS-OCT). All patients underwent pterygium excision combined with autologous bulbar conjunctival flap transplantation under local infiltration anesthesia. RESULTS: A total of 76 patients(76 eyes)with pterygium were finally enrolled(30 males, 46 females)with a mean age of 62.2±8.2 y. The mean length of corneal invasion by pterygium was 3.61±0.89 mm, the mean depth of invasion into the anterior corneal surface was 0.15±0.09 mm, and the median area of corneal invasion was 10.25(6.90, 18.75)mm2. The median preoperative corneal astigmatism was 1.50(0.70, 5.45)D. Median astigmatism was 0.8(0.40, 1.28)D at 2 wk postoperatively and 0.60(0.30, 1.15)D at 1 mo postoperatively. Patient age showed a positive correlation with preoperative astigmatism, and with residual astigmatism at 2 wk and 1 mo postoperatively(all P<0.05). The length of corneal invasion was positively correlated with preoperative astigmatism and residual astigmatism at both postoperative timepoints(P<0.01). The depth of invasion showed no significant linear correlation with astigmatism at any stage(P=0.250, 0.761, 0.686). The area of corneal invasion was positively correlated with astigmatism at all stages(P<0.01). Patients were grouped based on significant astigmatism(≥1.0 D)and non-significant astigmatism(<1.0 D), after adjusting for other variables, age(P=0.031)and the area of corneal invasion(P=0.004)were identified as risk factors for significant astigmatism. Pterygium invasion length was not significant factors(P>0.05). Receiver operating characteristic(ROC)analysis showed the highest area under the curve(AUC)for the invasion area(AUC=0.915). CONCLUSION: Significant preoperative corneal astigmatism in pterygium patients is correlated with patient age, the length of corneal invasion, and the area of invasion. The area of pterygium invasion into the cornea is the strongest predictor of significant preoperative corneal astigmatism.

BackgroundThe violent aggressive behaviors of patients with schizophrenia usually have the characteristics of suddenness， unpredictability， high severity， and great difficulty in prevention. Early identification and accurate assessment of their risk of violent aggression have significant clinical significance. ObjectiveTo construct a predictive model for the violence risk in hospitalized patients with schizophrenia， to identify the key factors influencing the occurrence of violent behavior in these patients， so as to provide references for clinical precise quantitative assessment and early intervention. MethodsA total of 200 patients with schizophrenia who were hospitalized at Taiyuan Psychiatric Hospital from March 2022 to September 2024 and met the diagnostic criteria of the International Classification of Diseases， eleventh edition （ICD-11） were collected to form the modeling cohort. They were randomly divided into a training set （n=140） and a test set （n=60） at a ratio of 7∶3. Based on the least absolute shrinkage and selection operator （LASSO） regression algorithm， the feature variables were screened and dimension-reduced. The support vector machine （SVM） from machine learning was selected for model training and prediction. The discrimination efficacy of the model was evaluated by the area under the receiver operating characteristic （ROC） curve （AUC）， accuracy， precision， sensitivity， specificity， F1 value， and Brier value. ResultsLASSO regression screening identified 16 feature variables. Pearson correlation analysis revealed a positive correlation between prior violent behavior frequency and clinical psychiatric symptom scores （r=0.580， P<0.01）， a positive correlation between hospitalization compliance and current disease status （r=0.550， P=0.003）， and a positive correlation between educational level and family per capita monthly income （r=0.367， P<0.01）. The SVM model achieved an AUC of 0.853， accuracy of 0.800， precision of 0.810， sensitivity of 0.895， specificity of 0.636， F1 value of 0.850， and Brier value of 0.168. ConclusionThe SVM model has a relatively high level of applicability and overall predictive performance in the assessment of violent risk in schizophrenia patients， which is helpful for the early identification of violent risks in such patients. ［Funded by Specialized Research Project for Enhancing the Competence of Health Professionals in Taiyuan City （number， Y2023006）］

Objective To investigate the expression of carcinoembryonic antigen-related cell adhesion molecule 6 (CEACAM6) in esophageal squamous cell carcinoma (ESCC) and analyze its correlation with immune cell infiltration and patient prognosis. Methods Three ESCC datasets (GSE161533, GSE26886, and GSE23400) from the GEO database were analyzed to identify differentially expressed genes. CEACAM6 was identified as a key gene through survival analysis. Its expression, prognostic value, and relationship with immune cell infiltration were further explored using databases, such as TIMER. Tissue samples were collected from 162 patients with ESCC. Immunohistochemistry was performed to detect the expression of CEACAM6, immune cell markers (CD4, CD8, CD20, and CD56), and immune checkpoint molecules (HHLA2 and CD40LG). Correlations between CEACAM6 expression and clinicopathological features, immune cell infiltration, and immune checkpoints were analyzed. Results Bioinformatic analysis and clinical sample validation confirmed that CEACAM6 expression was significantly upregulated in ESCC tissues compared with adjacent nontumor tissues (P<0.05). High CEACAM6 expression was closely associated with advanced clinical stage (AJCC Ⅲ-Ⅳ), high T stage (T3-T4), lymph node metastasis, nonulcerative type, and poor prognosis. Furthermore, CEACAM6 expression levels were positively correlated with the infiltration density of CD8⁺ T cells, CD4⁺ T cells, and CD20⁺ B cells within the tumor microenvironment and with the expression of the immune checkpoint molecules HHLA2 and CD40LG (all P<0.05). Conclusion CEACAM6 serves as an independent poor prognostic factor for ESCC. Its high expression is implicated in the modulation of the tumor immune microenvironment by correlating with specific immune cell infiltration and immune checkpoint molecules, suggesting its potential as a novel prognostic biomarker and immunotherapeutic target for ESCC.

ObjectiveTo develop a standardized classification model for traditional Chinese medicine （TCM） syndrome patterns of mixed hemorrhoids using multi-center real-world data， and unveil their distribution patterns and core risk factors， thereby providing evidence-based support for standardizing TCM syndrome differentiation and implementing precision interventions. MethodsA multi-center cross-sectional study was conducted， enrolling 13 283 mixed hemorrhoid patients from eight hospitals in Jiangsu Province between September 1st， 2023 and December 31st， 2024. DeepSeek-R1-Distill-Qwen-7B and LLaMA-3.3 large language models （LLM） were integrated with latent class analysis （LCA） to perform unsupervised learning and latent class modeling of TCM symptomatology. Potential risk factors were screened via univariate analysis， followed by logistic regression to identify independent risk factors for each syndrome pattern. ResultsThe model's performance indicators were stable and reliable across different clinical data types，i.e. in the outpatient records， past medical history （F1=99.7%）， current medical history （F1=94.9%）， and specialist examination （F1=90.7%）； in inpatient records， past medical history （F1=98.2%）， current medical history （F1=91.2%）， specialist examination （F1=90.3%）， and discharge status （F1=90.6%）. Latent class mode-ling identified four core TCM syndrome patterns including spleen deficiency and qi sinking syndrome （915 cases， 6.89%）， damp-heat pouring downward syndrome （10 820 cases， 81.46%）， qi stagnation and blood stasis syndrome （1252 cases， 9.43%）， and wind injuring intestinal collaterals syndrome （296 cases， 2.22%）， with respective latent class probabilities of 0.069， 0.815， 0.094， and 0.022. Logistic regression demonstrated that gender， age， disease duration， hypertension， diabetes， hyperlipidemia， constipation， smoking history， and alcohol consumption were independent risk factors for pattern differentiation （P＜0.05）. The efficacy validation evaluation revealed that the cure rates for patients with spleen deficiency and qi sinking syndrome and qi stagnation and blood stasis syndrome were higher than those for patients with damp-heat pouring downward syndrome （adjusted P＜0.05）， with no statistically significant differences among other syndrome patterns. ConclusionDamp-heat pouring downward syndrome is the predominant syndrome in mixed hemorrhoids. Gender， age， disease duration， hypertension， diabetes， hyperlipi-demia， constipation， smoking history， and alcohol consumption are independent risk factors for the differentiation of syndrome types.

OBJECTIVE To form an expert consensus on the clinical application of parenteral direct thrombin inhibitors （DTIs） in patients during the perioperative period. METHODS Led by Sichuan Academy of Medical Sciences & Sichuan Provincial People’s Hospital （the Affiliated Hospital of UESTC）， a multidisciplinary working group was established. Through literature review and the Delphi method， clinical questions related to the rational perioperative use of parenteral DTIs were identified. A structured design was adopted using the “Population-Intervention-Comparison-Outcome” framework； systematic searches were conducted in CNKI， Medline， Embase and other databases. Relevant evidence from randomized controlled trials and cohort studies was included and synthesized. Evidence quality was assessed using the Grades of Recommendations Assessment，Development and Evaluation （GRADE） approach， and recommendations were formulated through multiple rounds of Delphi surveys and expert consensus meetings. RESULTS &CONCLUSIONS Seven recommendations （each with an expert consensus rate exceeding 90%） on the use of parenteral DTIs in perioperative patients were developed. These recommendations specify drug selection， dosing ranges， key monitoring points， and safety management strategies for parenteral DTIs in various scenarios， including the perioperative period of ventricular assist device implantation， the perioperative period of cardiac surgery， perioperative patients with lower-extremity atherosclerotic disease， the perioperative period of percutaneous coronary intervention in patients with acute coronary syndrome， the perioperative period of carotid artery stenting in patients with carotid stenosis， the perioperative period of patients with right heart thrombosis， and patients who develop related thrombosis and dysfunction after a central venous catheter insertion. In addition， warning and management pathways for perioperative bleeding and thrombotic events were proposed. This expert consensus， which is formulated based on the best available evidence， provides evidence-based guidance for standardized and individualized use of parenteral DTIs in perioperative period.

Background Work-related musculoskeletal disorders (WMSDs) are a major occupational health concern, particularly among workers exposed to adverse ergonomic conditions. Manganese production involves heavy physical demands, yet research on WMSDs among manganese workers remains limited. Objective To investigate the prevalence and influencing factors of WMSDs among manganese workers in a manganese enterprise in Guangxi. Methods A cross-sectional survey was conducted from May to June 2024 on workers at a manganese factory in Guangxi. The Chinese Musculoskeletal Disorders Questionnaire was used to collect information on demographic characteristics, distribution of musculoskeletal symptoms, and work-related exposures. χ² test was applied to compare differences in positive WMSDs rates across groups, and logistic regression analysis was performed to identify associated factors. Results A total of 1476 workers were enrolled in the study after pre-determined inclusion and exclusion criteria. The overall prevalence of WMSDs was 34.15%. The most commonly affected body regions were the lower back (17.28%), neck (16.67%), and shoulders (13.82%). The results of logistic regression analysis indicated that female, older age, and education level of college or above were associated with a higher risk of WMSDs (P<0.05). Awkward working postures were significantly associated with WMSDs in corresponding body regions; in particular, awkward postures of the neck, upper limbs, trunk, and lower limbs were related to an increased risk of WMSDs in multiple body sites (P<0.05). In addition, poor lighting conditions, high workplace temperature, frequent or sustained arm support during work, and high job demands were associated with an increased risk of overall or site-specific WMSDs (P<0.05). Conclusion The high prevalence of WMSDs among manganese workers is closely associated with demographic characteristics, working postures, and work environment and organizational factors. Targeted ergonomic interventions focusing on high-risk body regions and key ergonomic exposures are warranted to reduce the risk of WMSDs among manganese workers.

BACKGROUND:Cervical disc herniation can cause pain in the neck and shoulder area,as well as radiating pain in the upper limbs.The incidence rate is increasing year by year and tends to affect younger individuals.Fully understanding the biomechanical characteristics of the cervical spine in adolescents is of great significance for preventing and delaying the onset of cervical disc herniation in this age group. OBJECTIVE:To reconstruct cervical spine models for both healthy adolescents and adolescent patients with cervical disc herniation utilizing finite element analysis techniques,to analyze the motion range of the C1-T1 cervical vertebrae as well as the biomechanical characteristics of the annulus fibrosus,nucleus pulposus,endplates,and the cartilage of the small joints. METHODS:A normal adolescent's cervical spine and an adolescent patient with cervical disc herniation were selected in this study.The continuous scan cervical spine CT raw image data were imported into Mimics 21.0 in DICOM format.The C1-T1 vertebrae were reconstructed separately.Subsequently,the established models were imported into the 3-Matic software for disc reconstruction.The perfected models were then imported into Hypermesh software for meshing of the vertebrae,nucleus pulposus,annulus fibrosus,and ligaments,creating valid geometric models.After assigning material properties,the final models were imported into ABAQUS software to observe the joint motion range of the C1-C7 cervical vertebrae segments under different conditions,and to analyze the biomechanical characteristics of the annulus fibrosus,nucleus pulposus,endplates,and small joint cartilage of each cervical spine segment. RESULTS AND CONCLUSION:(1)In six different conditions,the joint motion range of the C1 vertebra in the cervical spine models of both normal adolescent and adolescent patient with cervical disc herniation was higher than that of the other vertebrae.Additionally,the joint motion range of each cervical spine segment in normal adolescent was greater than that in adolescent patient with cervical disc herniation.(2)In the cervical spine model of normal adolescent,the maximum stress values in the annulus fibrosus and nucleus pulposus were found on the left side during C2-3 flexion conditions(0.43 MPa and 0.17 MPa,respectively).In the cervical spine model of adolescent patient with cervical disc herniation,the maximum stress values were found on the left side during C7-T1 flexion conditions(0.54 MPa and 0.18 MPa,respectively).(3)In the cervical spine model of normal adolescent,the maximum stress value on the endplate was found on the left side of the upper endplate of C3 during flexion conditions(1.46 MPa).In the model of adolescent patient with cervical disc herniation,the maximum stress value on the endplate was found on the left side of the lower endplate of C7 during flexion conditions(1.32 MPa).(4)In the cervical spine model of normal adolescent,the maximum stress value in the small joint cartilage was found in the C2-3 left rotation conditions(0.98 MPa).In adolescent patient with cervical disc herniation,the stress in the small joint cartilage significantly increased under different conditions,especially in C1-2,with the maximum stress found during left flexion(3.50 MPa).(5)It is concluded that compared to normal adolescent,adolescent patient with cervical disc herniation exhibits altered cervical curvature and a decrease in overall joint motion range in the cervical spine.In adolescent with cervical disc herniation,there is a significant increase in stress on the annulus fibrosus,nucleus pulposus,and endplates in the C7-T1 segment.The stress on the left articular cartilage of the C1-2 is notable.Abnormal cervical curvature may be the primary factor causing these stress changes.