ObjectiveTo investigate the therapeutic effects and mechanism of decoctions from four kinds of processed products of Aconiti Radix Lateralis Praeparata（ARLP） in deficiency-cold syndrome. MethodsA total of 36 SD rats were randomly divided into the control group， model group， Shengfupian（SFP） group， Paofuzi（PFZ） group， Heishunpian（HSP） group and Paofupian（PFP） group with 6 rats in each group. Except for the control group， rats in other groups were administered hydrocortisone sodium succinate via intramuscular injection to induce a cold deficiency syndrome model. After 14 consecutive days， each ARLP decoction pieces was administered via continuous gastric lavage at a dose of 12 g·kg^-1·d^-1 for 7 d， while the control and model groups received an equivalent volume of physiological saline. After the end of administration， body weight， spleen weight and thymus weight were measured for calculating the spleen and thymus indexes. Hematoxylin-eosin（HE） staining was used to observe the pathological morphology of adrenal tissue. The fully automatic biochemistry analyzer was used to measure the total cholesterol（TC）， triglyceride（TG）， lactic dehydrogenase（LDH） and lactate（LAC） levels in serum. Enzyme-linked immunosorbent assay（ELISA） was employed to measure the contents of 17-hydroxycorticosteroid（17-OHCS）， cortisol（CORT）， triiodothyronine（T₃）， thyroxine（T₄）， thyrotropin（TSH）， immunoglobulin（Ig） M， IgG， cyclic adenosine monophosphate（cAMP） and cyclic guanosine monophosphate（cGMP）. Western blot was used to measure the protein expression levels of protein kinase A（PKA）， cAMP response element-binding protein（CREB）， silent information regulator 1（Sirt1） and peroxisome proliferator-activated receptor γ coactivator-1α（PGC-1α）. And high performance liquid chromatography（HPLC） was used to determine the content of major alkaloids， followed by Pearson correlation analysis with pharmacodynamic indicators. ResultsAfter modeling， compare with the control group， the model rats exhibited symptoms such as lethargy and loose stools， mild abnormalities were observed in adrenal tissue structure， and both spleen and thymus indices were significantly reduced（P<0.01）. Thyroid， adrenal and immune system functions were suppressed， with decreased serum cAMP level and significantly elevated cGMP level（P<0.01）. Compared with the model group， the adrenal injury by hydrocortisone sodium succinate were repaired and the spleen index were increased significantly in all four ARLP groups（P<0.05， P<0.01）. The thymus index in SFP and PFZ groups were increased significantly（P<0.05）. The contents of T₃， TSH， 17-OHCS and CORT were increased significantly in SFP and PFZ groups（P<0.05）. In addition， the content of IgG in SFP， PFZ and PFP groups were increased significantly（P<0.01）， while the content of IgM in PFZ and HSP groups were also increased significantly（P<0.05）. Regarding the cyclic nucleotide system， PFZ significantly elevated cAMP level while reducing cGMP level（P<0.05）， exhibiting the most pronounced effect among the four decoction pieces. For energy metabolism indicators， PFZ significantly improved abnormal markers including TC， TG， LDH， and LAC（P<0.05）. HSP showed marked improvement effects on TG， LDH， and LAC（P<0.05）. Both PFZ and SFP significantly elevated the expression levels of PKA， CREB， Sirt1， and PGC-1α proteins（P<0.01）. Additionally， the diester alkaloids in ARLP showed a strong positive correlation with TG， IgG， and CORT， a strong negative correlation with LAC， a moderate positive correlation with T₄， and moderate negative correlations with cAMP and spleen index. Monomeric alkaloids showed strong positive correlations with TG and IgG， strong negative correlations with LAC， moderate positive correlations with CORT and T₄， and moderate negative correlations with cAMP and spleen index. However， the content of water-soluble alkaloids showed strong positive correlations with TC， LDH， 17-OHCS， T₃， TSH， and thymus index， moderate positive correlations with cAMP， CORT， T₄， and spleen index， and moderate negative correlation with cGMP. ConclusionAmong different processed ARLP decoction pieces， PFZ processed according to ZHANG Zhongjing's method exhibits the most potent warming and cold-dispelling effects. Its pharmacological actions are mediated through regulating the thyroid， adrenal， immune， cyclic nucleotide systems， and material-energy metabolism pathways. Among these， water-soluble alkaloids show strong or moderate correlations with more indicators of deficiency-cold syndrome and exhibit the highest content in PFZ. Therefore， PFZ processed according to ZHANG Zhongjing's method may exert its warming and cold-dispelling effects through water-soluble alkaloids.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

OBJECTIVE To explore a model for constructing a platform for medical institution formulation and provide insights for promoting their development. METHODS By systematically reviewing the development status and challenges of medical institution preparations in China， and based on the theory of industry-university-research collaborative innovation， the organizational structure， collaborative processes， and safeguard mechanisms of the platform were designed. RESULTS & CONCLUSIONS Medical institution formulations in China mainly faced challenges such as weak research and development （R&D） capacity， uneven quality standards， and blocked transformation pathways. This study established a full-chain， whole- industry collaborative innovation network covering the government， medical institutions， universities/research institutes， pharmaceutical enterprises， and the market， forming a new “government-industry-university-research-application” five-in-one platform model for medical institution formulations. By establishing mechanisms such as multi-entity collaborative cooperation， full- chain intellectual property management， contribution-based benefit distribution， staged risk-sharing， and third-party evaluation， the model clarified the responsibilities and collaborative pathways of all parties. The new model highlights the whole-process transformation of clinical experience-based prescriptions， enabling precise alignment between clinical needs and technological R&D， as well as between preparation achievements and industrial transformation. While breaking down the barriers of traditional platform construction， it effectively achieves optimal resource allocation and complementary advantages， addresses problems emerging in the development of medical institution preparations， and provides reference value for the formulation of relevant systems.

Oral squamous cell carcinoma (OSCC) is a common head and neck malignancy. Approximately 50% to 60% of patients with OSCC are diagnosed at a locally advanced stage (clinical staging III-IVa). Even with comprehensive and sequential treatment primarily based on surgery, the 5-year overall survival rate remains below 50%, and patients often suffer from postoperative functional impairments such as difficulties with speaking and swallowing. Programmed death receptor-1 (PD-1) inhibitors are increasingly used in the neoadjuvant treatment of locally advanced OSCC and have shown encouraging efficacy. However, clinical practice still faces key challenges, including the definition of indications, optimization of combination regimens, and standards for efficacy evaluation. Based on the latest research advances worldwide and the clinical experience of the expert group, this expert consensus systematically evaluates the application of PD-1 inhibitors in the neoadjuvant treatment of locally advanced OSCC, covering combination strategies, treatment cycles and surgical timing, efficacy assessment, use of biomarkers, management of special populations and immune related adverse events, principles for immunotherapy rechallenge, and function preservation strategies. After multiple rounds of panel discussion and through anonymous voting using the Delphi method, the following consensus statements have been formulated: 1) Neoadjuvant therapy with PD-1 inhibitors can be used preoperatively in patients with locally advanced OSCC. The preferred regimen is a PD-1 inhibitor combined with platinum based chemotherapy, administered for 2-3 cycles. 2) During the efficacy evaluation of neoadjuvant therapy, radiographic assessment should follow the dual criteria of Response Evaluation Criteria in Solid Tumors (RECIST) version 1.1 and immune RECIST (iRECIST). After surgery, systematic pathological evaluation of both the primary lesion and regional lymph nodes is required. For combination chemotherapy regimens, PD-L1 expression and combined positive score need not be used as mandatory inclusion or exclusion criteria. 3) For special populations such as the elderly (≥ 70 years), individuals with stable HIV viral load, and carriers of chronic HBV/HCV, PD-1 inhibitors may be used cautiously under the guidance of a multidisciplinary team (MDT), with close monitoring for adverse events. 4) For patients with a poor response to neoadjuvant therapy, continuation of the original treatment regimen is not recommended; the subsequent treatment plan should be adjusted promptly after MDT assessment. Organ transplant recipients and patients with active autoimmune diseases are not recommended to receive neoadjuvant PD-1 inhibitor therapy due to the high risk of immune related activation. Rechallenge is generally not advised for patients who have experienced high risk immune related adverse events such as immune mediated myocarditis, neurotoxicity, or pneumonitis. 5) For patients with a good pathological response, individualized de escalation surgery and function preservation strategies can be explored. This consensus aims to promote the standardized, safe, and precise application of neoadjuvant PD-1 inhibitor strategies in the management of locally advanced OSCC patients.

Surgical treatment is one of the key approaches for non-small cell lung cancer (NSCLC). Regular postoperative follow-up is crucial for early detection and timely management of tumor recurrence, metastasis, or second primary tumors. A scientifically sound and reasonable follow-up strategy not only extends patient survival but also significantly improves quality of life, thereby enhancing overall prognosis. This consensus aims to build upon the previous version by incorporating the latest clinical research advancements and refining postoperative follow-up protocols for early-stage NSCLC patients based on different treatment modalities. It provides a scientific and practical reference for clinicians involved in the postoperative follow-up management of NSCLC. By optimizing follow-up strategies, this consensus seeks to promote the standardization and normalization of lung cancer diagnosis and treatment in China, helping more patients receive high-quality care and long-term management. Additionally, the release of this consensus is expected to provide insights for related research and clinical practice both domestically and internationally, driving continuous development and innovation in the field of postoperative management for NSCLC.

OBJECTIVE To systematically evaluate risk prediction models for chemotherapy-induced myelosuppression in breast cancer， and provide a scientific reference for clinical healthcare workers in selecting or developing effective predictive models. METHODS A systematic search was conducted for studies on predictive models of the risk of chemotherapy-induced myelosuppression in breast cancer across the CNKI， VIP， Wanfang， PubMed， Web of Science， Cochrane Library， Embase， and Scopus databases， with a time frame of the establishment of the database to May 7， 2024. Literature was independently screened by 2 investigators， data were extracted according to critical appraisal and data extraction for systematic reviews of predictive model studies， and the risk of bias evaluation tool for predictive model studies was used to analyze the risk of bias and applicability of the included studies. RESULTS There were totally 7 studies， comprising 12 models. Among them， 11 models indicated an area under the subject operating characteristic curve of 0.600-0.908； 2 models indicated calibration. The common predictor variables of the included models were age， pre-chemotherapy neutrophil count， pre-chemotherapy lymphocyte count， and pre-chemotherapy albumin. The overall risk of bias of the 7 studies was high， which was mainly attributed to the flaws in the study design， insufficient sample sizes， inappropriate treatment of variables， non-reporting of missing data， and the lack of indicators for the assessment of the models， but the applicability was good. CONCLUSIONS The predictive performance of risk predictive models for chemotherapy-induced myelosuppression in breast cancer remains to be further enhanced， and the overall risk of model bias is high. Future studies should follow the specifications of model development and reporting， then combine machine learning algorithms to develop risk predictive models with good predictive performance， high stability， and low risk of bias， so as to provide a decision-making basis for the clinic.

BACKGROUND:Platelet-derived extracellular vesicles are the most abundant vesicles in the circulation,rich in bioactive molecules,genetic material,proteins and other information molecules,involved in cellular communication and material exchange,not only has good procoagulant activity,but also has the promotion of tissue repair and regeneration,and has a wide range of applications in regenerative medicine. OBJECTIVE:To elaborate the secretion mechanism of platelet-derived extracellular vesicles,their application in regenerative medicine,and limiting factors for clinical transformation,and to provide some theoretical support for the clinical translation of platelet-derived extracellular vesicles. METHODS:A computerized search of the PubMed database from January 2005 to August 2023 was applied to articles relating to platelet-derived extracellular vesicles with the search terms"platelet-derived,platelet-rich plasma,extracellular vesicles,isolated,microvesicles exosomes,applications".A total of 62 articles that met the subject criteria were finally included. RESULTS AND CONCLUSION:(1)Activated platelet-derived extracellular vesicles produce two types of vesicles,platelet-derived microparticles,whose secretion may be associated with the asymmetry of the actin cytoskeleton,and platelet-derived exosomes,which may be associated with the regulation of H+-ATPase.(2)Platelet-derived extracellular vesicles are potential effectors of platelet concentrates and platelets themselves,and may intervene in tissue regeneration by promoting angiogenesis,influencing cellular behavior,promoting coagulation and hemostasis,and exerting inflammatory effects.(3)Platelet-derived extracellular vesicles have been reported preclinically in the field of regenerative medicine such as tissue injury,muscle regeneration,cartilage regeneration,and osteoarthritis,and clinical trial data are available as potential therapeutic approaches for wound healing.However,factors such as isolation methods,sample sources,and the types of activators limit the clinical translation of platelet-derived extracellular vesicles into the field of regenerative medicine.(4)In the future,platelet-derived extracellular vesicles may become a cell-free alternative to platelet-rich plasma in regenerative medicine,but the clinical translation of platelet-derived extracellular vesicles needs to actively search for specific markers to differentiate platelet-derived microparticles from platelet-derived exosomes.The mechanism of activator-stimulated platelet-derived extracellular vesicle production,as well as the optimal method of platelet-derived extracellular vesicle collection,the optimal method of storage,the shelf life of the platelet-derived extracellular vesicles,the recommended dosage of platelet-derived extracellular vesicles for clinical application,and the optimal clinical indications need to be further investigated.

OBJECTIVE:The main clinical manifestations of knee osteoarthritis are pain,swelling,stiffness,and limited activity,which have a serious impact on the life of patients.Exercise therapy can effectively improve the related symptoms of patients with knee osteoarthritis.This paper uses the method of network meta-analysis to compare the efficacy of different exercise types in the treatment of knee osteoarthritis. METHODS:CNKI,WanFang,PubMed,Embase,Cochrane Library,Web of Science,Scopus,Ebsco,SinoMed,and UpToDate were searched with Chinese search terms"knee osteoarthritis,exercise therapy"and English search terms"knee osteoarthritis,exercise".Randomized controlled trials on the application of different exercise types in patients with knee osteoarthritis from October 2013 to October 2023 were collected.The outcome measures included visual analog scale,Western Ontario and McMaster Universities Osteoarthritis Index score,Timed Up and Go test,and 36-item short form health survey.Literature quality analysis was performed using the Cochrane Manual recommended tool for risk assessment of bias in randomized controlled trials.Two researchers independently completed the data collection,collation,extraction and analysis.RevMan 5.4 and Stata 18.0 software were used to analyze and plot the obtained data. RESULTS:A total of 29 articles with acceptable quality were included,involving 1 633 patients with knee osteoarthritis.The studies involved four types of exercise:aerobic training,strength training,flexibility/skill training,and mindfulness relaxation training.(1)The results of network meta-analysis showed that compared with routine care/health education,aerobic training could significantly improve pain symptoms(SMD=-3.26,95%CI:-6.33 to-0.19,P<0.05);strength training(SMD=-0.79,95%CI:-1.34 to-0.23,P<0.05)and mindfulness relaxation training(SMD=-0.79,95%CI:-1.23 to-0.34,P<0.05)could significantly improve the function of patients.Aerobic training(SMD=-1.37,95%CI:-2.24 to-0.51,P<0.05)and mindfulness relaxation training(SMD=-0.41,95%CI:-0.80 to-0.02,P<0.05)could significantly improve the functional mobility of patients.Mindfulness relaxation training(SMD=0.70,95%CI:0.21-1.18,P<0.05)and strength training(SMD=0.42,95%CI:0.03-0.81,P<0.05)could significantly improve the quality of life of patients.(2)The cumulative probability ranking results were as follows:pain:aerobic training(86.6%)>flexibility/skill training(60.1%)>strength training(56.8%)>mindfulness relaxation training(34.7%)>routine care/health education(11.7%);Knee function:strength training(73.7%)>mindfulness relaxation training(73.1%)>flexibility/skill training(56.1%)>aerobic training(39.9%)>usual care/health education(7.6%);Functional mobility:aerobic training(94.7%)>mindfulness relaxation training(65.5%)>strength training(45.1%)>flexibility/skill training(41.6%)>routine care/health education(3.2%);Quality of life:mindfulness relaxation training(91.3%)>strength training(68.0%)>flexibility/skill training(44.3%)>aerobic training(34.0%)>usual care/health education(12.3%). CONCLUSION:(1)Exercise therapy is effective in the treatment of knee osteoarthritis,among which aerobic training has the best effect on relieving pain and improving functional mobility.Strength training and mindfulness relaxation training has the best effect on improving patients'function.Mindfulness relaxation training has the best effect on improving the quality of life of patients.(2)Limited by the quality and quantity of the included literature,more high-quality studies are needed to verify it.

BACKGROUND:The capability of repairing articular cartilage damage is very limited,and tissue engineering technology provides new therapeutic options for repairing damaged cartilage,in which the interaction and induction between chondrocytes,bone marrow mesenchymal stem cells,and synovial mesenchymal stem cells is the basis of autologous healing of cartilage damage. OBJECTIVE:To construct the chondrocyte-bone marrow mesenchymal stem cell-synovial mesenchymal stem cell co-culture system to simulate the in vitro microenvironment of chondrocytes,and to explore the optimal cell inoculation ratio,meanwhile to observe the effects of icariin-containing serum on the proliferation of chondrocytes and the chondrogenic differentiation of stem cells in the system. METHODS:Rat knee chondrocytes,bone marrow mesenchymal stem cells and synovial mesenchymal stem cells were extracted,cultured and identified,and a chondrocyte-bone marrow mesenchymal stem cell-synovial mesenchymal stem cell non-contact co-culture system was constructed according to different cell inoculation ratios.After 72 hours of co-culturing,the chondrocyte proliferative activity and phenotypic ability were observed,and the co-culture system with the best overall effect was selected.New Zealand white rabbits were gavaged with icariin solution(0.25 mg/mL)to prepare icariin-containing serum,and cultured in conventional complete medium(high sugar DMEM culture medium containing 10%fetal bovine serum and 1%double antibody by volume)as the control group,while the experimental group was intervened by adding 10%icariin-containing serum by volume on the basis of above.The proliferative activity of chondrocytes and the expression of collagen type II were tested for the two groups after 24 and 48 hours.The differentiation of bone marrow mesenchymal stem cells and synovial mesenchymal stem cells into chondrocytes in the co-culture system was tested by immunofluorescence staining after 14 days. RESULTS AND CONCLUSION:(1)The three kinds of cells grew normally adherently to the wall in different ratios of co-culture,where chondrocytes showed the best proliferative activity and phenotypic ability in the co-culture system when chondrocytes:bone marrow mesenchymal stem cells:synovial mesenchymal stem cells=2:1:1.(2)Compared with the control group,the proliferative activity and type II collagen expression of chondrocytes in the experimental group were significantly increased after 24 hours(P<0.01),and the two groups still had difference after 48 hours(P<0.05).The two groups showed obvious chondrogenic differentiation of bone marrow mesenchymal stem cells and synovial mesenchymal stem cells after 14 days(P<0.01),and some of the cells appeared round or oval,and the cytoplasmic type II collagen immunofluorescence staining was positive.The fluorescence intensity of the experimental group was significantly higher than that of the control group(P<0.01).(3)The results showed that the chondrocyte-bone marrow mesenchymal stem cell-synovial mesenchymal stem cell co-culture system could be successfully established by the non-contact co-culture method,and the best chondrocyte proliferative activity and phenotypic ability could be obtained when the cell ratio was 2:1:1.Icariin-containing serum had the promoting effect on chondrocyte proliferation,and chondrogenic differentiation of bone marrow mesenchymal stem cells and synovial mesenchymal stem cells in the system.

With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.