Objective To identify factors affecting and key environmental factors of the Oncomelania hupensis snail density in the Yangtze River Delta region using machine learning methods. Methods Administrative village-level O. hupensis snail survey data in the Yangtze River Delta (including Shanghai Municipality, Jiangsu Province, Zhejiang Province and Anhui Province) from 2011 to 2021 were retrieved from the Information Management System for Parasitic Disease Control of Chinese Center for Disease Control and Prevention. Environmental factor data were captured from the Google Earth Engine platform, including elevation, slope, terrain, normalized difference vegetation index (NDVI), vegetation type, soil type, total petroleum hydrocarbon (TPH), ammonium nitrogen, inorganic nitrogen, dissolved oxygen, pH of water, chemical oxygen demand (COD) and inorganic phosphorus, and climatic factor data in the study region were retrieved from the Copernicus Climate Data Store, including annual precipitation, aridity index and annual mean temperature (AMT). O. hupensis snail survey data in the Yangtze River Delta region from 2011 to 2021 were randomly divided into a training set (70%) and a test set (30%), and five machine learning models were selected for machine learning model construction and comparative analysis of the O. hupensis snail density using the software R 4.3.0, including random forest (RF), eXtreme gradient boosting (XGBoost), support vector machine (SVM), gradient boosting machine (GBM) and neural network (NN). The XGBoost model was employed to construct a predictive model for the O. hupensis snail density, and the impact of each environmental factor on O. hupensis snail distribution was quantified. The SHapley Additive exPlanations (SHAPs) values were calculated to estimate the average contribution of each variable to the model prediction, and the core environmental factors affecting the O. hupensis snail population density were screened. Results Among the five machine learning models, the XGBoost model exhibited the optimal comprehensive performance, with the coefficient of determination (R²) of 0.855, mean squared error (MSE) of 0.188, root mean squared error (RMSE) of 0.434 and mean absolute error (MAE) of 0.155, respectively. Analysis of factors affecting the O. hupensis snail density with the XGBoost model showed that among the 16 environmental factors, the top four high-impact factors ranked by SHAPs values included annual precipitation, elevation, aridity index and NDVI, with cumulative SHAPs contributions of 75%, which was higher than that of other environmental factors. If NDVI was higher than 0.6, the O. hupensis snail density increased with NDVI and peaked if NDVI was 0.8 (1.60 snails/0.1 m²). The O. hupensis snail density increased with elevation if the elevation ranged from 14 to 40 m, and slowly rose if the annual precipitation ranged from 900 to 1 300 mm, and then increased rapidly to the peak (1.52 snails/0.1 m²) if the annual precipitation ranged from 1 300 to 1 500 mm. In addition, the O. hupensis snail density increased rapidly to the maximum (1.60 snails/0.1 m²) if the aridity index ranged from 0.8 to 1.1, and decreased gradually if the aridity index exceeded 1.1. Conclusions The XGBoost model shows excellent performance in prediction of the O. hupensis snail density and identification of key environmental factors in the Yangtze River Delta region. Annual precipitation, elevation, aridity index and NDVI are key environmental factors affecting the distribution and density of O. hupensis snails in the Yangtze River Delta region.

Objective To investigate the species of sandflies and the prevalence of Leishmania infections in sandflies from selected areas of northern and northwestern China, so as to provide insights into identification of leishmaniasis vectors and assessment of epidemiological trends of leishmaniasis in China. Methods Sandfly samples were collected from Mentougou District of Beijing Municipality, Xiangning County in Linfen City of Shanxi Province, Ejin Banner in Alxa League of Inner Mongolia Autonomous Region, and Payzawat County of Karamay District of Karamay City, Gaochang District of Turpan City in Xinjiang Uygur Autonomous Region from July 2023 to July 2024. Approximately 100 intact female sandfly samples were randomly selected from each site and the species of sandflies was identified according to morphological characteristics and molecular assays. Female sandflies originating from the same habitat were grouped into pools of 10 individuals. Leishmania infection was detected using polymerase chain reaction (PCR) assay targeting the internal transcribed spacer 1 (ITS-1) gene, and the prevalence of Leishmania infection was calculated in sandflies from different sampling sites using the minimum infection rate (MIR) method. In addition, positive amplicons were sequenced and subjected to phylogenetic analysis. Results A total of 6 155 sandflies were collected from different environments at sampling sites across the six aforementioned regions from July 2023 to July 2024. Phlebotomus chinensis (96.00%) was the dominant sandfly species in Mentougou District, Beijing Municipality, with a small proportion of Ph. sergenti (4.00%), and only Ph. chinensis was found in Xiangning County, Linfen City, Shanxi Province. Ph. wui was the only sandfly species detected in Ejin Banner, Alxa League, Inner Mongolia Autonomous Region, and Payzawat County, Kashgar City, Xinjiang Uygur Autonomous Region, and Ph. caucasicus (97.70%) was the dominant sandfly species in Karamay District, Karamay City, Xinjiang Uygur Autonomous Region, with a small proportion of Ph. wui (2.30%), while Ph. alexandri was the only species in Gaochang District, Turpan City, Xinjiang Uygur Autonomous Region. A total of 40, 60, 34, 18, 18, and 22 pools of sandfly samples were tested from Mentougou District in Beijing Municipality, Xiangning County in Linfen City of Shanxi Province, Ejin Banner in Alxa League of Inner Mongolia Autonomous Region, Payzawat County in Kashgar City, Karamay District in Karamay City, and Gaochang District in Turpan City of Xinjiang Uygur Autonomous Region, respectively. L. infantum was detected in Ph. chinensis samples from Mentougou District in Beijing Municipality, and Xiangning County of Linfen City in Shanxi Province, with MIR of 0.25% to 1.00%, and L. donovani was detected in Ph. wui from Ejin Banner in Alxa League of Inner Mongolia Autonomous Region, and Payzawat County in Kashgar City of Xinjiang Uygur Autonomous Region, with MIR of 0.56% to 0.88%; however, no Leishmania infection was detected in Ph. caucasicus from Karamay District in Karamay City or Ph. alexandri from Gaochang District in Turpan City of Xinjiang Uygur Autonomous Region. Phylogenetic analysis showed that the Leishmania ITS-1 gene sequences obtained from Mentougou District in Beijing Municipality and Xiangning County in Linfen City of Shanxi Province were clustered into the same clade with the reference sequences of L. infantum ITS-1 gene, while the Leishmania ITS-1 gene sequences obtained from Ejin Banner in Alxa League of Inner Mongolia Autonomous Region and Payzawat County in Kashgar City of Xinjiang Uygur Autonomous Region were clustered into the same clade with the reference sequences of L. donovani ITS-1 gene. Conclusions There are variations in sandfly species in selected areas of northern and northwestern China, and variations in the species of Leishmania infecting sandflies. Improved surveillance of sandfly vectors and targeted control strategies with adaptations to geographical features and leishmaniasis vectors are recommended.

Objective To examine the impact of extreme temperature and drought stress on the survival of Bulinus globosus, so as to provide the theoretical evidence for the genomic research of Bulinus in absence of reference genes. Methods B. globosus snail samples were collected from Kiwani Shehia in Pemba Island, Zanzibar, Tanzania, and offspring snails were obtained through laboratory breeding and reproduction. A total of 120 10-week-old B. globosus snails from the same generation were selected and randomly assigned into four groups, including the high-temperature drought (HD) group, normal temperature drought (D) group, low-temperature drought (LD) group, and the control (C) group, of 30 snails in each group. Snails in HD, D, and LD groups were placed in beakers containing dry soil at the bottom and subsequently housed in climate chambers at 35, 26 ℃, and 10 ℃, respectively, while snails in Group C were maintained in 500 mL petri dishes containing dechlorinated tap water at 26 ℃. Following 3 days of breeding, living snails in each group were collected, and soft tissues were dissected and isolated. Total RNA was extracted from snail soft tissues for library construction, followed by high-throughput sequencing on the Illumina HiSeq 4000 sequencing system. De novo transcriptome assembly was performed using the Trinity software, and the longest transcripts were selected as unigenes. Gene functional annotations of unigenes were conducted using the Diamond software against Gene Ontology (GO) knowledgebase, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway database, NCBI non-redundant (NR) protein sequences database, Protein Family (Pfam) database, and UniProtKB/Swiss-Prot (Swiss-Prot) knowledgebase. GO and KEGG enrichment analyses of differentially expressed genes (DEGs) were performed using the topGO and clusterProfiler software, respectively. In addition, four relevant genes were selected for validation using a real-time quantitative PCR (qRT-PCR) assay to verify the reliability of transcriptome sequencing results. Results Following 3 days of breeding, there were 7, 20, 28, and 30 survival B. globosus snails in HD, LD, D, and C groups, with corresponding survival rates of 23.33% (7/30), 66.67% (20/30), 93.33% (28/30), and 100.00% (30/30), respectively (χ² = 52.72, P < 0.001). De novo transcriptome assembly generated 176 942 unigenes, with annotation rates of 0.98%, 13.49%, 26.46%, 12.48%, and 14.39% against GO knowledgebase, KEGG pathway database, NR protein sequences database, Pfam database, and Swiss-Prot knowledgebase, respectively. There were 33 up-regulated and 72 down-regulated genes in Group D, 483 up-regulated and 815 down-regulated genes in Group HD, and 245 up-regulated and 172 down-regulated genes in Group LD relative to in Group C. Following removal of overlapping genes across groups and unmatched genes, 11 candidate genes were identified. GO and KEGG analyses revealed 3 heat shock protein (HSP)-related DEGs in these 11 candidate genes, which were annotated as HSP12.2, HSP70, and HSP20 genes and were all significantly up-regulated in each treatment group. Three immune and nervous system-related DEGs were identified, and were all significantly down-regulated in each treatment group, which were involved in the neural cell adhesion molecule L1-like protein pathway, fibrinogen binding protein pathway, and leukocyte elastase inhibitor-like protein pathway. qRT-PCR assay quantified that the expression trends of four genes related to temperature and drought stress across different treatment groups were highly consistent with transcriptome sequencing data. Conclusion The survival rate of B. globosus significantly reduces under combined stresses of extreme temperature and drought, possibly due to an imbalance in its cellular homeostasis regulatory system.

Based on review of global and Chinese schistosomiasis control progress and the evolution of control strategies, this article focuses on Chinese practical experiences of schistosomiasis control and systematically summarizes five key determinants for schistosomiasis transmission risk, including source of infections, intermediate host snails, high-risk populations, natural environments, and social factors. To address these risks and challenges associated with these determinants, the article reviews the advances in techniques for assessment of schistosomiasis transmission risk and their applications, including conventional risk assessment approaches, mathematical model-based tools for prediction of schistosomiasis transmission risk, and indicator-systembased techniques for assessment of schistosomiasis transmission risk. This review underscores the essential role of interdisciplinary integration and dynamic management in precision schistosomiasis control and recommends the intensification of verification of field adaptation and dynamic updates of indicator systems to promote the widespread application of assessment tools across diverse regions and contexts, so as to provide strategic guidance and methodological support to achieve the target for elimination of schistosomiasis across China in 2030.

Background Gestational weight gain is closely related to maternal and infant health outcomes. Pregnant women are simultaneously exposed to four metals—lithium (Li), vanadium (V), uranium (U), and bismuth (Bi)—through inhalation of fine particulate matter and consumption of contaminated food and water. Existing studies suggest that exposure to these metals may be associated with gestational weight gain. However, no study has yet explored the complex relationships between exposure to mixtures of these four metals and weight gain at different stages of pregnancy. Objective To investigate the associations between mixed exposure to Li, V, U, and Bi in early pregnancy and the average weekly gestational weight gain during both early pregnancy and mid-to-late pregnancy. Methods This prospective study recruited eligible women in early pregnancy from an obstetrics clinic of a tertiary hospital in Jinan, China, between September 2021 and July 2023. Pre-pregnancy weight, current weight (at 11⁺⁰ to 13⁺⁶ weeks of gestation), and spot urine samples (≥5.0 mL) were collected at enrollment. Urinary concentrations of Li, V, Bi, and U were determined using inductively coupled plasma mass spectrometry. Participants were followed up in late pregnancy (≥28 weeks of gestation) to collect information on physical activity via questionnaire; weight measurements at the last antenatal visit (35⁺⁰ to 37⁺⁶ weeks of gestation) were obtained from the hospital information system. After adjusting for covariates, multiple linear regression and generalized additive models were used to assess the associations of individual metals with weekly weight gain in early pregnancy and in mid-to-late pregnancy. Bayesian kernel machine regression (BKMR) and quantile-based g-computation (Qgcomp) were applied to evaluate the joint effects of the metal mixture exposure on weekly weight gain at the two gestational stages. Results A total of 313 pregnant women were included. The geometric means of urinary Li, V, U, and Bi concentrations were 37.07, 0.20, 0.06, and 0.04 μg·L⁻¹, respectively; after creatinine adjustment, the corresponding values were 46.82, 0.25, 0.07, and 0.05 μg·g⁻¹ (Cr). The mean weekly gestational weight gain was (0.19±0.25) kg in early pregnancy and (0.53 ± 0.18) kg in mid-to-late pregnancy. Both multiple linear regression and generalized additive models showed that urinary V concentration was positively associated with average weekly gestational weight gain in early pregnancy, while no significant associations were found for other metals or for gestational weight gain in mid-to-late pregnancy. In the BKMR model with early-pregnancy weight gain as the outcome, V had the strongest association [posterior inclusion probability (PIP)=0.773]. When other metals were fixed at their medians, V showed a positive non-linear association with the outcome. A significant single-metal effect of V and its interaction with Li were observed. Compared with the 50th percentile of the metal mixture, the average weekly weight gain in early pregnancy increased by 0.016 (95%CI: 0.003, 0.029) and 0.018 (95%CI: 0.001, 0.036) at the 60th and 65th percentiles, respectively; conversely, at the 25th percentile, it decreased by 0.026 (95%CI: 0.002, 0.050). Overall, the joint effect of the metal mixture on early- pregnancy weight gain showed an upward trend. In the BKMR model for mid-to-late pregnancy gestational weight gain, all PIPs were<0.5, and no significant single-metal effects, interactions, or joint effects were identified. Qgcomp results confirmed a positive association between the metal mixture and early-pregnancy weight gain (b=0.031, 95%CI: 0.010, 0.051; P<0.01), with V contributing the highest positive weight (0.71). No significant association was found for weight gain in mid-to-late pregnancy (b=0.007, P=0.339). Conclusion Higher levels of co-exposure to the Li, V, Bi, and U metal mixture during early pregnancy may be associated with increased average weekly weight gain in early pregnancy. Among these metals, V exhibits a predominant role and appears to interact with Li. No association is observed between early-pregnancy metal mixture exposure and average weekly gestational weight gain in mid-to-late pregnancy. These findings suggest that monitoring and managing metal exposure during early pregnancy may be crucial for the rational regulation of gestational weight gain.

Traumatic paraplegia, resulting from spinal cord injury, leads to severe motor dysfunction, with limited efficacy and high risks associated with conventional treatments. Brain-computer interface (BCI) has emerged as a promising technology that decodes neural signals to control external devices or stimulate paralyzed muscles, providing a novel approach for functional restoration in paraplegic patients. This article reviews the clinical applications of BCI in treating both high- and low-level traumatic paraplegia. Challenges related to signal decoding, device stability, biocompatibility, clinical safety, and ethical considerations are also discussed. In the future, the integration of artificial intelligence may further enhance BCI as a “neural bridge” for restoring motor and interactive functions in patients with traumatic paraplegia.

ObjectiveTo investigate the therapeutic effects and mechanism of decoctions from four kinds of processed products of Aconiti Radix Lateralis Praeparata（ARLP） in deficiency-cold syndrome. MethodsA total of 36 SD rats were randomly divided into the control group， model group， Shengfupian（SFP） group， Paofuzi（PFZ） group， Heishunpian（HSP） group and Paofupian（PFP） group with 6 rats in each group. Except for the control group， rats in other groups were administered hydrocortisone sodium succinate via intramuscular injection to induce a cold deficiency syndrome model. After 14 consecutive days， each ARLP decoction pieces was administered via continuous gastric lavage at a dose of 12 g·kg^-1·d^-1 for 7 d， while the control and model groups received an equivalent volume of physiological saline. After the end of administration， body weight， spleen weight and thymus weight were measured for calculating the spleen and thymus indexes. Hematoxylin-eosin（HE） staining was used to observe the pathological morphology of adrenal tissue. The fully automatic biochemistry analyzer was used to measure the total cholesterol（TC）， triglyceride（TG）， lactic dehydrogenase（LDH） and lactate（LAC） levels in serum. Enzyme-linked immunosorbent assay（ELISA） was employed to measure the contents of 17-hydroxycorticosteroid（17-OHCS）， cortisol（CORT）， triiodothyronine（T₃）， thyroxine（T₄）， thyrotropin（TSH）， immunoglobulin（Ig） M， IgG， cyclic adenosine monophosphate（cAMP） and cyclic guanosine monophosphate（cGMP）. Western blot was used to measure the protein expression levels of protein kinase A（PKA）， cAMP response element-binding protein（CREB）， silent information regulator 1（Sirt1） and peroxisome proliferator-activated receptor γ coactivator-1α（PGC-1α）. And high performance liquid chromatography（HPLC） was used to determine the content of major alkaloids， followed by Pearson correlation analysis with pharmacodynamic indicators. ResultsAfter modeling， compare with the control group， the model rats exhibited symptoms such as lethargy and loose stools， mild abnormalities were observed in adrenal tissue structure， and both spleen and thymus indices were significantly reduced（P<0.01）. Thyroid， adrenal and immune system functions were suppressed， with decreased serum cAMP level and significantly elevated cGMP level（P<0.01）. Compared with the model group， the adrenal injury by hydrocortisone sodium succinate were repaired and the spleen index were increased significantly in all four ARLP groups（P<0.05， P<0.01）. The thymus index in SFP and PFZ groups were increased significantly（P<0.05）. The contents of T₃， TSH， 17-OHCS and CORT were increased significantly in SFP and PFZ groups（P<0.05）. In addition， the content of IgG in SFP， PFZ and PFP groups were increased significantly（P<0.01）， while the content of IgM in PFZ and HSP groups were also increased significantly（P<0.05）. Regarding the cyclic nucleotide system， PFZ significantly elevated cAMP level while reducing cGMP level（P<0.05）， exhibiting the most pronounced effect among the four decoction pieces. For energy metabolism indicators， PFZ significantly improved abnormal markers including TC， TG， LDH， and LAC（P<0.05）. HSP showed marked improvement effects on TG， LDH， and LAC（P<0.05）. Both PFZ and SFP significantly elevated the expression levels of PKA， CREB， Sirt1， and PGC-1α proteins（P<0.01）. Additionally， the diester alkaloids in ARLP showed a strong positive correlation with TG， IgG， and CORT， a strong negative correlation with LAC， a moderate positive correlation with T₄， and moderate negative correlations with cAMP and spleen index. Monomeric alkaloids showed strong positive correlations with TG and IgG， strong negative correlations with LAC， moderate positive correlations with CORT and T₄， and moderate negative correlations with cAMP and spleen index. However， the content of water-soluble alkaloids showed strong positive correlations with TC， LDH， 17-OHCS， T₃， TSH， and thymus index， moderate positive correlations with cAMP， CORT， T₄， and spleen index， and moderate negative correlation with cGMP. ConclusionAmong different processed ARLP decoction pieces， PFZ processed according to ZHANG Zhongjing's method exhibits the most potent warming and cold-dispelling effects. Its pharmacological actions are mediated through regulating the thyroid， adrenal， immune， cyclic nucleotide systems， and material-energy metabolism pathways. Among these， water-soluble alkaloids show strong or moderate correlations with more indicators of deficiency-cold syndrome and exhibit the highest content in PFZ. Therefore， PFZ processed according to ZHANG Zhongjing's method may exert its warming and cold-dispelling effects through water-soluble alkaloids.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

OBJECTIVE To explore a model for constructing a platform for medical institution formulation and provide insights for promoting their development. METHODS By systematically reviewing the development status and challenges of medical institution preparations in China， and based on the theory of industry-university-research collaborative innovation， the organizational structure， collaborative processes， and safeguard mechanisms of the platform were designed. RESULTS & CONCLUSIONS Medical institution formulations in China mainly faced challenges such as weak research and development （R&D） capacity， uneven quality standards， and blocked transformation pathways. This study established a full-chain， whole- industry collaborative innovation network covering the government， medical institutions， universities/research institutes， pharmaceutical enterprises， and the market， forming a new “government-industry-university-research-application” five-in-one platform model for medical institution formulations. By establishing mechanisms such as multi-entity collaborative cooperation， full- chain intellectual property management， contribution-based benefit distribution， staged risk-sharing， and third-party evaluation， the model clarified the responsibilities and collaborative pathways of all parties. The new model highlights the whole-process transformation of clinical experience-based prescriptions， enabling precise alignment between clinical needs and technological R&D， as well as between preparation achievements and industrial transformation. While breaking down the barriers of traditional platform construction， it effectively achieves optimal resource allocation and complementary advantages， addresses problems emerging in the development of medical institution preparations， and provides reference value for the formulation of relevant systems.

Oral squamous cell carcinoma (OSCC) is a common head and neck malignancy. Approximately 50% to 60% of patients with OSCC are diagnosed at a locally advanced stage (clinical staging III-IVa). Even with comprehensive and sequential treatment primarily based on surgery, the 5-year overall survival rate remains below 50%, and patients often suffer from postoperative functional impairments such as difficulties with speaking and swallowing. Programmed death receptor-1 (PD-1) inhibitors are increasingly used in the neoadjuvant treatment of locally advanced OSCC and have shown encouraging efficacy. However, clinical practice still faces key challenges, including the definition of indications, optimization of combination regimens, and standards for efficacy evaluation. Based on the latest research advances worldwide and the clinical experience of the expert group, this expert consensus systematically evaluates the application of PD-1 inhibitors in the neoadjuvant treatment of locally advanced OSCC, covering combination strategies, treatment cycles and surgical timing, efficacy assessment, use of biomarkers, management of special populations and immune related adverse events, principles for immunotherapy rechallenge, and function preservation strategies. After multiple rounds of panel discussion and through anonymous voting using the Delphi method, the following consensus statements have been formulated: 1) Neoadjuvant therapy with PD-1 inhibitors can be used preoperatively in patients with locally advanced OSCC. The preferred regimen is a PD-1 inhibitor combined with platinum based chemotherapy, administered for 2-3 cycles. 2) During the efficacy evaluation of neoadjuvant therapy, radiographic assessment should follow the dual criteria of Response Evaluation Criteria in Solid Tumors (RECIST) version 1.1 and immune RECIST (iRECIST). After surgery, systematic pathological evaluation of both the primary lesion and regional lymph nodes is required. For combination chemotherapy regimens, PD-L1 expression and combined positive score need not be used as mandatory inclusion or exclusion criteria. 3) For special populations such as the elderly (≥ 70 years), individuals with stable HIV viral load, and carriers of chronic HBV/HCV, PD-1 inhibitors may be used cautiously under the guidance of a multidisciplinary team (MDT), with close monitoring for adverse events. 4) For patients with a poor response to neoadjuvant therapy, continuation of the original treatment regimen is not recommended; the subsequent treatment plan should be adjusted promptly after MDT assessment. Organ transplant recipients and patients with active autoimmune diseases are not recommended to receive neoadjuvant PD-1 inhibitor therapy due to the high risk of immune related activation. Rechallenge is generally not advised for patients who have experienced high risk immune related adverse events such as immune mediated myocarditis, neurotoxicity, or pneumonitis. 5) For patients with a good pathological response, individualized de escalation surgery and function preservation strategies can be explored. This consensus aims to promote the standardized, safe, and precise application of neoadjuvant PD-1 inhibitor strategies in the management of locally advanced OSCC patients.