Objective To investigate the impact of dietary protein intake on the prevalence of type 2 diabetes in adult residents, and to provide a reference for formulating diabetes prevention and control measures. Methods The research was based on cross-sectional survey data from the Nutrition and Health Follow-up Study of Chinese Residents in Chongqing (2021). Energy and nutrient intake was calculated in combination with the Chinese food composition table. Multivariate logistic regression was used to analyze the association between dietary protein and diabetes, and then restricted cubic spline regression (RCS) was used to analyze the dose-response relationship between dietary protein intake and the development of diabetes. Results Among the 1 415 adult residents, dietary intake of total protein, animal protein, and plant protein was 69.69g/d, 26.26g/d, and 43.43g/d, respectively. The ratio of protein to energy supply was 14.31%, and the prevalence of diabetes was 18.02%. Comparing with the residents in the first percentile of total dietary protein intake, the multivariable-adjusted odds ratios of those in the second and third percentile were 1.754 and 2.453 respectively. Comparing the residents in the third percentile with those in the first percentile, the multivariable-adjusted odds ratios of diabetes were 1.592 for protein energy supply ratio, and 1.558 for animal protein intake. Conclusion High protein intake, high protein energy supply ratio and high animal protein intake may increase the risk of diabetes, and different types of protein may have different effects on diabetes.

OBJECTIVE To explore the association between the use of oral progesterone drugs in early pregnancy and gestational diabetes mellitus （GDM）. METHODS Through real-world retrospective cohort research method， pregnant women who underwent the oral glucose tolerance test （OGTT） at the Affiliated Maternal and Child Health Hospital of Nantong University between January 2022 and January 2023 were enrolled. Based on whether oral progesterone drugs were used in early pregnancy， they were divided into treatment group and control group； propensity score matching （PSM） with a 1∶1 ratio was employed to control for confounding factors； Logistic regression and linear regression were employed to analyze the association between drug factors （whether use of oral progesterone drug， duration of medication， dosage， and drug type） and outcome indicators （occurrence of GDM， fasting blood glucose levels， and OGTT 1 and 2 h blood glucose levels in late pregnancy）. RESULTS A total of 709 pregnant women were enrolled in the two groups before PSM； after PSM， 256 cases were included in both the treatment group and the control group. The results of association analysis indicated that there was no significant association between the use of oral progesterone drugs and GDM （P＞0.05）； but a significant correlation was found with OGTT 1 h blood glucose levels [β＝0.965， 95%CI （0.007，1.922）， P＜0.05]， specifically with Dydrogesterone tablets [β＝0.977， 95%CI （0.009， 1.944）， P＜0.05] and Progesterone soft capsules [β ＝1.089， 95%CI （0.077， 2.102）， P＜0.05]. There was no significant correlation between other drug factors and outcome indicators （P＞0.05）. CONCLUSIONS The use of oral progestogen drugs in early pregnancy is not significantly associated with GDM. The blood glucose levels in late pregnancy， especially OGTT 1 h blood glucose levels， have a certain correlation with Progesterone soft capsules and Dydrogesterone tablets.

BackgroundDementia seriously affects the quality of life and lifespan of elderly people， with Alzheimer's disease （AD） being the most common type of dementia. Previous studies have suggested that gout may reduce the risk of developing AD， but the causal relationship between the two still requires further research. ObjectiveTo investigate the potential causal relationship between gout and AD through a two-sample Mendelian randomization （MR） analysis， so as to provide references for the prevention and treatment of AD. MethodsData from Genome-Wide Association Studies （GWAS） extracted in 2024 were analyzed， using pooled data on gout （6 810 cases in the case group and 477 788 cases in the control group） published by UK Biobank in 2021 as the exposure variable， and data on AD （3 899 cases in the case group and 214 893 cases in the control group） published by FinnGen in the same year as the outcome variable. The inverse-variance weighted， MR-Egger regression， weighted median estimation， simple model and weighted model were used to analyze the potential causal relationship between gout and AD. Pleiotropic effects were assessed using MR-Egger regression. Heterogeneity assessment was conducted using Cochran's Q test. The leave-one-out analysis was carried out for sensitivity analysis. And a funnel plot was drawn to detect potential publication bias. ResultsThe inverse-variance weighted analysis demonstrated a negative causal relationship between gout and AD （OR=0.004， 95% CI： 0~0.700， P<0.05）. The plot resembled a symmetrical inversed funnel， indicating the absence of publication bias. No heterogeneity was detected by Cochran's Q test. The MR-Egger regression indicated no significant horizontal pleiotropy. Concerning the reverse directions， no significant associations between AD and gout were noted. ConclusionThere is a negative causal relationship between gout and AD， with gout potentially reducing the risk of developing AD. ［Funded by The Third Batch of Social Welfare and Basic Research Projects （Medical and Health） of Zhongshan City in 2022 （number， 2022B3017）］

Panax species are mostly valuable medicinal plants. While some species' seeds are sensitive to dehydration, the dehydration tolerance of seeds from other Panax species remains unclear. The phospholipase D(PLD) gene plays an important role in plant responses to dehydration stress. However, the characteristics of the PLD gene family and their mechanisms of response to dehydration stress in seeds of Panax species with different dehydration tolerances are not well understood. This study used seeds from eight Panax species to measure the germination rates and PLD activity after dehydration and to analyze the correlation between dehydration tolerance and seed traits. Bioinformatics analysis was also conducted to characterize the PnPLD and PvPLD gene families and to evaluate their expression patterns under dehydration stress. The dehydration tolerance of Panax seeds was ranked from high to low as follows: P. ginseng, P. zingiberensis, P. quinquefolius, P. vietnamensis var. fuscidiscus, P. japonicus var. angustifolius, P. japonicus, P. notoginseng, and P. stipuleanatus. A significant negative correlation was found between dehydration tolerance and seed shape(three-dimensional variance), with flatter seeds exhibiting stronger dehydration tolerance(r=-0.792). Eighteen and nineteen PLD members were identified in P. notoginseng and P. vietnamensis var. fuscidiscus, respectively. These members were classified into five isoforms: α, β, γ, δ, and ζ. The gene structures, subcellular localization, physicochemical properties, and other characteristics of PnPLD and PvPLD were similar. Both promoters contained regulatory elements associated with plant growth and development, hormone responses, and both abiotic and biotic stress. During dehydration, the PLD enzyme activity in P. notoginseng seeds gradually increased as the water content decreased, whereas in P. vietnamensis var. fuscidiscus, PLD activity first decreased and then increased. The expression of PLDα and PLDδ in P. notoginseng seeds initially increased and then decreased, whereas in P. vietnamensis var. fuscidiscus, the expression of PLDα and PLDδ consistently decreased. In conclusion, the dehydration tolerance of Panax seeds showed a significant negative correlation with seed shape. The dehydration tolerance in P. vietnamensis var. fuscidiscus and dehydration sensitivity of P. notoginseng seeds may be related to differences in PLD enzyme activity and the expression of PLDα and PLDδ genes. This study provided the first systematic comparison of dehydration tolerance in Panax seeds and analyzed the causes of tolerance differences and the optimal water content for long-term storage at ultra-low temperatures, thus providing a theoretical basis for the short-term and ultra-low temperature long-term storage of medicinal plant seeds with varying dehydration tolerances.
Seeds/metabolism* ; Panax/physiology* ; Plant Proteins/metabolism* ; Gene Expression Regulation, Plant ; Phospholipase D/metabolism* ; Plants, Medicinal/enzymology* ; Germination ; Multigene Family ; Water/metabolism* ; Dehydration ; Phylogeny

"Prescriptions being modified according to the syndrome and processing following prescription" is one of the characteristics of clinical medication in traditional Chinese medicine(TCM), and it is also an important sign that distinguishes TCM from other traditional medicine. The processing methods of TCM decoctions originate from the ingenious combination of medicinal materials, the mutual restraint of seven emotions, the harmony of four properties, and the pairing and combining of medicinal materials in prescriptions. They are the concrete embodiment of the essence and characteristics of "prescriptions being modified according to the syndrome and processing following prescription". However, due to insufficient inheritance and innovation, many characteristic varieties and pharmaceutical experience have been lost or forgotten. There is an urgent need to systematically explore and organize the processing theory and characteristic varieties of TCM decoctions, delve into the scientific connotation of the processing principles, and optimize the processing technology. Therefore, this article systematically organizes and summarizes the historical evolution and modern research progress of TCM decoction processing, conducts in-depth reflection on the current problems, and puts forward reasonable suggestions, with the aim of further inheriting, enriching, and developing the processing theory of TCM decoctions and providing support for ensuring the clinical efficacy of prescriptions.
Drugs, Chinese Herbal/isolation & purification* ; Humans ; Medicine, Chinese Traditional/methods*

In recent years, the study of single-cell transcriptome sequencing technology in the heterogeneity of astrocytes (astrocytes) after spinal cord injury (SCI) has provided new perspectives on post-traumatic nerve regeneration and repair. To provide a review on the research progress of single-cell sequencing technology in astrocytes after spinal cord injury (SCI), and to more comprehensively and deeply elaborate the application of single-cell sequencing technology in the field of astrocytes after SCI. Single-cell sequencing technology can analyse the transcriptomes of individual cells in a high-throughput manner, thus revealing fine differences in cell types and states. By using single-cell sequencing technology, the heterogeneity of astrocytes after SCI and their association with nerve regeneration and repair were revealed. In conclusion, the application of single-cell sequencing technology provides an important tool to reveal the heterogeneity of astrocytes after SCI, to further explore the mechanisms of astrocytes in SCI, and to develop intervention strategies targeting their regulatory mechanisms in order to improve the therapeutic efficacy of SCI. The discovery of changes in astrocyte transcriptome dynamics has improved researchers' understanding of spinal cord injury lesion progression and provided new insights into the treatment of spinal cord injury at different time points. To date, all of these findings need to be validated by more basic research and sufficient clinical trials. In the future, single-cell sequencing technology, through interdisciplinary collaboration with bioinformatics, computer science, tissue engineering, and clinical medicine, is expected to open a new window for the treatment of spinal cord injury.
Spinal Cord Injuries/metabolism* ; Astrocytes/cytology* ; Single-Cell Analysis/methods* ; Humans ; Animals ; Transcriptome ; Nerve Regeneration

PURPOSE: Intertrochanteric fractures undergoing proximal femoral nail antirotation (PFNA) surgery are associated with significant hidden blood loss. This study aimed to explore whether intramedullary administration of tranexamic acid (TXA) can reduce bleeding in PFNA surgery for intertrochanteric fractures in elderly individuals. METHODS: A randomized controlled trial was conducted from January 2019 to December 2022. Patients aged over 60 years with intertrochanteric fractures who underwent intramedullary fixation surgery with PFNA were eligible for inclusion and grouped according to random numbers. A total of 249 patients were initially enrolled, of which 83 were randomly allocated to the TXA group and 82 were allocated to the saline group. The TXA group received intramedullary perfusion of TXA after the bone marrow was reamed. The primary outcomes were total peri-operative blood loss and post-operative transfusion rate. The occurrence of adverse events was also recorded. Continuous data was analyzed by unpaired t-test or Mann-Whitney U test, and categorical data was analyzed by Pearson Chi-square test. RESULTS: The total peri-operative blood loss (mL) in the TXA group was significantly lower than that in the saline group (577.23 ± 358.02 vs. 716.89 ± 420.30, p = 0.031). The post-operative transfusion rate was 30.67% in the TXA group and 47.95% in the saline group (p = 0.031). The extent of post-operative deep venous thrombosis and the 3-month mortality rate were similar between the 2 groups. CONCLUSION We observed that intramedullary administration of TXA in PFNA surgery for intertrochanteric fractures in elderly individuals resulted in less peri-operative blood loss and decreased transfusion rate, without any adverse effects, and is, thus, recommended.
Humans ; Tranexamic Acid/administration & dosage* ; Hip Fractures/surgery* ; Male ; Aged ; Female ; Fracture Fixation, Intramedullary/adverse effects* ; Blood Loss, Surgical/prevention & control* ; Antifibrinolytic Agents/administration & dosage* ; Aged, 80 and over ; Bone Nails ; Middle Aged ; Blood Transfusion/statistics & numerical data*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To investigate the application value of thromboelastography (TEG) in assessing coagulation function in children with severe hemophilia A (HA) after emicizumab (EMI) therapy. METHODS: A retrospective analysis was performed on the activated partial thromboplastin time (APTT) and TEG testing results of 17 children with severe HA before and after EMI treatment at Shenzhen Children's Hospital from January 2023 to July 2024. Correlation analysis was conducted between coagulation factor VIII (FVIII) equivalent activity and reaction time (R value) measured by TEG. RESULTS: After EMI treatment, the mean bleeding rate for children with severe HA was 1.6 events per year, with 15 children (88%) without spontaneous bleeding or joint bleeding. The children with severe HA showed a significant reduction in APTT after EMI treatment (P<0.05), with a significantly shorter APTT than the normal control group (P<0.05). There was no correlation between APTT and FVIII equivalent activity after treatment (P>0.05). After EMI treatment, TEG parameters, including R value, kinetic time, alpha angle (α), maximum amplitude, clot strength, and coagulation index, shifted from a hypocoagulable state before treatment to a nearly normal state after treatment (P<0.05). The R value demonstrated a strong negative correlation with FVIII equivalent activity (r=-0.758, P<0.05). CONCLUSIONS The bleeding condition of children with severe HA can be effectively controlled after EMI treatment. Routine APTT testing cannot reflect true coagulation function, whereas TEG testing is clinically valuable in assessing the coagulation function of children with severe HA undergoing EMI treatment.
Humans ; Thrombelastography ; Hemophilia A/physiopathology* ; Male ; Child ; Antibodies, Bispecific/therapeutic use* ; Antibodies, Monoclonal, Humanized/therapeutic use* ; Blood Coagulation/drug effects* ; Child, Preschool ; Retrospective Studies ; Female ; Partial Thromboplastin Time ; Adolescent ; Infant