1.Clinical efficacy and safety of intravenous colistin sulfate monotherapy versus combination with nebulized inhalation for pulmonary infections caused by carbapenem-resistant gram-negative bacilli: a multicenter retrospective cohort study.
Danyang PENG ; Fan ZHANG ; Ying LIU ; Yanqiu GAO ; Lanjuan XU ; Xiaohui LI ; Suping GUO ; Lihui WANG ; Lin GUO ; Yonghai FENG ; Chao QIN ; Huaibin HAN ; Xisheng ZHENG ; Faming HE ; Xiaozhao LI ; Bingyu QIN ; Huanzhang SHAO
Chinese Critical Care Medicine 2025;37(9):829-834
OBJECTIVE:
To compare the efficacy and safety of intravenous colistin sulfate combined with nebulized inhalation versus intravenous monotherapy for pulmonary infections caused by carbapenem-resistant organism (CRO).
METHODS:
A multicenter retrospective cohort study was conducted. Clinical data were collected from patients admitted to the intensive care unit (ICU) of 10 tertiary class-A hospitals in Henan Province between July 2021 and May 2023, who received colistin sulfate for CRO pulmonary infections. Data included baseline characteristics, inflammatory markers [white blood cell count (WBC), neutrophil count (NEU), procalcitonin (PCT), C-reactive protein (CRP)], renal function indicators [serum creatinine (SCr), blood urea nitrogen (BUN)], life support measures, anti-infection regimens, clinical efficacy, microbiological clearance rate, and prognostic outcomes. Patients were divided into two groups: intravenous group (colistin sulfate monotherapy via intravenous infusion) and combination group ((intravenous infusion combined with nebulized inhalation of colistin sulfate). Changes in parameters before and after treatment were analyzed.
RESULTS:
A total of 137 patients with CRO pulmonary infections were enrolled, including 89 in the intravenous group and 48 in the combination group. Baseline characteristics, life support measures, daily colistin dose, and combination regimens (most commonly colistin sulfate plus carbapenems in both groups) showed no significant differences between two groups. The combination group exhibited higher clinical efficacy [77.1% (37/48) vs. 59.6% (52/89)] and microbiological clearance rate [60.4% (29/48) vs. 39.3% (35/89)], both P < 0.05. Pre-treatment inflammatory and renal parameters showed no significant differences between two groups. Post-treatment, the combination group showed significantly lower WBC and CRP [WBC (×109/L): 8.2±0.5 vs. 10.9±0.6, CRP (mg/L): 14.0 (5.7, 26.6) vs. 52.1 (24.4, 109.6), both P < 0.05], whereas NEU, PCT, SCr, and BUN levels showed no significant between two groups. ICU length of stay was shorter in the combination group [days: 16 (10, 25) vs. 21 (14, 29), P < 0.05], although mechanical ventilation duration and total hospitalization showed no significant differences between two groups.
CONCLUSIONS
Intravenous colistin sulfate combined with nebulized inhalation improved clinical efficacy and microbiological clearance in CRO pulmonary infections with an acceptable safety profile.
Humans
;
Colistin/therapeutic use*
;
Retrospective Studies
;
Administration, Inhalation
;
Anti-Bacterial Agents/therapeutic use*
;
Carbapenems/pharmacology*
;
Male
;
Female
;
Middle Aged
;
Gram-Negative Bacteria/drug effects*
;
Aged
;
Treatment Outcome
;
Respiratory Tract Infections/drug therapy*
2.New tetrahydroanthraquinones and γ-butenolides from the fungus Auxarthron umbrinum DSM3193.
Ling TIAN ; Bingyu LIU ; Qian WEI ; Chen ZHANG ; Jiamin SHANG ; Xiaoxue LI ; Xiuying YANG ; Jinhua WANG ; Youcai HU
Chinese Journal of Natural Medicines (English Ed.) 2025;23(8):951-960
Nine novel compounds, comprising seven tetrahydroanthraquinones (auxarthrolones A-G, 1-7), a γ-butenolide glycoside (malfilamentoside E, 26), and a γ-butenolide (auxarthrolide A, 27), together with eighteen known compounds (8-25) were isolated from rice-based solid culture of Auxarthron umbrinum (A. umbrinum) DSM3193 using the one strain many compounds (OSMAC) approach. The structural elucidation of these compounds was accomplished through nuclear magnetic resonance (NMR), mass spectrometry (MS), and NMR calculation combined with DP4+ analysis or MAEΔΔδ parameter, while the absolute configurations of new compounds were established through single-crystal X-ray diffraction, electronic circular dichroism (ECD) spectroscopic data analysis and/or chemical derivatization. Austrocortilutein (10) and auxarthrol H (14) demonstrated moderate cytotoxicity against U87 and U251 [half maximal inhibitory concentration (IC50) 3.5-12.1 μmol·L-1]. Additionally, auxarthrolone A (1), auxarthrol H (14), eupolyphagin B (15), and 7-hydroxy-2-(2-hydroxypropyl)-5-methylchromone (17) exhibited torsional effects on fibroblast proliferation challenges induced by oleic acid, thus demonstrating fibroblast proliferation-promoting activity.
4-Butyrolactone/pharmacology*
;
Molecular Structure
;
Anthraquinones/pharmacology*
;
Humans
;
Animals
;
Mice
;
Cell Line, Tumor
;
Magnetic Resonance Spectroscopy
3.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.
4.Comprehensive Application of AHP-CRITIC Hybrid Weighting Method, Grey Correlation Analysis and BP-ANN in Optimization of Extraction Process of Qizhi Prescription
Qun LAN ; Yi CHENG ; Zian LI ; Bingyu WU ; Jinyu WANG ; Dewen LIU ; Yan TONG
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(8):176-186
ObjectiveBased on analytic hierarchy process(AHP)-criteria importance through intercriteria correlation(CRITIC) hybrid weighting method, grey relational analysis and backpropagation artificial neural network(BP-ANN), to optimize the water extraction process of Qizhi prescription, so as to provide an experimental basis for optimization of the preparation process of this prescription and the establishment of quality standards. MethodsL9(34) orthogonal test was employed, and the AHP-CRITIC hybrid weighting method was utilized to determine the weight coefficients of the quality fractions of various components, including astragaloside Ⅳ, polygalaxanthone Ⅲ, calycosin-7-O-β-D-glucoside, tenuifolin, and 3,6′-disinapoylsucrose, as well as the dry extract yield. The comprehensive score of each factor level combination in the orthogonal test were calculated as evaluation indicator to select the optimal extraction process parameters. The effects of extraction times, extraction time, and solvent dosage on the aqueous extraction process of the formula were investigated through intuitive analysis, variance analysis, and grey relational analysis. Meanwhile, a BP-ANN model was established to reverse-predict the optimal extraction process parameters of Qizhi prescription, and the optimized process parameters were validated. ResultsThe weight coefficients of the five index components(astragaloside Ⅳ, tenuifolin, calycosin-7-O-β-D-glucoside, polygalaxanthone Ⅲ, and 3,6′-disinapoylsucrose) and dry extract yield were 25.7%, 20.82%, 16.41%, 12.45%, 15.96% and 8.67%, respectively. The optimized extraction process parameters were extracted 3 times with 8, 6, 6 times the amount of water, each time for 1 h. The network prediction results of BP-ANN test samples were consistent with the orthogonal test results, and the mean square error(MSE) of the predicted and measured values of the network was <1%. The water extraction process of Qizhi prescription analyzed and predicted by relevant mathematical models was stable and feasible, which could effectively improve the extraction efficiency of the active ingredients of Astragali Radix and Polygalae Radix, and the average comprehensive score of the validation test was 90.85 with the relative standard deviation(RSD) of 1.55%. ConclusionThis study establishes a water extraction process for compound Qizhi granules, and the optimized extraction process can effectively improve the extraction efficiency of active ingredients, which provides useful references for the optimization of preparation process and the establishment of quality standards for other clinical experience formulas.
5.Effects of allergens on the expression levels of interleukin 18, interleukin 18 binding protein a and interleukin 18 receptor α in the blood monocyte subtypes of patients with allergic asthma
Haibo WANG ; Huanzhang SHAO ; Xin DONG ; Youjia ZHANG ; Congyi ZHAO ; Shihao LIU ; Jiazhan PAN ; Bingyu QIN ; Junling WANG
Chinese Journal of Internal Medicine 2025;64(7):660-669
Objective:To assess the effects of allergens on interleukin-18 (IL-18), IL-18 binding protein a (IL-18BPa), and IL-18 receptor α (IL-18Rα) expression levels in different monocyte subtypes of the peripheral blood samples of allergic asthma (AA) patients, and the correlations between the percentage of IL-18 +classical monocytes and plasma levels of pro-inflammatory cytokines. Methods:A cross-sectional study. Blood samples were collected from 28 healthy controls and 33 patients experiencing acute attack of AA based on a positive skin prick test of Henan Provincial People′s Hospital from February 2023 to April 2024. Flow cytometry was used to assess the effects of allergens on IL-18, IL-18BPa, and IL-18Rα expression levels in the classical, intermediate, and non-classical monocytes of the peripheral blood samples of AA patients. Kruskal-Wallis test and Pairwise test were used to analyze statistical significance between groups. Plasma tumor necrosis factor α (TNF-α) and interleukin 1β (IL-1β) levels were estimated using Bioplex assays. Pearson correlation test was used to determine the association between the percentage of IL-18 +classical monocytes and the plasma levels of IL-1β and TNF-α. Results:Compared with healthy controls, the percentages of classical and non-classical monocytes in the peripheral blood of AA patients were reduced by 20.2% ( Z=-3.89, P<0.001) and 45.8% ( Z=-4.01, P<0.001), respectively. Allergens increased the percentages of classical, intermediate, and non-classical monocytes in AA patients in vitro by 13.1%-61.5% (all P<0.05). Compared with healthy controls, the percentages of IL-18 expression in classical monocytes of AA patients was elevated by 1.08-fold ( Z=-6.40, P<0.001), whereas the percentages of IL-18 expression in intermediate and non-classical monocytes were reduced by 52.7% ( Z=-6.40, P<0.001) and 3.23% ( Z=-3.13, P=0.001), respectively. Allergens upregulated IL-18 expression by 16.4%-67.8% in the classical and intermediate monocytes of AA patients (all P<0.05). Compared with healthy controls, IL-18BPa expression level was lower in the three monocyte subtypes of AA patients (all P<0.05). However, allergens upregulated IL-18BPa expression by 8.9% and 13.3% in the classical monocytes (both P<0.05). Compared with healthy controls, IL-18Rα expression was elevated by 1.29-fold in the classical monocytes of AA patients ( Z=-6.40, P<0.001). Allergens upregulated IL-18Rα expression by 17.6%-39.2% in the three monocyte subtypes of AA patients (all P<0.05). Plasma levels of IL-1β and TNF-α in the AA patients were increased compared to those in healthy controls (all P<0.001), and correlated with the percentage of IL-18 +classical monocytes ( r=0.451, 0.714; both P<0.05). Conclusions:Allergens may participate in the inflammatory response of AA by inducing the differentiation of monocytes and the expression levels of IL-18, IL-18BPa and IL-18Rα in different blood monocytes subtypes. Classical monocytes are the potential source of elevated plasma IL-18 level in AA patients.
6.Experience of parents engaging in kangaroo mother care for preterm infants in the NICU:a qualitative Meta-synthesis
Weizhen ZOU ; Liqing YUE ; Bingyu LI ; Xiuwen CHEN ; Bin PENG ; Tiange ZHANG ; Qiang PENG ; Huiqiong CHEN ; Moyan LIU
Chinese Journal of Nursing 2025;60(20):2534-2541
Objective To systematically evaluate and analyze qualitative studies of parental engagement in kangaroo mother care experiences for preterm infants in the NICU,aiming to provide references for promoting the early recovery of preterm infants in NICU and improving the quality of nursing services.Methods Relevant were searched for qualitative studies of parental engagement in kangaroo mother care for preterm infants in NICU.The search time limit was from the construction of the database to July 19,2024.The quality of the included literature was assessed using the Joanna Brigg Institute's(JBI)Australian Centre for Evidence-Based Health Care's Quality Assessment Criteria for Qualitative Research,and the results were integrated using the meta-integration methods.Results A total of 17 papers were included in the literature,and 61 findings were extracted,grouped into 10 new categories.These were further synthesized into 4 integrated findings:physical and psychological perceptions of participation in kangaroo mother care;challenges to participation in kangaroo mother care;facilitators of participation in kangaroo mother care;expectations and suggestions for kangaroo mother care.Conclusion Hospital administrators should further improve the management specifications of kangaroo mother care for preterm infants in NICU,optimize resource allocation and strengthen publicity.At the same time,healthcare professionals should actively promote the establishment of peer and family support systems and increase participation in kangaroo mother care to facilitate early recovery of preterm infants in NICU and to continuously promote the improvement of nursing service quality.
7.The Establishment of a Virus-related Lymphoma Risk Warning System and Health Management Model Based on Traditional Chinese Medicine Conditions
Hanjing LI ; Shunan LI ; Zewei ZHUO ; Shunyong WANG ; Qiangqiang ZHENG ; Bingyu HUANG ; Yupeng YANG ; Chenxi QIU ; Ningning CHEN ; He WANG ; Tingbo LIU ; Haiying FU
Journal of Traditional Chinese Medicine 2025;66(4):335-339
Virus-related lymphoma exhibits a dual nature as both a hematologic malignancy and a viral infectious disease, making it more resistant to treatment and associated with poorer prognosis. This paper analyzes the understanding and therapeutic advantages of traditional Chinese medicine (TCM) in virus-related lymphoma. It proposes a TCM-based approach centered around syndrome differentiation, using standardized measurements of the overall TCM condition, multi-omics research of hematologic tumors, and artificial intelligence technologies to identify the "pre-condition" of virus-related lymphoma. A risk warning model will be established to early identify high-risk populations with viral infections that may develop into malignant lymphoma, thereby establishing a risk warning system for virus-related lymphoma. At the same time, a TCM health management approach will be applied to manage and regulate virus-related lymphoma, interrupting its progression and forming a human-centered, comprehensive, continuous health service model. Based on this, a standardized, integrated clinical prevention and treatment decision-making model for virus-related lymphoma, recognized by both Chinese and western medicine, will be established to provide TCM solutions for primary prevention of major malignant tumors.
8.Study on the distribution of traditional Chinese medicine syndromes and syndrome elements in lymphoma and the correlation between syndromes and Western medicine clinical indicators
Hanjing LI ; Shunan LI ; Zewei ZHUO ; Shunyong WANG ; Qiangqiang ZHENG ; Bingyu HUANG ; Yupeng YANG ; Chenxi QIU ; Ningning CHEN ; Yanyan QIU ; He WANG ; Tingbo LIU ; Haiying FU
Journal of Beijing University of Traditional Chinese Medicine 2025;48(1):127-137
Objective:
To investigate the distribution of traditional Chinese medicine (TCM) syndromes and syndrome elements in lymphoma, as well as the correlation between TCM syndromes and Western clinical indicators, in order to analyze associations between TCM syndromes and these indicators.
Methods:
From January 2023 to May 2024, 216 patients with lymphoma who met the inclusion criteria in the Department of Hematology, Third People′s Hospital Affiliated to Fujian University of Traditional Chinese Medicine were enrolled. Four diagnostic methods were applied to perform TCM syndrome differentiation and extract syndrome elements. The correlations between various syndromes and blood test indicators of lactate dehydrogenase (LDH), β2-microglobulin (β2-MG), immunoglobulin G (IgG), immunoglobulin M (IgM), immunoglobulin A (IgA), white blood cell (WBC), hemoglobin (Hb), platelet count (PLT), neutrophil (NEUT), immunohistochemical markers of B-cell lymphoma-6 (BCL6), B-cell lymphoma-2 (BCL2), proto-oncogene MYC, and Ki67 protein expression, Ann Arbor staging, international prognostic index (IPI) score, bone marrow infiltration, concurrent infections during chemotherapy, and post-chemotherapy bone marrow suppression rate were analyzed.
Results:
Five TCM syndromes, ranked by frequency, were syndromes of yin deficiency with phlegm accumulation(41.67%), qi depression with phlegm obstruction(30.56%), cold-phlegm congelation and stagnation(12.96%), phlegm-blood stasis toxin(12.04%), and lingering pathogen due to deficient vital qi(2.77%). Yin deficiency(50.93%) and phlegm(45.37%) were the more prevalent syndrome elements. The TCM syndromes were correlated with β2-MG, PLT, MYC, BCL2/MYC, Ki67 protein expression, and bone marrow infiltration (P<0.05). No statistically significant differences were observed in Ann Arbor staging or IPI score across the syndromes. Compared to the syndrome of cold-phlegm congelation and stagnation, the syndrome of qi depression with phlegm obstruction exhibited higher levels of NEUT, MYC, BCL2/MYC, and Ki67 protein expression, as well as a higher rate of post-chemotherapy bone marrow suppression (P<0.05); the syndrome of phlegm-blood stasis toxin showed higher MYC and BCL2/MYC protein expression and a higher rate of post-chemotherapy bone marrow suppression rate (P<0.05); the syndrome of yin deficiency with phlegm accumulation demonstrated higher MYC and BCL2/MYC protein expression and bone marrow infiltration rates, whereas PLT level was lower (P<0.05); the syndrome of lingering pathogen due to deficient vital qi had higher MYC, BCL2/MYC, and Ki67 protein expression levels, as well as a higher rate of post-chemotherapy bone marrow suppression rate (P<0.05). Compared to the syndrome of qi depression with phlegm obstruction, the syndrome of phlegm-blood stasis toxin exhibited lower Ki67 protein expression (P<0.05); the syndrome of yin deficiency with phlegm accumulation had higher β2-MG level, bone marrow infiltration rate, and rate of concurrent infections during chemotherapy, whereas PLT and NEUT levels and the rate of post-chemotherapy bone marrow suppression rate were lower (P<0.05). Compared to the syndrome of phlegm-blood stasis toxin, the syndrome of yin deficiency with phlegm accumulation had higher β2-MG level, whereas NEUT and the rate of post-chemotherapy bone marrow suppression were lower(P<0.05); the syndrome of lingering pathogen due to deficient vital qi exhibited a higher Ki67 protein expression (P<0.05). Compared to the syndrome of yin deficiency with phlegm accumulation, the syndrome of lingering pathogen due to deficient vital qi also showed a higher Ki67 protein expression(P<0.05).
Conclusion
The syndrome of yin deficiency with phlegm accumulation is relatively common in lymphoma. There is a correlation between TCM syndromes and Western medicine clinical indicators. The presence of heat signs in the syndromes may indicate active disease and poor prognosis, while the presence of strong pathogenic factors and weak vital qi in the syndromes may indicate a severer chemotherapy-related bone marrow suppression.
9.Study on the levels and potential mechanisms of degranulated basophils in the blood of patients with sepsis
Yuhan SUN ; Shengyong REN ; Mengmeng ZHAN ; Xin DONG ; Shihao LIU ; Congyi ZHAO ; Junling WANG ; Bingyu QIN
Chinese Journal of Emergency Medicine 2025;34(10):1373-1381
Objective:To compare the degranulation levels of basophils in peripheral blood mononuclear cell (PBMC) and granulocyte populations between healthy subjects and patients with sepsis, and to explore the underlying mechanisms. Additionally, plasma cytokine levels were measured in these volunteers.Methods:Peripheral blood samples were collected from both healthy individuals and sepsis patients. The degranulation level of basophils in sepsis patients and its potential mechanisms were examined. Plasma levels of IL-1β, IL-9, and IL-10 were detected, and Pearson correlation analysis was performed to assess the relationship between degranulated basophils in the granulocyte population and IL-9 levels.Results:Compared with healthy subjects, sepsis patients showed a reduction in basophil percentages within PBMC and granulocyte populations by 94.8% and 37.9%, respectively ( Z = -6.441, P < 0.05; Z = -2.681, P < 0.05). In contrast, both the proportion and number of degranulated basophils in the granulocyte population were increased (both P < 0.05). Plasma levels of IL-1β, IL-9, and IL-10 were significantly elevated in sepsis patients--by 80.6%, 36.7%, and 11.9-fold, respectively ( Z = -4.258, P < 0.05; Z = -3.606, P < 0.05; Z = -4.814, P < 0.05). Moreover, plasma IL-9 levels were highly correlated with both the percentage and count of degranulated basophils in the granulocyte population (both P < 0.05). GO and KEGG enrichment analyses revealed cytological changes and potential mechanisms involving basophils in the PBMC of sepsis patients. Conclusions:The decreased total count of basophils in sepsis patients may elevate the risk of secondary infection. Degranulated basophils in the granulocyte population may contribute to excessive inflammatory responses through IL-9 secretion.
10.Construction and validation of a dynamic nomogram prognostic model based on perineural invasion and lymphovascular tumor embolus for patients with gastric cancer after postoperative chemotherapy
Buyun SONG ; Wenbo LIU ; Yong LI ; Xiaohan ZHAO ; Mingming ZHANG ; Xinyu YUAN ; Zhaoxing LI ; Bingyu WANG ; Jiaxiang CUI ; Zaibo ZHANG ; Bibo TAN
Chinese Journal of General Surgery 2025;40(8):631-638
Objective:To verify the prognostic value of perineural invasion and lymphovascular tumor embolus for patients with gastric cancer undergoing gastrectomy and postoperative chemotherapy, and establish a prognostic prediction nomogram model.Methods:According to 7∶3 radio, 781 gastric cancer patients were randomly divided into training cohort and internal validation cohort. One hundred fifty patients were utilized as the external validation cohort. Univariate and multivariate analysis were performed to evaluate the prognostic value of perineural invasion and lymphovascular tumor embolus, and construct the dynamic nomogram. The concordance index (C-index), net reclassification index and integrated discrimination improvement index, receiver operating characteristic curve, calibration curves and decision curve analysis were used to evaluate the nomogram.Results:Perineural invasion ( HR=1.486, 95% CI: 1.150-1.919, P<0.01) and lymphovascular tumor embolus ( HR=1.321, 95% CI: 1.030-1.693, P<0.05) were independent prognostic risk factors for patients with gastric cancer after gastrectomy and postoperative chemotherapy. C-index (training cohort: 0.734, internal validation cohort: 0.755, external validation cohort: 0.715), net reclassification index (training cohort: 0.228 for 3-year and 0.213 for 5-year OS prediction; internal validation cohort: 0.211 for 3-year and 0.279 for 5-year OS prediction; external validation cohort: 0.220 for 3-year and 0.440 for 5-year OS prediction) and integrated discrimination improvement index (training cohort: 0.051 for 3-year and 0.041 for 5-year OS prediction; internal validation cohort: 0.027 for 3-year and 0.036 for 5-year OS prediction; external validation cohort: 0.063 for 3-year and 0.153 for 5-year OS prediction) indicated that the nomogram performed better than the traditional TNM staging system ( P<0.05). Conclusions:Perineural invasion and lymphovascular tumor embolus are independent prognostic risk factors of gastric cancer patients after postoperative chemotherapy. The novel dynamic nomogram model based on perineural invasion and lymphovascular tumor embolus provides better assistance in evaluating prognosis of gastric cancer patients.


Result Analysis
Print
Save
E-mail