1.Analysis of clinical characteristics and etiologies of hospitalized patients with spike-and-wave activation in sleep
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Applied Clinical Pediatrics 2025;40(6):426-433
Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.
2.Analysis of clinical characteristics and etiologies of hospitalized patients with spike-and-wave activation in sleep
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Applied Clinical Pediatrics 2025;40(6):426-433
Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.
3.Biomarker identification and mechanism of polycystic ovary syndrome based on multi-omics analysis
Xinna LIU ; Mengqun LIU ; Jiwen WANG ; Junbiao YANG ; Xuzhe ZHOU ; Chen LIU ; Mingxuan LI ; Ying WANG
Journal of China Pharmaceutical University 2025;56(5):634-644
Based on a letrozole-induced rat model of polycystic ovary syndrome (PCOS), serum metabolomics was employed to characterize metabolic abnormalities, identify potential biomarkers, and investigate their roles in the pathogenesis and progression of PCOS. Metabolomic analyses revealed significantly decreased levels of cholesterol, pregnenolone, leucine, and citrate in the serum of model rats, accompanied by elevated levels of androsterone glucuronide (ADTG) and linoleic acid, indicating dysregulation of key pathways including steroid biosynthesis, branched-chain amino acid metabolism, tricarboxylic acid (TCA) cycle, and lipid metabolism. To elucidate the tissue origins and molecular mechanisms underlying these metabolic alterations, ovarian proteomics and qRT-PCR analyses were further integrated. The results confirmed the upregulation of key enzymes involved in the related metabolic pathways, such as 17α-hydroxylase (CYP17A1), 11β-hydroxysteroid dehydrogenase (HSD11B1), branched-chain amino acid aminotransferase (BCAT2), fatty acid desaturase 2 (FADS2), and oxoglutarate dehydrogenase (OGDH). These findings suggest that both “cholesterol precursor depletion-androgen accumulation” and “energy/lipid metabolic reprogramming” constitute core features of metabolic disturbances in PCOS. Through multi-omic cross-validation, six serum metabolites with high stability and clinical translational potential were identified as promising combinational biomarkers for the auxiliary diagnosis of PCOS. This study employed a metabolomics-guided strategy, supported by proteomic and transcriptomic validation, which has not only deepened our understanding of PCOS metabolic mechanisms but also provided us with a theoretical foundation for its auxiliary diagnosis.
4.Two cases of developmental and epileptic encephalopathy related to the EEF1A2 gene and a literature review
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Neurology 2025;58(4):404-413
Objective:To investigate the clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene. Methods:The clinical data and whole exome sequencing results of 2 patients who were diagnosed as developmental and epileptic encephalopathy related to the EEF1A2 gene in the Children′s Hospital, Capital Institute of Pediatrics in June 2016 and August 2018 were retrospectively analyzed. Relevant literatures were retrieved using " EEF1A2" and "epileptic encephalopathy" or "epilepsy" as key words in Online Mendelian Inheritance in Man, PubMed, CNKI and Wanfang databases (literatures searching from establishment of these databases to June 2024). The clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene were summarized based on literature reports and the data of these 2 patients. Results:Patient 1 was a 9 months old male infant. He presented with global developmental delay. He developed myoclonic seizures at 4 months old. Valproic acid, clonazepam, topiramate and vagus nerve stimulation were all ineffective. Both of his hands had transverse palmar crease. The de novo c.364G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Patient 2 was a 2 years and 2 months old boy. He presented with global developmental delay. Myoclonic seizures occurred when he was 2 years and 3 months old, and various anti-epileptic drugs were ineffective. He had left eye esotropia and low muscle tone in the extremities. He died at the age of 4. The de novo c.208G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Eight literatures on developmental and epileptic encephalopathy related to the EEF1A2 gene (all in English) were retrieved, reporting 28 cases (totally 30 patients, including 2 cases in this study). The main clinical manifestations were psychomotor developmental delay (30/30, 100.0%), facial dysmorphism (15/30, 50.0%), refractory epilepsy (14/26, 53.8%), myoclonic seizures (19/26, 73.1%), and movement disorders (8/16). A total of 15 mutation sites in the EEF1A2 gene were reported, all of which were missense mutations. Conclusions:Developmental and epileptic encephalopathy related to the EEF1A2 gene is primarily characterized by delayed psychomotor development, distinctive facial features, drug-resistant epilepsy, myoclonic seizures, and movement disorders. Variants in the EEF1A2 gene are predominantly missense mutations, and identifying these variants plays a crucial role in accurate diagnosis of the disease.
5.Drug resistance before anti-retroviral therapy among newly dignosed HIV/AIDS patients aged 50 years and above in Yangzhou City
XU Li ; LIU Ping ; BIAN Yuxun ; CHEN Yuanyuan ; LI Xinna ; ZHOU Le
Journal of Preventive Medicine 2025;37(8):779-782,788
Objective:
To investigate the status of drug resistance before anti-retroviral therapy among newly dignosed HIV/AIDS patients aged ≥50 years in Yangzhou City, Jiangsu Province, so as to provide the evidence for improving the anti-retroviral therapy effect of AIDS.
Methods:
HIV/AIDS patients aged ≥50 years who were newly dignosed in Yangzhou City from 2021 to 2024 and did not receive anti-retroviral therapy were selected. Basic information were collected through the Chinese Disease Prevention and Control Information System. Blood samples were collected to determine CD4+T lymphocyte (CD4 cell) counts and HIV-1 viral load. Following nucleic acid extraction, the pol gene region was amplified using reverse transcription and nested PCR, and subsequently subjected to Sanger sequencing. The resulting sequences were uploaded to the Stanford University HIV Drug Resistance Database to analyze drug resistance to non-nucleoside reverse transcriptase inhibitors (NNRTIs), protease inhibitors (PIs), and nucleoside reverse transcriptase inhibitors (NRTIs).
Results:
Totally 404 blood samples from HIV/AIDS patients were collected, with successful sequencing of the pol gene region in 341 cases. Among them, 253 (74.19%) were males and 88 (25.81%) were females, with a mean age of (62.48±7.60) years. A total of 152 cases (44.57%) had CD4 cell counts below 200 cells/μL, and 296 cases (86.80%) had HIV-1 viral loads exceeding 5 000 copies/mL. A total of 87 cases exhibited drug resistance-associated mutations, corresponding to a mutation rate of 25.51%. The predominant mutation site was V179, with a mutation rate of 17.01%. A total of 29 cases exhibited resistance to at least one drug, resulting in a resistance rate of 8.50%. The resistance rates to NNRTIs, PIs, and NRTIs were 5.57%, 2.93%, and 1.17%, respectively. The HIV/AIDS patients exhibited varying degrees of resistance to 13 anti-retroviral drugs, with low- or intermediate-level drug resistance being predominant. High-level drug resistance cases were observed against NNRTIs such as nevirapine and efavirenz.
Conclusions
The drug resistance rate before anti-retroviral therapy among newly dignosed HIV/AIDS patients aged ≥50 years in Yangzhou City was at a moderate level. The predominant resistance mutation was observed at V179 site, with NNRTIs resistance being most prevalent, primarily demonstrating low- or intermediate-level drug resistance.
6.Two cases of developmental and epileptic encephalopathy related to the EEF1A2 gene and a literature review
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Neurology 2025;58(4):404-413
Objective:To investigate the clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene. Methods:The clinical data and whole exome sequencing results of 2 patients who were diagnosed as developmental and epileptic encephalopathy related to the EEF1A2 gene in the Children′s Hospital, Capital Institute of Pediatrics in June 2016 and August 2018 were retrospectively analyzed. Relevant literatures were retrieved using " EEF1A2" and "epileptic encephalopathy" or "epilepsy" as key words in Online Mendelian Inheritance in Man, PubMed, CNKI and Wanfang databases (literatures searching from establishment of these databases to June 2024). The clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene were summarized based on literature reports and the data of these 2 patients. Results:Patient 1 was a 9 months old male infant. He presented with global developmental delay. He developed myoclonic seizures at 4 months old. Valproic acid, clonazepam, topiramate and vagus nerve stimulation were all ineffective. Both of his hands had transverse palmar crease. The de novo c.364G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Patient 2 was a 2 years and 2 months old boy. He presented with global developmental delay. Myoclonic seizures occurred when he was 2 years and 3 months old, and various anti-epileptic drugs were ineffective. He had left eye esotropia and low muscle tone in the extremities. He died at the age of 4. The de novo c.208G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Eight literatures on developmental and epileptic encephalopathy related to the EEF1A2 gene (all in English) were retrieved, reporting 28 cases (totally 30 patients, including 2 cases in this study). The main clinical manifestations were psychomotor developmental delay (30/30, 100.0%), facial dysmorphism (15/30, 50.0%), refractory epilepsy (14/26, 53.8%), myoclonic seizures (19/26, 73.1%), and movement disorders (8/16). A total of 15 mutation sites in the EEF1A2 gene were reported, all of which were missense mutations. Conclusions:Developmental and epileptic encephalopathy related to the EEF1A2 gene is primarily characterized by delayed psychomotor development, distinctive facial features, drug-resistant epilepsy, myoclonic seizures, and movement disorders. Variants in the EEF1A2 gene are predominantly missense mutations, and identifying these variants plays a crucial role in accurate diagnosis of the disease.
7.Application of Cardiac Magnetic Resonance in the Evaluation of Left Atrium
Xinna ZHANG ; Weishu HOU ; Honglin YU ; Lingling ZHAO ; Panpan YANG ; Yuqi JIANG ; Xiaohu LI
Chinese Journal of Medical Imaging 2024;32(1):100-104
As the continuation of the left ventricle,the left atrium and left ventricle interact and play an important role in the function of the whole heart.At present,there are many techniques to evaluate the atrial structure and function,but the left atrial structure is complex and the myocardium is thin,which brings some challenges to the relevant evaluation.This paper introduces the parameters,precautions and relevant clinical applications in the process of left atrial evaluation from the aspects of myocardial strain and delayed enhancement.
8.Feasibility of evaluating coronary artery calcium score on virtual non-contrast scan in dual-layer spectral detector CT
Panpan Yang ; Lu Lu ; Mao Sheng ; Ruomei Li ; Ji Zhang ; Yuqi Jiang ; Xinna Zhang ; Wei Deng ; Yuguo Li ; Shutian An ; Ren Zhao ; Yongqiang Yu ; Xiaohu Li
Acta Universitatis Medicinalis Anhui 2023;58(4):692-697
Objective:
To evaluate the accuracy and feasibility of coronary artery calcium score ( CACS) on virtual non-contrast scan ( VNC) images obtained from coronary artery CT angiography ( CCTA) scan with dual -layer spectral detector CT (SDCT) .
Methods :
The data of 197 patients who underwent CCTA scan in hospital were analyzed retrospectively,and 88 patients with CACS >0 were further analyzed. Linear regression analysis of CACS and coronary artery calcium volume ( CACV) of true non-contrast (TNC) images and VNC images ( CACS-TNC, CACS-VNC,CACV-TNC,CACV-VNC) was performed to obtain linear regression equation and correction coefficients λ 1AVG and λ2AVG .CACS-VNC and CACV-VNC were corrected by the corresponding regression equation and recorded as CCACS-VNC and CCACV-VNC,respectively.Spearman correlation coefficient was used for correlation analysis and Bland-Altman plot was used for consistency test.Mann-Whitney U test was used to compare the difference between the two groups.
Results :
For the total coronary artery,there was a strong correlation between CACS- TNC and CACS-VNC (rs = 0. 952,P <0. 001 ,λ 1AVG = 2. 19 ) ,CACV-TNC and CACV-VNC ( rs = 0. 954,P < 0. 001,λ2AVG = 1. 93) .The results of Mann-Whitney U test showed that there was no significant difference between CACS-TNC and CCACS-VNC or between CACV-TNC and CCACV-VNC,and the Bland-Altman plot showed good consistency between CACS-TNC and CCACS-VNC ,CACV-TNC and CCACV-VNC.
Conclusion
VNC images based on SDCT can accurately measure CACS and be used for cardiovascular risk classification,which is expected to replace TNC scan and reduce the radiation dose of patients.
9.Epidemic characteristics and genotyping of varicella in Yangzhou in 2021
Rongrong XYU ; Yao HUANG ; Yuxun BIAN ; Xinna LI ; Le ZHOU ; Qin XYU
Journal of Public Health and Preventive Medicine 2023;34(2):131-134
Objective To analyze the epidemic characteristics of varicella and the genetic characteristics of varicella zoster virus (VZV) in Yangzhou in 2021, and to provide a theoretical basis for the scientific prevention and control of varicella in Yangzhou. Methods Descriptive epidemiological analysis was carried out on the varicella outbreaks reported in Yangzhou in 2021. Throat swabs or herpes fluid samples from varicella cases in 2021 were collected, and the viral nucleic acid was detected by real-time fluorescent quantitative PCR. The genotype and evolutionary relationship of the virus strain were determined according to the 6 SNPs in the ORF22 gene fragment sequence. Results In 2021, there were 20 varicella outbreaks in Yangzhou, involving 147 cases, all of which occurred in kindergartens and primary and secondary schools, and the peak incidence was in the age group of 4-7 years old. The high incidence time of the outbreaks was from May to July, and from November to January of the next year. The varicella vaccination rate of the cases was low, and all were 1-dose vaccination. The gene sequencing results of 8 samples were J/clade 2, and 3 of them had A-C synonymous mutation at position 37997 in ORF22 sequence. Conclusion In 2021, varicella outbreaks in Yangzhou occurred mainly in kindergartens and schools. Preschool children are susceptible, all of which are caused by J/clade 2 varicella-zoster virus. It is suggested to strengthen the monitoring and management of the varicella epidemic situation in schools in the city, and at the same time incorporate the varicella vaccine into the routine immunization program of the city and strengthen 2 doses of varicella vaccination.
10.Clinical characteristics and analysis of diagnosis and treatment of 16 patients with GATOR1 complex-related epilepsy
Yanyan GAO ; Ying CHAI ; Xinna JI ; Xingzhou LIU ; Shupin LI ; Pingping ZHANG ; Qian CHEN ; Wei ZHANG
Chinese Journal of Neurology 2023;56(2):133-142
Objective:To analyze the clinical manifestations, gene mutation characteristics and treatment effects of patients with GATOR1 complex-related epilepsy, and to explore the diagnosis and treatment of this disease.Methods:The medical history, electroencephalogram, brain imaging, genetic test results, treatment and follow-up data of patients with GATOR1 complex-related epilepsy who attended the Children′s Hospital Affiliated to Capital Institute of Pediatrics, Beijing Tsinghua Changgung Hospital, and Shanghai Deji Hospital from May 2017 to July 2022 were retrospectively analyzed.Results:A total of 16 patients with GATOR1 complex-related epilepsy were collected, including 7 males and 9 females. The age of onset of epilepsy was from 2 months to 14 years. Ten cases had focal seizures only, 2 cases had generalized seizures only, and 4 cases had coexistence of focal seizures and generalized seizures, of which generalized seizures included generalized tonic-clonic seizure, spastic seizure, and myoclonic seizure. Among the 16 patients, 2 had infantile spasms, 3 had familial focal epilepsy with variable focus, and 1 had sleep related hyperkinetic epilepsy. Electroencephalogram intervals suggested multiple brain areas discharge or diffuse discharge. A total of 13 DEPDC5 gene mutation sites, 1 NPRL2 gene mutation site, and 2 NPRL3 gene mutation sites were found; 4 sites of DEPDC5 gene were reported sites, the rest were unreported; all mutations had pathogenic significance; 8 cases had nonsense mutation, 1 case had large fragment deletion, 4 cases had frameshift mutation, 1 case had integer mutation, 2 cases had splicing mutation; 13 cases′ mutation was inherited from parents, 2 cases had new mutation, and 1 case had unverified mutation. Magnetic resonance imaging (MRI) showed 5 of the 16 patients were normal, and 11 had abnormal cerebral cortex structure, manifested as bottom-of-sulcus focal cortical dysplasia (FCD), abnormal formation of sulci and (or) gyri with or without ill-defined gray-white matter and malformation of cortical dysplasia of the bilateral brain. Seven patients underwent stereotactic electroencephalogram (SEEG) monitoring, and the SEEG showed low-amplitude fast rhythm at the beginning in 6 patients, of whom 5 cases started from the frontal lobe, and 1 case started from the parietal lobe. Eight patients were only treated with drugs, 1 with single-drug therapy and the rest with multi-drug combination therapy. Eight patients underwent surgery. Among them, 5 patients with DEPDC5 gene mutation underwent epileptogenic cortex excising after SEEG monitoring, and postoperative pathological examinations showed FCDⅡ, FCDⅢ or non-specific changes; 1 patient was waiting for surgery. One patient with NPRL3 gene mutation underwent epileptogenic foci resection and postoperative pathological examinations showed FCDⅡa; the other patient with NPRL3 gene mutation underwent radiofrequency thermocoagulation after SEEG monitoring. Follow-up showed that 3 patients were seizure-free with drug treatment, and 4 patients had fewer seizures after drug treatment. Six cases underwent epileptic foci resection. Five of them were assisted by SEEG to locate the epileptic foci before surgery and were seizure-free after the operation, but the range of surgical resection was wider than the abnormal range shown by MRI; whereas 1 case who was not assisted by SEEG showed no improvement. There was still 1 case who underwent SEEG-guided radiofrequency thermocoagulation and had no improvement after operation. Conclusions:GATOR1 complex-related epilepsy mostly manifests as focal seizures. SEEG shows that seizures originate from the frontal lobe more often, and cortical developmental abnormalities are often found. DEPDC5 gene mutations are the most common ones, mostly inherited from parents, with high incomplete penetrance rate. Therefore, genetic testing is recommended for non-acquired brain structural abnormalities. For those who are refractory to drugs, a radical cure can be obtained by resection of the epileptogenic foci after preoperative evaluation.


Result Analysis
Print
Save
E-mail