ObjectiveThis paper aims to observe the protective effect of Huamoyan granules on knee osteoarthritis （KOA） and explore whether its protective effect is oriented toward an anti-inflammatory direction by regulation of macrophage polarization， which can effectively inhibit the progression of pathological inflammatory response， reduce the release of inflammatory pain mediators， and downregulate the protein expression level of transient receptor potential vanilloid 1 （TRPV1）， so as to provide experimental evidence for its clinical application and investigate its action mechanism. MethodsAfter adaptive feeding， Sprague-Dawley （SD） rats were randomly divided into six groups： sham group， model group， celecoxib group， and high， medium， and low-dose synovitis granule groups （9.6， 4.8， 2.4 g·kg^-1）. The administration dose of celecoxib capsules was 20 mg·kg^-1. There were 10 rats in the sham group and 12 rats in the model group and each administration group. A KOA animal model was established by means of intra-articular injection of sodium iodoacetate into the knee joint. From the 10^th day of the experiment， each administration group was given intragastric administration at a dose of 10 mL·kg^-1 for 4 weeks. General conditions of rats in each group were assessed daily. The pressure pain threshold （PPT） to mechanical stimulation and joint diameter were recorded. X-ray examination was performed on the right knee joints of rats for imaging analysis. Enzyme linked immunosorbent assay （ELISA） was performed to detect the tumor necrosis factor-α （TNF-α）， serum interleukin-1β （IL-1β）， and other pro-inflammatory cytokines in rat serum samples， as well as the expression levels of neurogenic inflammatory mediators such as nerve growth factor （NGF） and calcitonin gene-related peptide （CGRP）. Histopathological changes in the knee joint synovial tissues were examined by hematoxylineosin （HE） staining. Safranin O-fast green staining was performed to observe and evaluate the degree of knee cartilage lesions. Western blot was employed to quantitatively analyze TRPV1， p38 mitogen-activated protein kinase （p38 MAPK）， and phosphorylated （p）-p38 MAPK in rat knee synovial tissues. Immunofluorescence （IF） was used to measure and assess M1/M2 macrophage polarization. ResultsCompared with those in the sham group， the circumference and joint diameter of the right knee were markedly enlarged in the model group （P<0.01）， while PPTs of rats showed a significant reduction （P<0.01）. The contents of IL-1β， TNF-α， CGRP， and NGF in rats' serum were significantly elevated （P<0.01）， and the synovial Krenn score was increased （P<0.01）. The Mankin score of cartilage tissue was increased （P<0.01）， and the protein expressions of TRPV1 and p-p38 MAPK/p38 MAPK were significantly upregulated （P<0.01）. The experimental intervention significantly reduced the proportion of pro-inflammatory M1 macrophages in the total macrophage population （P<0.01）， and the percentage of M2 macrophages was decreased （P<0.01）. The M1/M2 macrophage ratio was significantly elevated （P<0.01）. Knee joint diameters of all dose groups of Huamoyan granules and the celecoxib group were reduced （P<0.01） compared with those of the model group， and the PPT recovery speeds in the high and medium-dose groups of Huamoyan granules were more obvious （P<0.05）. The contents of IL-1β， CGRP， and NGF in the rats' serum in all administration groups were significantly reduced （P<0.05， P<0.01）， and the content of TNF-α in rats' serum was significantly reduced （P<0.01）. All dose groups of Huamoyan granules demonstrated significant reductions in both synovial Krenn score （P<0.05， P<0.01） and protein expression of TRPV1 and p-p38 MAPK/p38 MAPK in rats' synovial tissues （P<0.01）. The percentage of M1 macrophages in the synovial tissues of the celecoxib group and all dose groups of Huamoyan granules was decreased （P<0.01）. The percentage of M2 macrophages was increased （P<0.05）， and the M1/M2 ratio was decreased （P<0.01）. ConclusionHuamoyan granules can alleviate the inflammatory response of KOA， reduce the release of inflammatory pain mediators， and downregulate TRPV1 protein expression by regulating macrophage polarization. Its mechanism may be related to the TRPV1/p38 MAPK signaling pathway， thereby achieving the effect of improving peripheral pain hypersensitivity in KOA.

Dry eye disease(DED)and depression(DEP), though anatomically and clinically distinct, show significant epidemiological, pathophysiological, and prognostic interplay. Their co-occurrence has risen sharply in recent years, yet the mechanisms driving this comorbidity remain under-investigated. This review systematically synthesizes current evidence, highlighting that pro-inflammatory cytokines, neuro-regulatory imbalance, mitochondrial dysfunction, and gut-microbiota dysbiosis constitute a shared molecular network, while sleep deprivation and antidepressant use further amplify the vicious cycle. By identifying limitations in existing studies, this review proposes future research directions to offer new theoretical and clinical insights for managing DED-DEP comorbidity.

AIM: To explore the factors associated with significant corneal astigmatism during the perioperative period in patients with pterygium. METHODS: Patients with primary pterygium presenting at Shanxi Eye Hospital between February and June 2025 were enrolled. All patients underwent medical history collection. Pre- and postoperative data were obtained using Pentacam, anterior segment photography, Image J software, and anterior segment optical coherence tomography(AS-OCT). All patients underwent pterygium excision combined with autologous bulbar conjunctival flap transplantation under local infiltration anesthesia. RESULTS: A total of 76 patients(76 eyes)with pterygium were finally enrolled(30 males, 46 females)with a mean age of 62.2±8.2 y. The mean length of corneal invasion by pterygium was 3.61±0.89 mm, the mean depth of invasion into the anterior corneal surface was 0.15±0.09 mm, and the median area of corneal invasion was 10.25(6.90, 18.75)mm2. The median preoperative corneal astigmatism was 1.50(0.70, 5.45)D. Median astigmatism was 0.8(0.40, 1.28)D at 2 wk postoperatively and 0.60(0.30, 1.15)D at 1 mo postoperatively. Patient age showed a positive correlation with preoperative astigmatism, and with residual astigmatism at 2 wk and 1 mo postoperatively(all P<0.05). The length of corneal invasion was positively correlated with preoperative astigmatism and residual astigmatism at both postoperative timepoints(P<0.01). The depth of invasion showed no significant linear correlation with astigmatism at any stage(P=0.250, 0.761, 0.686). The area of corneal invasion was positively correlated with astigmatism at all stages(P<0.01). Patients were grouped based on significant astigmatism(≥1.0 D)and non-significant astigmatism(<1.0 D), after adjusting for other variables, age(P=0.031)and the area of corneal invasion(P=0.004)were identified as risk factors for significant astigmatism. Pterygium invasion length was not significant factors(P>0.05). Receiver operating characteristic(ROC)analysis showed the highest area under the curve(AUC)for the invasion area(AUC=0.915). CONCLUSION: Significant preoperative corneal astigmatism in pterygium patients is correlated with patient age, the length of corneal invasion, and the area of invasion. The area of pterygium invasion into the cornea is the strongest predictor of significant preoperative corneal astigmatism.

BackgroundThe violent aggressive behaviors of patients with schizophrenia usually have the characteristics of suddenness， unpredictability， high severity， and great difficulty in prevention. Early identification and accurate assessment of their risk of violent aggression have significant clinical significance. ObjectiveTo construct a predictive model for the violence risk in hospitalized patients with schizophrenia， to identify the key factors influencing the occurrence of violent behavior in these patients， so as to provide references for clinical precise quantitative assessment and early intervention. MethodsA total of 200 patients with schizophrenia who were hospitalized at Taiyuan Psychiatric Hospital from March 2022 to September 2024 and met the diagnostic criteria of the International Classification of Diseases， eleventh edition （ICD-11） were collected to form the modeling cohort. They were randomly divided into a training set （n=140） and a test set （n=60） at a ratio of 7∶3. Based on the least absolute shrinkage and selection operator （LASSO） regression algorithm， the feature variables were screened and dimension-reduced. The support vector machine （SVM） from machine learning was selected for model training and prediction. The discrimination efficacy of the model was evaluated by the area under the receiver operating characteristic （ROC） curve （AUC）， accuracy， precision， sensitivity， specificity， F1 value， and Brier value. ResultsLASSO regression screening identified 16 feature variables. Pearson correlation analysis revealed a positive correlation between prior violent behavior frequency and clinical psychiatric symptom scores （r=0.580， P<0.01）， a positive correlation between hospitalization compliance and current disease status （r=0.550， P=0.003）， and a positive correlation between educational level and family per capita monthly income （r=0.367， P<0.01）. The SVM model achieved an AUC of 0.853， accuracy of 0.800， precision of 0.810， sensitivity of 0.895， specificity of 0.636， F1 value of 0.850， and Brier value of 0.168. ConclusionThe SVM model has a relatively high level of applicability and overall predictive performance in the assessment of violent risk in schizophrenia patients， which is helpful for the early identification of violent risks in such patients. ［Funded by Specialized Research Project for Enhancing the Competence of Health Professionals in Taiyuan City （number， Y2023006）］

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveBased on ultra-high performance liquid chromatography-quadrupole-time-of-flight mass spectrometry（UPLC-Q-TOF-MS/MS）， network pharmacology and molecular docking techniques， to explore the pharmacodynamic material basis and mechanism of Renshen Wuweizi Tang in treating spleen-lung Qi deficiency syndrome. MethodsThe chemical components in the decoction of Renshen Wuweizi Tang were systematically characterized and identified by UPLC-Q-TOF-MS/MS， and network pharmacology was used to screen potential active ingredients， collect component targets and gene sets related to spleen-lung Qi deficiency syndrome， and obtain protein interaction relationships through STRING. Cytoscape 3.9.1 was used to construct a "formula-syndrome" association network and calculate topological feature values. Gene ontology（GO） function and Kyoto Encyclopedia of Genes and Genomes（KEGG） pathway enrichment analysis were performed on core genes to explore potential pharmacodynamic links， the average shortest path between the formula-drug target network and the pharmacodynamic link gene network was calculated to discover dominant pharmacodynamic links， and MCODE plugin was used to identify core gene clusters from the dominant pharmacodynamic links， which were validated using Gene Expression Omnibus（GEO）， and molecular docking was performed between key components and core targets. ResultsOne hundred and thirty-seven components were identified in the negative ion mode， and eighty components were identified in the positive ion mode. After deduplication， a total of 185 components were identified， mainly composed of triterpenoid saponins（49） and flavonoids（54）. Based on the "formula-syndrome" correlation network analysis， energy metabolism was determined to be the dominant pharmacodynamic link of Renshen Wuweizi Tang in the treatment of spleen-lung Qi deficiency syndrome. The results of molecular docking showed that 7 components（adenosine， atractylenolide Ⅱ， atractylenolide Ⅲ， ginsenoside Rg₁， glycyrrhizin B₂， glycyrrhizin E₂ and campesterol） from 4 medicinal materials（Ginseng Radix et Rhizoma， Atractylodis Macrocephalae Rhizoma， Glycyrrhizae Radix et Rhizoma and Poria） in this formula might regulate energy metabolism by acting on 6 targets， namely cyclic adenosine monophosphate-response element binding protein 1（CREB1）， glyceraldehyde-3-phosphate dehydrogenase（GAPDH）， interleukin（IL）-6， nuclear transcription factor（NF）-κB1， peroxisome proliferator-activated receptor α（PPARα）， and tumor necrosis factor（TNF）， thus improving the symptoms of diseases related to spleen-lung Qi deficiency syndrome. ConclusionThis study established a UPLC-Q-TOF-MS/MS for rapid characterization and identification of chemical components in the decoction of Renshen Wuweizi Tang， expanding the understanding of the material composition of this formula， and found that 7 components might act on the key advantageous pharmacodynamic link "energy metabolism" through 6 targets to improve the related symptoms of spleen-lung Qi deficiency syndrome. This can provide a reference for the subsequent exploration of the material benchmark and mechanism of the famous classical formula.

Objective To systematically evaluate the risk prediction model of anastomotic fistula after radical resection of esophageal cancer, and to provide objective basis for selecting a suitable model. Methods A comprehensive search was conducted on Chinese and English databases including CNKI, Wanfang, VIP, CBM, PubMed, EMbase, Web of Science, The Cochrane Library for relevant studies on the risk prediction model of anastomotic fistula after radical resection of esophageal cancer from inception to April 30, 2023. Two researchers independently screened literatures and extracted data information. PROBAST tool was used to assess the risk of bias and applicability of included literatures. Meta-analysis was performed on the predictive value of common predictors in the model with RevMan 5.3 software. Results A total of 18 studies were included, including 11 Chinese literatures and 7 English literatures. The area under the curve (AUC) of the prediction models ranged from 0.68 to 0.954, and the AUC of 10 models was >0.8, indicating that the prediction performance was good, but the risk of bias in the included studies was high, mainly in the field of research design and data analysis. The results of the meta-analysis on common predictors showed that age, history of hypertension, history of diabetes, C-reactive protein, history of preoperative chemotherapy, hypoproteinemia, peripheral vascular disease, pulmonary infection, and calcification of gastric omental vascular branches are effective predictors for the occurrence of anastomotic leakage after radical surgery for esophageal cancer (P<0.05). Conclusion The study on the risk prediction model of anastomotic fistula after radical resection of esophageal cancer is still in the development stage. Future studies can refer to the common predictors summarized by this study, and select appropriate methods to develop and verify the anastomotic fistula prediction model in combination with clinical practice, so as to provide targeted preventive measures for patients with high-risk anastomotic fistula as soon as possible.

The analysis presented here is based on the blood components of Guanxin Qiwei tablets, the key anti-atherosclerosis pathway of Guanxin Qiwei tablets was screened by network pharmacology, and the anti-atherosclerosis mechanism of Guanxin Qiwei tablets was clarified and verified by cell experiments. HPLC-Q-Exactive-MS/MS technique was used to analyze the components of Guanxin Qiwei tablets into blood, to determine the precise mass charge ratio of the compounds, and to conduct a comprehensive analysis of the components by using secondary mass spectrometry fragments and literature comparison. Finally, a total of 42 components of Guanxin Qiwei tablets into blood were identified. To better understand the interactions, we employed the Swiss Target Prediction database to predict the associated targets. Atherosclerosis (AS) disease targets were searched in disease databases Genecard, OMIM and Disgent, and 181 intersection targets of disease targets and component targets were obtained by Venny 2.1.0 software. Protein interactions were analyzed by String database. The 32 core targets were selected by Cytscape software. Gene Ontology (GO) enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis were performed in DAVID database. It was found that the anti-atherosclerosis pathways of Guanxin Qiwei tablets mainly include lipid metabolism and atherosclerosis and AGE-RAGE signaling pathway in diabetic complications and other signal pathways. The core targets and the core compounds were interlinked, and it was found that cryptotanshinone and tanshinone ⅡA in Guanxin Qiwei tablets were well bound to TNF, PPARγ, AKT1, PTG2 and other targets. The lipid metabolism and atherosclerotic pathway was verified using human hl-7702 hepatocytes. This study preliminarily identified the potential pharmacodynamic components of Guanxin Qiwei tablets in the treatment of AS diseases and predicted their pathways of action, and verified the relationship between regulating lipid metabolism and atherosclerosis of Guanxin Qiwei tablets in vitro, providing a reference for the further study of the pharmacodynamic material basis and mechanism of action of this prescription. This experiment was approved by the Medical Ethics Committee of Inner Mongolia Medical University (No. YKD202401262).

OBJECTIVE To explore optimization pathways for the drug traceability code management model in outpatient pharmacy workflows， providing practical evidence for enhancing the efficiency of pharmaceutical service. METHODS Taking the outpatient pharmacy of the First Affiliated Hospital of Sun Yat-sen University as the research subject， a comprehensive drug traceability system was established through three key interventions： upgrading the information system architecture [including integration of the hospital information system （HIS） with the traceability platform]， workflow optimization （reorganizing the inventory-dispensing-verification tripartite process）， and designing a dual-mode traceability data collection mechanism （primary data capture at dispensing stations and supplementary capture at verification stations）. Operational efficiency differences before and after implementation were analyzed using the medical insurance data and service timeliness metrics in September 2024. RESULTS After the implementation of drug traceability code management， in terms of data collection: Mode Ⅰ （verification-stage capture） uploaded 26 144 records， while Mode Ⅲ （inventory-as-sales capture） uploaded 443 061 records， totaling 469 205 entries； in terms of time efficiency： average drug dispensing time increased from 28.74 s to 43.37 s （enhanced by 51%）. Through dynamic staffing adjustments， patient wait time only extended from 8.04 min to 8.67 min （enhanced by 8%）. CONCLUSIONS Drug traceability code management can be effectively implemented via a “system reconstruction-process reengineering-human-machine collaboration” trinity strategy， leveraging informatization （e.g.， dual-mode data capture） to offset manual operation delays， which validates the feasibility of balancing national traceability demands with service efficiency in outpatient pharmacies.

Sleep， skin， and health are closely interconnected. Clinically， insomnia has a high incidence and is often accompanied by or secondary to skin aging. The two conditions exhibit "different diseases with the same syndrome"， significantly affecting the physical and mental health of the Chinese population. Preventing and treating skin aging by improving insomnia is an important strategy， with the principle of "treating different diseases with the same approach" serving as a crucial therapeutic guideline. However， effective clinical prevention and treatment methods for both conditions remain lacking. Traditional Chinese medicine （TCM） has a profound theoretical foundation and notable efficacy in the concurrent treatment of insomnia and skin aging， yet there are few reports on the etiology， pathogenesis， therapeutic principles， and treatment methods of their shared treatment， warranting further exploration. Based on holistic view and syndrome differentiation and treatment in TCM， this study systematically investigates the theoretical origins of the shared manifestations of insomnia and skin aging from multiple dimensions， including etiology， pathological location， pathogenesis， disease nature， and prevention and treatment strategies. As early as Huangdi's Internal Classic （Huangdi Neijing）， it was recognized that mental clarity during the day， sound sleep at night， and firm， healthy skin are key indicators of external health， whereas daytime lethargy， poor sleep quality， and dry， withered skin are prominent signs of aging. Maintaining mental clarity during the day and restful sleep at night is essential for skin integrity and healthy aging. Later medical scholars proposed that the common etiology of insomnia and skin aging lies in "internal-external interactions"， with the pathological location involving "the five organ systems". The primary pathogenesis includes "deficiency， fire， stagnation， phlegm， and blood stasis"， while the disease nature is often characterized by "a combination of deficiency and excess". Treatment should be guided by syndrome differentiation， following the principle of balancing Yin and Yang. This theoretical exploration enriches and advances TCM understanding of disease onset and prevention， providing theoretical guidance for the clinical prevention and treatment of insomnia-associated skin aging and contributing to the realization of the "Healthy China" initiative.