AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Surgical treatment is one of the key approaches for non-small cell lung cancer (NSCLC). Regular postoperative follow-up is crucial for early detection and timely management of tumor recurrence, metastasis, or second primary tumors. A scientifically sound and reasonable follow-up strategy not only extends patient survival but also significantly improves quality of life, thereby enhancing overall prognosis. This consensus aims to build upon the previous version by incorporating the latest clinical research advancements and refining postoperative follow-up protocols for early-stage NSCLC patients based on different treatment modalities. It provides a scientific and practical reference for clinicians involved in the postoperative follow-up management of NSCLC. By optimizing follow-up strategies, this consensus seeks to promote the standardization and normalization of lung cancer diagnosis and treatment in China, helping more patients receive high-quality care and long-term management. Additionally, the release of this consensus is expected to provide insights for related research and clinical practice both domestically and internationally, driving continuous development and innovation in the field of postoperative management for NSCLC.

BACKGROUND:Cervical disc herniation can cause pain in the neck and shoulder area,as well as radiating pain in the upper limbs.The incidence rate is increasing year by year and tends to affect younger individuals.Fully understanding the biomechanical characteristics of the cervical spine in adolescents is of great significance for preventing and delaying the onset of cervical disc herniation in this age group. OBJECTIVE:To reconstruct cervical spine models for both healthy adolescents and adolescent patients with cervical disc herniation utilizing finite element analysis techniques,to analyze the motion range of the C1-T1 cervical vertebrae as well as the biomechanical characteristics of the annulus fibrosus,nucleus pulposus,endplates,and the cartilage of the small joints. METHODS:A normal adolescent's cervical spine and an adolescent patient with cervical disc herniation were selected in this study.The continuous scan cervical spine CT raw image data were imported into Mimics 21.0 in DICOM format.The C1-T1 vertebrae were reconstructed separately.Subsequently,the established models were imported into the 3-Matic software for disc reconstruction.The perfected models were then imported into Hypermesh software for meshing of the vertebrae,nucleus pulposus,annulus fibrosus,and ligaments,creating valid geometric models.After assigning material properties,the final models were imported into ABAQUS software to observe the joint motion range of the C1-C7 cervical vertebrae segments under different conditions,and to analyze the biomechanical characteristics of the annulus fibrosus,nucleus pulposus,endplates,and small joint cartilage of each cervical spine segment. RESULTS AND CONCLUSION:(1)In six different conditions,the joint motion range of the C1 vertebra in the cervical spine models of both normal adolescent and adolescent patient with cervical disc herniation was higher than that of the other vertebrae.Additionally,the joint motion range of each cervical spine segment in normal adolescent was greater than that in adolescent patient with cervical disc herniation.(2)In the cervical spine model of normal adolescent,the maximum stress values in the annulus fibrosus and nucleus pulposus were found on the left side during C2-3 flexion conditions(0.43 MPa and 0.17 MPa,respectively).In the cervical spine model of adolescent patient with cervical disc herniation,the maximum stress values were found on the left side during C7-T1 flexion conditions(0.54 MPa and 0.18 MPa,respectively).(3)In the cervical spine model of normal adolescent,the maximum stress value on the endplate was found on the left side of the upper endplate of C3 during flexion conditions(1.46 MPa).In the model of adolescent patient with cervical disc herniation,the maximum stress value on the endplate was found on the left side of the lower endplate of C7 during flexion conditions(1.32 MPa).(4)In the cervical spine model of normal adolescent,the maximum stress value in the small joint cartilage was found in the C2-3 left rotation conditions(0.98 MPa).In adolescent patient with cervical disc herniation,the stress in the small joint cartilage significantly increased under different conditions,especially in C1-2,with the maximum stress found during left flexion(3.50 MPa).(5)It is concluded that compared to normal adolescent,adolescent patient with cervical disc herniation exhibits altered cervical curvature and a decrease in overall joint motion range in the cervical spine.In adolescent with cervical disc herniation,there is a significant increase in stress on the annulus fibrosus,nucleus pulposus,and endplates in the C7-T1 segment.The stress on the left articular cartilage of the C1-2 is notable.Abnormal cervical curvature may be the primary factor causing these stress changes.

ObjectiveBased on ultra-high performance liquid chromatography-quadrupole-time-of-flight mass spectrometry（UPLC-Q-TOF-MS/MS）， network pharmacology and molecular docking techniques， to explore the pharmacodynamic material basis and mechanism of Renshen Wuweizi Tang in treating spleen-lung Qi deficiency syndrome. MethodsThe chemical components in the decoction of Renshen Wuweizi Tang were systematically characterized and identified by UPLC-Q-TOF-MS/MS， and network pharmacology was used to screen potential active ingredients， collect component targets and gene sets related to spleen-lung Qi deficiency syndrome， and obtain protein interaction relationships through STRING. Cytoscape 3.9.1 was used to construct a "formula-syndrome" association network and calculate topological feature values. Gene ontology（GO） function and Kyoto Encyclopedia of Genes and Genomes（KEGG） pathway enrichment analysis were performed on core genes to explore potential pharmacodynamic links， the average shortest path between the formula-drug target network and the pharmacodynamic link gene network was calculated to discover dominant pharmacodynamic links， and MCODE plugin was used to identify core gene clusters from the dominant pharmacodynamic links， which were validated using Gene Expression Omnibus（GEO）， and molecular docking was performed between key components and core targets. ResultsOne hundred and thirty-seven components were identified in the negative ion mode， and eighty components were identified in the positive ion mode. After deduplication， a total of 185 components were identified， mainly composed of triterpenoid saponins（49） and flavonoids（54）. Based on the "formula-syndrome" correlation network analysis， energy metabolism was determined to be the dominant pharmacodynamic link of Renshen Wuweizi Tang in the treatment of spleen-lung Qi deficiency syndrome. The results of molecular docking showed that 7 components（adenosine， atractylenolide Ⅱ， atractylenolide Ⅲ， ginsenoside Rg₁， glycyrrhizin B₂， glycyrrhizin E₂ and campesterol） from 4 medicinal materials（Ginseng Radix et Rhizoma， Atractylodis Macrocephalae Rhizoma， Glycyrrhizae Radix et Rhizoma and Poria） in this formula might regulate energy metabolism by acting on 6 targets， namely cyclic adenosine monophosphate-response element binding protein 1（CREB1）， glyceraldehyde-3-phosphate dehydrogenase（GAPDH）， interleukin（IL）-6， nuclear transcription factor（NF）-κB1， peroxisome proliferator-activated receptor α（PPARα）， and tumor necrosis factor（TNF）， thus improving the symptoms of diseases related to spleen-lung Qi deficiency syndrome. ConclusionThis study established a UPLC-Q-TOF-MS/MS for rapid characterization and identification of chemical components in the decoction of Renshen Wuweizi Tang， expanding the understanding of the material composition of this formula， and found that 7 components might act on the key advantageous pharmacodynamic link "energy metabolism" through 6 targets to improve the related symptoms of spleen-lung Qi deficiency syndrome. This can provide a reference for the subsequent exploration of the material benchmark and mechanism of the famous classical formula.

Osteoporosis is a common senile bone metabolism disease， clinically characterized by decreased bone mass， destruction of bone microstructure， increased bone fragility， and easy fracture. It tends to occur in the elderly and postmenopausal women， seriously threatening the quality of life and physical and mental health of the elderly. At present， the treatment of osteoporosis is mainly based on oral western medicines， such as calcium， Vitamin D， and bisphosphonates. Still， there are drawbacks such as a long medication cycle and many adverse reactions. In recent years， due to the advantages of multi-component， multi-pathway， and multi-target， some traditional Chinese medicines and effective ingredients can regulate the osteogenic and osteoclastic differentiation process in both directions and are widely used in the prevention and treatment of osteoporosis. Hippophae rhamnoides is a commonly used herbal medicine， and its fruits are rich in flavonoids， polyphenols， fatty acids， vitamins， and trace elements， which have been proven to have a good anti-osteoporosis effect. Isorhamnetin is the main effective ingredient of Hippophae rhamnoides fruits， which has many pharmacological effects such as anti-inflammation， anti-oxidative stress， anti-aging， and anti-tumor. Studies have shown that isorhamnetin can participate in the regulation of bone metabolism and has a good anti-osteoporosis effect. However， the pharmacological effects and related mechanisms of isorhamnetin against osteoporosis have not been systematically summarized. Therefore， this paper reviewed the pharmacological effects and related mechanisms of isorhamnetin against osteoporosis by referring to relevant literature to provide more basis for the development and application of isorhamnetin.

Purpose: Erectile dysfunction (ED) is a common male sexual dysfunction. Gut microbiota plays an important role in various diseases. To investigate the effects and mechanisms of intestinal flora dysregulation induced by high-fat diet (HFD) on erectile function. Materials and Methods: Male Sprague–Dawley rats aged 8 weeks were randomly divided into the normal diet (ND) and HFD groups. After 24 weeks, a measurement of erectile function was performed. We performed 16S rRNA sequencing of stool samples. Then, we established fecal microbiota transplantation (FMT) rat models by transplanting fecal microbiota from rats of ND group and HFD group to two new groups of rats respectively. After 24 weeks, erectile function of the rats was evaluated and 16S rRNA sequencing was performed, and serum samples were collected for the untargeted metabolomics detection. Results: The erectile function of rats and the species diversity of intestinal microbiota in the HFD group was significantly lower, and the characteristics of the intestinal microbiota community structure were also significantly different between the two groups. The erectile function of rats in the HFD-FMT group was significantly lower than that of rats in the ND-FMT group. The characteristics of the intestinal microbiota community structure were significantly different. In the HFD-FMT group, 27 metabolites were significantly different and they were mainly involved in the several inflammation-related pathways. Conclusions Intestinal microbiota disorders induced by HFD can damage the intestinal barrier of rats, change the serum metabolic profile, induce low-grade inflammation and apoptosis in the corpus cavernosum of the penis, and lead to ED.

Purpose: The aim of this study was to investigate the feasibility of an intelligent handheld ultrasound (US) device for assisting non-expert general practitioners (GPs) in detecting carotid plaques (CPs) in community populations. Methods: This prospective parallel controlled trial recruited 111 consecutive community residents. All of them underwent examinations by non-expert GPs and specialist doctors using handheld US devices (setting A, setting B, and setting C). The results of setting C with specialist doctors were considered the gold standard. Carotid intima-media thickness (CIMT) and the features of CPs were measured and recorded. The diagnostic performance of GPs in distinguishing CPs was evaluated using a receiver operating characteristic curve. Inter-observer agreement was compared using the intragroup correlation coefficient (ICC). Questionnaires were completed to evaluate clinical benefits. Results: Among the 111 community residents, 80, 96, and 112 CPs were detected in settings A, B, and C, respectively. Setting B exhibited better diagnostic performance than setting A for detecting CPs (area under the curve, 0.856 vs. 0.749; P<0.01). Setting B had better consistency with setting C than setting A in CIMT measurement and the assessment of CPs (ICC, 0.731 to 0.923). Moreover, measurements in setting B required less time than the other two settings (44.59 seconds vs. 108.87 seconds vs. 126.13 seconds, both P<0.01). Conclusion Using an intelligent handheld US device, GPs can perform CP screening and achieve a diagnostic capability comparable to that of specialist doctors.

With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.

Neoadjuvant therapy has become the standard treatment for locally advanced resectable esophageal cancer, significantly improving long-term survival compared to surgery alone. Neoadjuvant therapy has evolved to include various strategies, such as concurrent chemoradiotherapy, chemotherapy, immunotherapy, or targeted combination therapy. This enriches clinical treatment options and provides a more personalized and scientific treatment approach for patients. This article aims to comprehensively summarize current academic research hot topics, review the rationale and evaluation measures of neoadjuvant therapy, discuss challenges in restaging methods after neoadjuvant therapy, and identify the advantages and disadvantages of various neoadjuvant therapeutic strategies.

ObjectiveTo explore the effects of different dosage forms of Kaixinsan （KXS） on the morphology and function of mitochondria in rat models of Alzheimer's disease （AD） and potential mechanisms of action. MethodsMale SD rats were randomly assigned to a sham group， model group， treatment groups receiving KXS decoction， powders， and granules （3.08 g·kg^-1）， as well as donepezil group （0.51×10^-3 g·kg^-1）， with 10 rats in each group. AD model was created using intracerebroventricular injection of streptozocin （STZ）. After 30 days of administration， behavioral assessments were conducted， and mitochondrial morphology was observed using transmission electron microscopy. Mitochondrial respiratory chain complex content was measured via enzyme-linked immunosorbent assay （ELISA）. Changes in mitochondrial membrane potential were measured via JC-1 staining， and superoxide dismutase （SOD） activity and reactive oxygen species （ROS） levels were measured via biochemical assays. The mRNA expression of adenosine 5'-monophosphate-activated protein kinase （AMPK）， peroxisome proliferator-activated receptor gamma coactivator-1α （PGC-1α）， and silent information regulator 3 （SIRT3） was detected by real-time fluorescent quantitative polymerase chain reaction （Real-time PCR）， and Western blot was used to examine the protein expression levels of optic atrophy protein1 （OPA1）， mitochondrial fission protein 1 （FIS1）， AMPK， p-AMPK， PGC-1α， and SIRT3. ResultsCompared with the sham group， rats in the model group had significantly lower recognition index， spontaneous alternation rate， escape latency， number of platform crossings， time spent in the target quadrant， and percentage of distance traveled in the target quadrant distance （P<0.05， P<0.01）. Significant mitochondrial damage was observed in the hippocampal tissue， with a marked decrease in mitochondrial respiratory chain complex content （P<0.01） and reduced mitochondrial membrane potential （P<0.05）. Additionally， the SOD activity was reduced， while ROS levels were elevated （P<0.01）. The mRNA expression of PGC-1α and SIRT3 was significantly downregulated （P<0.01）， along with decreased protein expression levels of OPA1， p-AMPK/AMPK， PGC-1α， and SIRT3， whereas FIS1 protein expression was significantly upregulated （P<0.05， P<0.01）. Compared with the model group， rats in KXS-treated groups （various dosage forms） showed significant improvement in behavioral indexes （P<0.05， P<0.01）， reduced hippocampal mitochondrial damage， and more organized mitochondrial cristae. Mitochondrial respiratory chain complex content was significantly increased （P<0.05， P<0.01）， and mitochondrial membrane potentials were elevated （P<0.05）. SOD activity was elevated， and ROS levels were significantly reduced （P<0.05， P<0.01）. Furthermore， the mRNA expression of PGC-1α and SIRT3 was upregulated， with increased protein levels of OPA1， p-AMPK/AMPK， PGC-1α， and SIRT3， while FIS1 protein expression levels were significantly reduced （P<0.05， P<0.01）. Across the KXS-treated groups， the granule group showed a higher spontaneous alternation rate than the decoction and powder groups （P<0.05）. ConclusionKXS decoction， powders， and granules can improve the learning and memory ability of rats， with granules being the most effective. The mechanism of action may involve activation of the AMPK/PGC-1α/SIRT3 signaling pathway， improvement of the mitochondrial function， and subsequent amelioration of the brain energy metabolism disorders.