Diabetes mellitus（DM） is a globally prevalent chronic metabolic disease， and its hyperglycemia can lead to a series of serious complications. Although current DM treatments are effective， they still have side effects and limitations. Therefore， discovering new drugs has become a key approach to improving DM management. As a traditional Chinese medicine， Dendrobii Caulis has garnered significant attention due to its rich phytochemical properties， which may offer a natural approach to mitigate the harmful effects of DM. Studies have demonstrated that Dendrobii Caulis can significantly reduce blood glucose levels in diabetic animal models and improve insulin resistance. Modern pharmacological studies have shown that the hypoglycemic effect of Dendrobii Caulis is primarily based on multiple mechanisms， including improving insulin sensitivity， inhibiting liver glycogen breakdown， promoting liver glycogen synthesis， and reducing oxidative stress. In addition， polysaccharides in Dendrobii Caulis have been found to increase the serum level of glucagon-like peptide-1 （GLP-1）， which promotes insulin secretion and inhibits glucagon release， thereby improving the symptoms of DM and its complications. Given its potential hypoglycemic effect， Dendrobii Caulis is expected to be developed as a new hypoglycemic agent or health food with promising prospects for treating DM and its complications. With further basic and clinical research， Dendrobii Caulis is expected to become an important adjunct in DM treatment.

Corneal endothelial cells(CECs), which form the innermost cellular layer of the cornea, play a pivotal role in sustaining corneal transparency and preserving visual acuity. However, CECs are vulnerable to damage induced by a spectrum of pathological conditions or traumatic injuries. Once the density of CECs declines below a critical threshold, corneal endothelial dysfunction is precipitated, ultimately leading to corneal edema and progressive visual impairment. Penetrating keratoplasty and corneal endothelial transplantation remain the first-line therapeutic strategies for managing advanced corneal endothelial dysfunction. Nevertheless, the global shortage of donor corneas severely limits the accessibility and scalability of these surgical interventions. Consequently, regenerative medicine approaches targeting corneal endothelial repair and regeneration have emerged as a major focus of international research in ophthalmology. A key challenge in the in vitro expansion of CECs is their propensity to undergo endothelial-to-mesenchymal transition(EndMT). EndMT is a process of cellular phenotypic transformation, through which endothelial cells lose their intrinsic functions and acquire the characteristic features of mesenchymal cells. The EndMT significantly impedes the clinical translation of in vitro-cultured CECs for regenerative applications. In this review, the risk factors and related signaling pathways involved in EndMT were summarized, aiming to provide references for the basic research and clinical treatment of relevant diseases.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

OBJECTIVE To investigate the application status of prescription pre-review systems in healthcare institutions of Yunnan province， evaluate their system functions and management capabilities， and provide a practical basis for promoting rational drug use. METHODS A questionnaire survey was conducted among public healthcare institutions at or above the secondary level in Yunnan province to investigate the deployment status of the systems. A capability maturity assessment framework was constructed， encompassing 6 dimensions and 39 indicators， including real-time prescription review， prescription correlation review， rule setting， evidence-based information support， prescription authority management， and system operation management. This framework was then used to evaluate the institutions that had implemented the pre-review systems. RESULTS A total of 100 valid questionnaires were collected， with 37 institutions having adopted prescription pre-review systems， mainly tertiary hospitals. The system predominantly adopted a modular architecture and was embedded into the hospital information system through application programming interfaces and middleware， providing certain capabilities for real-time prescription risk identification. Evaluation results indicated that basic functions such as reviewing indications， contraindications， and drug compatibility performed well， while deficiencies remained in functions related to parenteral nutrition prescription， review of drug dosage for specific diseases， individual patient characteristic recognition， and rule setting. Moreover， the construction of review centers and establishment of management systems were also not well-developed. CONCLUSIONS The overall application rate of prescription pre-review systems in Yunnan province remains low. System functions and management mechanisms require further improvement. It is recommended to enhance information infrastructure in lower-level institutions and explore regionally unified review models to promote standardized and intelligent development of prescription review practices.

Objective: To explore the association between takeout fast foods and sugar sweetened beverage consumption with co-occurrence of anxiety and depressive symptoms among first year junior high school students in Yunnan Province, so as to provide theoretical basis for the prevention of anxiety and depressive symptoms co-occurrence among adolescents. Methods: A random cluster sampling involving 8 500 first year junior high school students in 11 counties in Yunnan Province was conducted by a questionnaire survey from October to December 2022. The Depression Anxiety Stress Scale-21 (DASS-21) was applied to assess anxiety and depressive symptoms in first year junior high school students. Chi-square test was used to compare the anxiety-depression co-occurrence symptoms of first year junior high school students with different demographic characteristics. The association between takeout fast foods and sugar sweetened beverage consumption with co-occurrence of anxiety and depressive symptoms of adolescents was analyzed by binary Logistic regression models. Results: The detection rate of co-occurrence of anxiety and depression symptoms among first year junior high school students in Yunnan Province was 26.92%. After controlling for demographic variables and other confounders, takeout fast foods and sugar sweetened beverage consumption( OR=1.50, 95%CI =1.27-1.77) was associated with anxiety-depression co-occurrence symptoms among first year junior high school students in Yunnan Province ( P <0.01). Stratified analysis showed that both Han ( OR=1.37, 95%CI =1.07-1.77) and ethnic minorities ( OR=1.60, 95%CI =1.29-2.00) exhibited statistically significant associations between takeout fast foods and sugar sweetened beverage consumption with co-occurrence of anxiety and depressive symptoms(both P <0.05). Conclusions Takeout fast foods and sugar sweetened beverage consumption increases the risk of co-occurrence of anxiety and depressive symptoms among first year junior high school students in Yunnan Province. It is recommended to strengthen guidance on the consumption of such products among junior high school students to prevent co-occurrence of anxiety and depressive symptoms.

ObjectiveTo investigate the influencing factors for recompensation in patients with decompensated liver cirrhosis， as well as the impact of recompensation on the prognosis of such patients， and to provide a basis for early identification of high-risk patients in clinical practice. MethodsA retrospective analysis was performed for the clinical data of patients who attended The Third People’s Hospital of Kunming from January 2016 to December 2022 and were diagnosed with decompensated liver cirrhosis due to hepatitis B， hepatitis C， alcoholic hepatitis， and autoimmune hepatitis， and they were divided into recompensation group and persistent decompensation group. To control for confounding factors， whether recompensation occurred was used as the rouping variable，and BMI， alcohol consumption history， HIV infection history， TG， CHOL， LDL， and HDL were used as covariates. The propensity score was calculated， and 1：1 nearest neighbor matching was performed with a caliper value of 0.1. After propensity score matching， the recompensation group and the persistent decompensation group with relatively balanced covariates were obtained. Univariate and multivariate Cox proportional-hazards regression model analyses were used to investigate the influencing factors for recompensation； the “rms” package was used to establish a nomogram； the receiver operating characteristic （ROC） curve was plotted to calculate the area under the ROC curve （AUC）； the Hosmer-Lemeshow test was used to assess the goodness of fit of the model； the “Calibration Curves” package was used to plot calibration curves for model assessment. The Kaplan-Meier method was used to plot survival curves， and the Log-rank test was used for comparison of survival curves. ResultsAmong the 863 patients with decompensated liver cirrhosis， 305 experienced recompensation， resulting in an incidence rate of 35.3%. After PSM， 610 cases were successfully matched， with 305 cases in each group. The univariate and multivariate Cox regression analyses showed that etiology （hepatitis C： hazard ratio［HR］=0.288， P=0.002）； male（HR=0.701， P=0.016）， age（HR=0.988， P=0.047）， hemoglobin （HGB）（HR=1.006， P=0.017）， and CD4 T cell（HR=1.001，P=0.047）， TIPS procedure （HR=1.808，P=0.042） were independent influencing factors for recompensation in patients with decompensated liver cirrhosis. During follow-up， 116 patients died of liver disease-related causes， with 27 patients （8.85%） in the recompensation group and 89 （15.95%） in the persistent decompensation group； 109 patients developed HCC， with 23 patients （7.54%） in the recompensation group and 86 （15.41%） in the persistent decompensation group. The Kaplan-Meier survival curves showed significant separation between the patients with different states of compensation in terms of liver disease-related mortality rate and the incidence rate of HCC， and the Log-rank test showed that there were significant differences between the two groups in liver disease-related mortality rate （χ²=9.023， P=0.003） and the incidence rate of HCC （χ²=10.526， P=0.001）. ConclusionEtiology，sex，age，TIPS，HGB，and CD4 T cell are independent influencing factors for recompensation in patients with decompensated liver cirrhosis. There is a significant difference in the incidence rate of recompensation between decompensated liver cirrhosis patients with different etiologies， and female patients and patients with a younger age，a history of TIPS， a higher HGB level， and a higher CD4 lymphocyte count are more likely to experience recompensation. Recompensation is the key to improving the long-term prognosis of patients and can significantly reduce long-term liver disease-related mortality rate and the incidence rate of HCC.

The thyroid gland is the largest endocrine organ in the human body， and its dysfunction can cause varying degrees of liver injury， leading to liver failure in severe cases. Patients with hyperthyroidism have a relatively high incidence rate of liver dysfunction， manifesting as hepatocellular injury or cholestatic liver injury， while hypothyroidism is closely associated with metabolic dysfunction-associated fatty liver disease. Autoimmune thyroid diseases， including Hashimoto’s thyroiditis and subacute thyroiditis， are commonly comorbid with autoimmune liver disease. In addition， medications such as antithyroid drugs， amiodarone， and immune checkpoint inhibitors can cause severe liver injury through direct toxicity or immune-mediated mechanisms. Although significant progress has been achieved in related diagnosis and treatment techniques in recent years， there are still many challenges in pathogenesis， individualized treatment strategies， early warning， and prognostic evaluation. This article systematically reviews the research advances in liver injury associated with thyroid dysfunction and proposes the directions for future research， in order to provide guidance for clinical diagnosis and treatment.

ObjectiveThis study aims to systematically review the marketed traditional Chinese patent medicines for treating chronic gastritis （CG） in China. By analyzing their variety characteristics and prescription patterns， it seeks to provide references for clinical syndrome differentiation-based drug selection， treatment method optimization， and the design of high-quality clinical research. MethodsInformation on marketed traditional Chinese patent medicines for treating CG was collected. Microsoft Excel software was used to collate and statistically analyze representative drugs for each pathological stage， market status， syndrome types， and other contents. The Ancient and Modern Medical Case Cloud Platform （V2.3.9） was employed to analyze the formula composition patterns of standardized prescriptions. ResultsA total of 141 marketed traditional Chinese patent medicines for treating CG in China were included. Based on the disease's pathological progression， they can be classified into drugs for non-atrophic gastritis， atrophic gastritis， and precancerous lesions. Post-marketing research reveals that relevant evaluation is only conducted on 17 drugs， of which 2 involve pharmacoeconomic studies and 14 possess standardized evidence-based evidence. The primary dosage forms were capsules， granules， and tablets. From the 100 prescriptions screened according to inclusion/exclusion criteria， the varieties indicated for the stomach collateral stasis syndrome in atrophic gastritis accounted for the highest proportion. The main efficacy distributions were clearing heat， detoxifying， and relieving pain by promoting Qi circulation. Core drugs included Glycyrrhizae Radix et Rhizome， Paeoniae Radix Alba， and Aucklandiae Radix. Medicinal properties were predominantly warm and neutral. Flavors were mainly bitter， pungent， and sweet. The drugs primarily entered the spleen and stomach meridians. Analysis of the package inserts reveals that 67 products list "contraindications"， 110 include "precautions"， and 23 explicitly state "adverse reactions". ConclusionTraditional Chinese patent medicines for treating CG hold unique value in clinical practice. However， currently there are challenges such as insufficient clarity in syndrome type descriptions within package inserts and a relative lack of high-level evidence-based medical evidence， as well as pharmacoeconomic evaluations. Future efforts should focus on addressing these shortcomings by advancing research on syndrome characteristics and medication patterns based on syndrome differentiation， systematically conducting pharmacoeconomic evaluations， strengthening the accumulation of high-level evidence-based evidence， and， on this basis， improving patient medication adherence. This will comprehensively enhance the clinical application value and scientific connotation of this category of drugs.

Objective To analyze survival outcomes and influencing factors among patients with colorectal cancer in Yunnan Province. Methods Clinical data were retrospectively collected from 4 892 patients with colorectal cancer. Survival data were obtained through follow-up. Overall survival (OS) was calculated by using the Kaplan-Meier method. Univariate analysis was performed by applying the log-rank test. Meanwhile, multivariate analysis employed the Cox proportional hazards regression model. Results The 1-, 3-, 5-, and 10-year OS rates for the entire cohort were 91.90%, 74.40%, 64.40%, and 28.70%, respectively. Univariate analysis revealed that age, ethnicity, region, differentiation grade, TNM stage, clinical stage, metastatic status, histological type, and treatment modality (chemotherapy, radiotherapy, and surgery) were associated with patient prognosis (all P<0.05). Multivariate analysis identified age (HR=1.250), region (HR=1.262), differentiation grade (HR=0.761), clinical stage (HR=3.128), and treatment modality (chemotherapy, HR=0.644; radiotherapy, HR=1.605; surgery, HR=0.384) as independent factors affecting survival prognosis in patients with colorectal cancer (all P<0.001). Conclusion Age, region, clinical stage, and treatment modality are independent factors influencing survival among patients with colorectal cancer in Yunnan Province. In clinical practice, these factors should be integrated to develop individualized prevention and treatment strategies, thereby improving patient outcomes.

Objective Objective To analyze the potential spatial factors affecting the genetic differentiation of Oncomelania hupensis robertsoni in Yunnan Province. Methods A total of 13 administrative villages were selected from schistosomiasis-endemic areas of Yunnan Province as O. hupensis snail sampling sites. At least 200 snails were collected in each site, and the spatial variable data of each site were recorded, including longitude, latitude and altitude. Thirty active and Schistosoma japonicum uninfected O. hupensis snails were selected from each sampling site by means of the crawling method and the cercarial shedding method. Genomic DNA was extracted from O. hupensis snails. Following PCR amplification, purification of PCR amplification products and sequencing, the gene sequences of O. hupensis snail samples were spliced and edited using the DNAstar software and the NCBI database to yield the complete mitochondrial sequences of O. hupensis snails at each sampling site, and the mitochondrial genetic distance matrix of O. hupensis robertsoni was calculated at each sampling site. The geographical coordinates of each sampling site were marked using the software ArcGIS 10.2, and the straight-line geographical distance between each sampling site was calculated. The altitude difference, longitude difference and latitude difference between each sampling site were calculated using the Excel software, and the correlation between the mitochondrial genetic distance matrix of O. hupensis robertsoni and each spatial variable matrix was examined by using the Mantel test at 13 sampling sites in Yunnan Province. Results Among the 13 O. hupensis snail sampling sites in Yunnan Province, the largest mitochondrial genetic distance of O. hupensis robertsoni snail populations was seen between Anding Village, Nanjian Yi Autonomous County and Caizhuang Village, Midu County (26.244 2), and the largest geographical distance was seen between Dongyuan Village, Gucheng District and Cangling Village, Chuxiong County (272.64 km). The highest altitude difference was seen between Anding Village, Nanjian Yi Autonomous County and Dongyuan Village, Gucheng District (1 086.10 m), and the largest longitude difference was found between Qiandian Village, Eryuan County and Cangling Village, Chuxiong County (1.86°), while the largest latitude difference was measured between Leqiu Village, Nanjian Yi Autonomous County and Dongyuan Village, Gucheng District (1.81°). In addition, the mitochondrial genetic distance of O. hupensis robertsoni snail populations was positively correlated with altitude at 13 snail sampling sites in Yunnan Province (r = 0.542 8, P < 0.001), and showed no significant correlations with geographical distance (r = 0.093 4, P > 0.05), longitude (r = −0.199 5, P > 0.05) or latitude (r = 0.205 7, P > 0.05). Conclusion Altitude may be a potential spatial factor affecting the genetic differentiation of O. hupensis robertsoni in Yunnan Province.