Diabetes mellitus（DM） is a globally prevalent chronic metabolic disease， and its hyperglycemia can lead to a series of serious complications. Although current DM treatments are effective， they still have side effects and limitations. Therefore， discovering new drugs has become a key approach to improving DM management. As a traditional Chinese medicine， Dendrobii Caulis has garnered significant attention due to its rich phytochemical properties， which may offer a natural approach to mitigate the harmful effects of DM. Studies have demonstrated that Dendrobii Caulis can significantly reduce blood glucose levels in diabetic animal models and improve insulin resistance. Modern pharmacological studies have shown that the hypoglycemic effect of Dendrobii Caulis is primarily based on multiple mechanisms， including improving insulin sensitivity， inhibiting liver glycogen breakdown， promoting liver glycogen synthesis， and reducing oxidative stress. In addition， polysaccharides in Dendrobii Caulis have been found to increase the serum level of glucagon-like peptide-1 （GLP-1）， which promotes insulin secretion and inhibits glucagon release， thereby improving the symptoms of DM and its complications. Given its potential hypoglycemic effect， Dendrobii Caulis is expected to be developed as a new hypoglycemic agent or health food with promising prospects for treating DM and its complications. With further basic and clinical research， Dendrobii Caulis is expected to become an important adjunct in DM treatment.

Corneal endothelial cells(CECs), which form the innermost cellular layer of the cornea, play a pivotal role in sustaining corneal transparency and preserving visual acuity. However, CECs are vulnerable to damage induced by a spectrum of pathological conditions or traumatic injuries. Once the density of CECs declines below a critical threshold, corneal endothelial dysfunction is precipitated, ultimately leading to corneal edema and progressive visual impairment. Penetrating keratoplasty and corneal endothelial transplantation remain the first-line therapeutic strategies for managing advanced corneal endothelial dysfunction. Nevertheless, the global shortage of donor corneas severely limits the accessibility and scalability of these surgical interventions. Consequently, regenerative medicine approaches targeting corneal endothelial repair and regeneration have emerged as a major focus of international research in ophthalmology. A key challenge in the in vitro expansion of CECs is their propensity to undergo endothelial-to-mesenchymal transition(EndMT). EndMT is a process of cellular phenotypic transformation, through which endothelial cells lose their intrinsic functions and acquire the characteristic features of mesenchymal cells. The EndMT significantly impedes the clinical translation of in vitro-cultured CECs for regenerative applications. In this review, the risk factors and related signaling pathways involved in EndMT were summarized, aiming to provide references for the basic research and clinical treatment of relevant diseases.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

OBJECTIVE To investigate the application status of prescription pre-review systems in healthcare institutions of Yunnan province， evaluate their system functions and management capabilities， and provide a practical basis for promoting rational drug use. METHODS A questionnaire survey was conducted among public healthcare institutions at or above the secondary level in Yunnan province to investigate the deployment status of the systems. A capability maturity assessment framework was constructed， encompassing 6 dimensions and 39 indicators， including real-time prescription review， prescription correlation review， rule setting， evidence-based information support， prescription authority management， and system operation management. This framework was then used to evaluate the institutions that had implemented the pre-review systems. RESULTS A total of 100 valid questionnaires were collected， with 37 institutions having adopted prescription pre-review systems， mainly tertiary hospitals. The system predominantly adopted a modular architecture and was embedded into the hospital information system through application programming interfaces and middleware， providing certain capabilities for real-time prescription risk identification. Evaluation results indicated that basic functions such as reviewing indications， contraindications， and drug compatibility performed well， while deficiencies remained in functions related to parenteral nutrition prescription， review of drug dosage for specific diseases， individual patient characteristic recognition， and rule setting. Moreover， the construction of review centers and establishment of management systems were also not well-developed. CONCLUSIONS The overall application rate of prescription pre-review systems in Yunnan province remains low. System functions and management mechanisms require further improvement. It is recommended to enhance information infrastructure in lower-level institutions and explore regionally unified review models to promote standardized and intelligent development of prescription review practices.

Objective: To explore the association between takeout fast foods and sugar sweetened beverage consumption with co-occurrence of anxiety and depressive symptoms among first year junior high school students in Yunnan Province, so as to provide theoretical basis for the prevention of anxiety and depressive symptoms co-occurrence among adolescents. Methods: A random cluster sampling involving 8 500 first year junior high school students in 11 counties in Yunnan Province was conducted by a questionnaire survey from October to December 2022. The Depression Anxiety Stress Scale-21 (DASS-21) was applied to assess anxiety and depressive symptoms in first year junior high school students. Chi-square test was used to compare the anxiety-depression co-occurrence symptoms of first year junior high school students with different demographic characteristics. The association between takeout fast foods and sugar sweetened beverage consumption with co-occurrence of anxiety and depressive symptoms of adolescents was analyzed by binary Logistic regression models. Results: The detection rate of co-occurrence of anxiety and depression symptoms among first year junior high school students in Yunnan Province was 26.92%. After controlling for demographic variables and other confounders, takeout fast foods and sugar sweetened beverage consumption( OR=1.50, 95%CI =1.27-1.77) was associated with anxiety-depression co-occurrence symptoms among first year junior high school students in Yunnan Province ( P <0.01). Stratified analysis showed that both Han ( OR=1.37, 95%CI =1.07-1.77) and ethnic minorities ( OR=1.60, 95%CI =1.29-2.00) exhibited statistically significant associations between takeout fast foods and sugar sweetened beverage consumption with co-occurrence of anxiety and depressive symptoms(both P <0.05). Conclusions Takeout fast foods and sugar sweetened beverage consumption increases the risk of co-occurrence of anxiety and depressive symptoms among first year junior high school students in Yunnan Province. It is recommended to strengthen guidance on the consumption of such products among junior high school students to prevent co-occurrence of anxiety and depressive symptoms.

Objective : To investigate the antidepressant effects and the underlying mechanisms of tetrahydrocurcumin(THC) and its nanoparticle formulation(THCN). Methods : Forty-six male ICR mice were randomly divided into Con group, LPS group, THC group, THCN group and SER group. A mouse depression model was established by intraperitoneal administration of LPS. The anxiety and depression-like behaviors of mice were evaluated by open field test(OFT) and forced swimming test(FST). Myelin staining was applied to assess the extent of demyelination in the prefrontal cortex of the mice. The prefrontal cortex and hippocampus were further examined for the expression levels of glial fibrillary acidic protein(GFAP) and Toll-like receptor 4(TLR4) through quantitative immunofluorescence assays. Results : Compared with the Con group, the LPS group showed increased anxiety-like and depressive-like behaviors in both the long-term and short-term experiments(P<0.05); the degree of demyelination increased in the LPS group of the long-term experiment(P<0.01); the expression of GFAP was reduced in the LPS group of the short-term experiment(P<0.01), while the expression of TLR4 increased(P<0.05); the expression of TLR4 decreased in the THC group(P<0.01); the expression of GFAP in the prefrontal cortex of the THCN group was reduced(P<0.01), while the expression of TLR4 increased(P<0.05). Compared with the LPS group, the THC group showed reduced depressive-like behaviors in the long-term experiment(P<0.05), while the anxiety-like and depressive-like behaviors of the THCN group and the SER group were reduced(P<0.05), and the anxiety-like and depressive-like behaviors of the THC group and the THCN group were reduced in the short-term experiment(P<0.05); the degree of demyelination was reduced in the THC group, THCN group and SER group in the long-term experiment(P<0.05); the expression of GFAP increased in the THC group of the short-term experiment(P<0.05), while the expression of TLR4 was reduced(P<0.05), and the expression of GFAP increased in the THCN group(P<0.05). Compared with the THC group, the THCN group and the SER group showed reduced anxiety-like behaviors in the long-term experiment(P<0.05); the expression of GFAP in the prefrontal cortex of the THCN group was reduced in the short-term experiment(P<0.05), while the expression of TLR4 in the hippocampal DG area increased in the short-term experiment(P<0.01). Conclusion Tetrahydrocurcumin and its nanoparticle formulation both exert significant ameliorative effects on depression-like behaviors and demyelination in mice induced by lipopolysaccharide. The antidepressant mechanism of THC appears to be mediated through the down-regulation of TLR4 and the up-regulation of GFAP. The mechanism underlying the antidepressant action of THCN seems predominantly focused on the enhancement of GFAP expression.

ObjectiveTo investigate the influencing factors for recompensation in patients with decompensated hepatitis C cirrhosis， and to establish a predictive model. MethodsA total of 217 patients who were diagnosed with decompensated hepatitis C cirrhosis and were admitted to The Third People’s Hospital of Kunming l from January， 2019 to December， 2022 were enrolled， among whom 63 patients who were readmitted within at least 1 year and had no portal hypertension-related complications were enrolled as recompensation group， and 154 patients without recompensation were enrolled as control group. Related clinical data were collected， and univariate and multivariate analyses were performed for the factors that may affect the occurrence of recompensation. The independent-samples t test was used for comparison of normally distributed measurement data between two groups， and the Mann-Whitney U test was used for comparison of non-normally distributed measurement data between two groups； the chi-square test or the Fisher’s exact test was used for comparison of categorical data between two groups. A binary Logistic regression analysis was used to investigate the influencing factors for recompensation in patients with decompensated hepatitis C cirrhosis， and the receiver operating characteristic （ROC） curve was used to assess the predictive performance of the model. ResultsAmong the 217 patients with decompensated hepatitis C cirrhosis， 63 （29.03%） had recompensation. There were significant differences between the recompensation group and the control group in HIV history （χ²=4.566， P=0.034）， history of partial splenic embolism （χ²=6.687， P=0.014）， Child-Pugh classification （χ²=11.978， P=0.003）， grade of ascites （χ²=14.229， P<0.001）， albumin （t=4.063， P<0.001）， prealbumin （Z=-3.077， P=0.002）， high-density lipoprotein （t=2.854， P=0.011）， high-sensitivity C-reactive protein （Z=-2.447， P=0.014）， prothrombin time （Z=-2.441， P=0.015）， carcinoembryonic antigen （Z=-2.113， P=0.035）， alpha-fetoprotein （AFP） （Z=-2.063， P=0.039）， CA125 （Z=-2.270， P=0.023）， TT3 （Z=-3.304， P<0.001）， TT4 （Z=-2.221， P=0.026）， CD45⁺ （Z=-2.278， P=0.023）， interleukin-5 （Z=-2.845， P=0.004）， tumor necrosis factor-α （Z=-2.176， P=0.030）， and portal vein width （Z=-5.283， P=0.005）. The multivariate analysis showed that history of partial splenic embolism （odds ratio ［OR］=3.064， P=0.049）， HIV history （OR=0.195， P=0.027）， a small amount of ascites （OR=3.390， P=0.017）， AFP （OR=1.003， P=0.004）， and portal vein width （OR=0.600， P<0.001） were independent influencing factors for the occurrence of recompensation in patients with decompensated hepatitis C cirrhosis. The ROC curve analysis showed that HIV history， grade of ascites， history of partial splenic embolism， AFP， portal vein width， and the combined predictive model of these indices had an area under the ROC curve of 0.556， 0.641， 0.560， 0.589， 0.745， and 0.817， respectively. ConclusionFor patients with decompensated hepatitis C cirrhosis， those with a history of partial splenic embolism， a small amount of ascites， and an increase in AFP level are more likely to experience recompensation， while those with a history of HIV and an increase in portal vein width are less likely to experience recompensation.

Hepatitis B virus （HBV） infection can cause acute or chronic infection， while untreated patients can develop into liver cirrhosis or liver cancer， thereby leading to death. As one of the most important organelles of cells， the maintenance of the normal morphology and function of mitochondria is the basis for ensuring various physiological activities in cells， and physiological activities， such as mitochondrial dynamics， mitophagy， injury， and oxidative phosphorylation， can affect the maintenance of mitochondrial homeostasis. HBV infection can affect mitochondrial homeostasis. This article summarizes the research advances in mitochondrial homeostasis and HBV infection from the four aspects of mitochondrial dynamics， mitophagy， mitochondrial oxidative phosphorylation， and mitochondrial injury and discusses the association between the maintenance of mitochondrial homeostasis and HBV infection， in order to provide a theoretical basis for understanding the molecular mechanism of HBV infection and identifying the potential therapeutic targets for HBV.

Objective: To understand the prevalence of myopia among primary and secondary school students in minority areas of Yunnan Province, and to explore the influence of outdoor activities and short-distance use of eyes, so as to provide a basis for early myopia intervention. Methods: In October 2020, the survey was conducted among 1 782 primary and secondary school students in three cities of Yunnan through a multi stage random cluster sampling method. All subjects underwent a questionnaire survey and the visual acuity examination at baseline. The first follow-up was conducted in October 2021 to obtain 1 691 valid samples, and the second follow-up was conducted in May 2023 to obtain 1 367 valid samples. Factors associated with myopia among primary and secondary school students were explored by using generalized estimating equations. Results: The prevalence rates of myopia in 2020, 2021 and 2023 were 52.64%, 61.62% and 69.35%, respectively, showing an increasing trend ( χ 2 trend =91.77, P <0.05). The results of multivariate regression analysis on the generalized estimation equations showed that age at baseline ( OR =1.31), girls ( OR =1.76), Hani ethnicity ( OR =0.75), Bai ethnicity ( OR =0.69), parental myopia ( OR =1.97-2.29), parents often reducing children s exercise time for homework or tutoring ( OR =1.35), less than 1 time or 2-3 times of ball sports per week ( OR =1.27, 1.20 ), reading and writing in the classroom during the break ( OR =1.27), reading in direct sunlight occasionally ( OR =1.20), using only desk lamp for writing at home ( OR =0.71), more than 1 hours of short-distance eye use for a break once ( OR =1.23) were associated with myopia among primary and secondary school students ( P <0.05). Conclusions Outdoor activities and short-distance use of eye among primary and middle school students in minority areas in Yunnan province are suboptimal. Enhancing the related environmental and behavioral factors can effectively mitigate the occurrence and progression of myopia.

As a patented characteristic medicine of Yi ethnic minority， Pingxuan capsules have the effects of nourishing the liver and kidney， pacifying the liver， and subduing Yang. With the main indications of dizziness， headache， palpitations， tinnitus， insomnia， dreaminess， waist and knee soreness caused by liver-kidney deficiency and liver Yang upward disturbance， Pingxuan capsules are widely used in the treatment of posterior circulation ischemic vertigo， vestibular migraine， benign paroxysmal positional vertigo. However， the current knowledge is limited regarding the efficacy， syndrome differentiation， and safety of this medicine. On the basis of summarizing the experience of clinicians and the existing evidence， this study invites clinical experts of traditional Chinese and Western medicine， pharmaceutical experts， and methodological experts from relevant fields across China to conduct evidence-based evaluation of Pingxuan capsules. The evaluation follows the Specifications for the Development of Clinical Expert Consensus on Chinese Patent Medicines issued by the Standardization Office of the China Association of Chinese Medicine， and reaches 5 recommendations and 16 consensus suggestions. The consensus clarifies the clinical applications， efficacy， dose， course of treatment， combination of medicines， precautions， and contraindications of Pingxuan capsules in the treatment of vertigo and explains the safety of clinical application. This consensus is applicable to clinicians （traditional Chinese medicine， Western medicine， and integrated traditional Chinese and Western medicine） and pharmacists in tertiary hospitals， secondary hospitals， and community-level medical and health institutions across China， providing a reference for the rational use of Pingxuan capsules in the treatment of vertigo. It is hoped that the promotion of this consensus can facilitate the rational use of drugs in clinical practice， reduce the risk of drug use， and give full play to the advantages of Pingxuan capsules in the treatment of vertigo diseases. This consensus has been reviewed and published by the China Association of Chinese Medicine， with the number GS/CACM330-2023.