1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Gualou Xiebai Banxiatang in Treatment of Cardiovascular Diseases: A Review
Yalong KANG ; Bo NING ; Juanjuan TAN ; Hongfei QI ; Yan SHI ; Fang GUAN ; Haifang WANG
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(2):256-267
Cardiovascular diseases (CVD),a group of common diseases in clinical practice,are witnessing a steady rise in both incidence and mortality rates,posing a challenge to public health. Gualou Xiebai Banxiatang,originating from Synopsis of the Golden Chamber (《金匮要略》),was initially used to treat severe cases of chest impediment. The formula consists of Trichosanthis Fructus,Allii Macrostemonis Bulbus,Pinelliae Rhizoma,and Baijiu. It has a wide range of clinical applications,with therapeutic effects including moving Qi to relieve depression,activating Yang to dissipate mass,and expelling phlegm to alleviate chest congestion. In recent years,clinical research has confirmed that Gualou Xiebai Banxiatang,with or without modification,used alone or in combination with Western medicine,has definite effects in the treatment of CVD such as hyperlipidemia,coronary atherosclerotic heart disease,hypertension,heart failure,and arrhythmia. It can alleviate disease symptoms and reduce the risk of re-hospitalization. Basic research indicates that the mechanisms of Gualou Xiebai Banxiatang include improving endothelial functions,exhibiting anti-inflammatory properties,countering oxidative stress,preventing apoptosis,inhibiting ventricular remodeling,regulating mitochondrial functions,improving hemorheology,and modulating autophagy and neurotransmitters. This article reviews relevant articles in recent years with focuses on the compatibility,clinical application,and mechanism of Gualou Xiebai Banxiatang. This review is expected to provide a theoretical basis for the mechanism research and clinical application of this formula in treating CVD and to offer ideas and reference for in-depth research.
3.Naoqingtong Decoction Ameliorates Kidney Damage in Spontaneously Hypertensive Rats via NLRP3 Inflammasomes
Jiaxin JU ; Caocao CHENG ; Teng GE ; Yalong KANG ; Fang GUAN ; Haifang WANG ; Juanjuan TAN
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(4):125-131
ObjectiveTo investigate the effect of Naoqingtong decoction (NQT) on the kidney damage and the inflammatory factors NOD-like receptor protein 3 (NLRP3), apoptosis-associated speck-like protein containing a C-terminal caspase recruitment domain (ASC), cysteinyl aspartate-specific proteinase-1 (Caspase-1), interleukin-6 (IL-6), and tumor necrosis factor-α (TNF-α) in spontaneously hypertensive rats (SHRs). MethodsTwenty-four SHRs were randomized into a model group, a low-dose (12.9 g·kg-1·d-1) NQT (NQT-L) group, a high-dose (25.8 g·kg-1·d-1) NQT group (NQT-H), and a captopril (CTP, 20 mg·kg-1·d-1) group, with 6 rats in each group. In addition, 6 homozygous male Wistar-Kyoto rats were used as the control group. The control and model groups were administrated with the same amount of normal saline by gavage for 8 weeks. General behaviors of rats were observed during the intervention period, and the blood pressure was measured periodically. At the end of intervention, the body mass was weighed, and both kidneys were collected and weighed for the calculation of the renal index. Hematoxylin-eosin staining was performed to observe the pathological changes in the kidney tissue. Real-time fluorescence quantitative polymerase chain reaction (Real-time PCR) and Western blot were employed to determine the expression levels of NLRP3, ASC, Caspase-1, IL-6, and TNF-α in the kidney tissue. ResultsDuring the experiment period, the control group had normal mental status, food intake, and activity, while the model group showed thinning of hair, loss of luster, reduced activity, loss of appetite, fecal adhesion, and irritability, and some of the skin had scratches or blood scabs. The above symptoms were alleviated to different degrees after 8 weeks of NQT administration. An intelligent non-invasive sphygmomanometer was used to measure the tail artery pressure of rats, which showed that the systolic and diastolic blood pressure of rats in the model group was higher than that in the control group (P<0.01). Compared with the model group, drug interventions lowered the systolic and diastolic blood pressure (P<0.05, P<0.01). Compared with the control group, the model group showed severe pathological damage in the kidney tissue, which was alleviated in each drug intervention group. Compared with the control group, the model group showed up-regulated expression levels of NLRP3, ASC, Caspase-1, IL-6, and TNF-α in the kidney tissue (P<0.05, P<0.01). Compared with the model group, the drug intervention groups showed down-regulated expression levels of NLRP3, ASC, Caspase-1, IL-6, and TNF-α in the kidney tissue (P<0.05, P<0.01). ConclusionNQT can lower the blood pressure in SHRs by inhibiting the activation of NLRP3 inflammasomes, suppressing renal inflammation, and ameliorating hypertensive kidney damage.
4.Chinese expert consensus on postoperative follow-up for non-small cell lung cancer (version 2025)
Lunxu LIU ; Shugeng GAO ; Jianxing HE ; Jian HU ; Di GE ; Hecheng LI ; Mingqiang KANG ; Fengwei TAN ; Fan YANG ; Qiang PU ; Kaican CAI
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(03):281-290
Surgical treatment is one of the key approaches for non-small cell lung cancer (NSCLC). Regular postoperative follow-up is crucial for early detection and timely management of tumor recurrence, metastasis, or second primary tumors. A scientifically sound and reasonable follow-up strategy not only extends patient survival but also significantly improves quality of life, thereby enhancing overall prognosis. This consensus aims to build upon the previous version by incorporating the latest clinical research advancements and refining postoperative follow-up protocols for early-stage NSCLC patients based on different treatment modalities. It provides a scientific and practical reference for clinicians involved in the postoperative follow-up management of NSCLC. By optimizing follow-up strategies, this consensus seeks to promote the standardization and normalization of lung cancer diagnosis and treatment in China, helping more patients receive high-quality care and long-term management. Additionally, the release of this consensus is expected to provide insights for related research and clinical practice both domestically and internationally, driving continuous development and innovation in the field of postoperative management for NSCLC.
5.Principles, technical specifications, and clinical application of lung watershed topography map 2.0: A thoracic surgery expert consensus (2024 version)
Wenzhao ZHONG ; Fan YANG ; Jian HU ; Fengwei TAN ; Xuening YANG ; Qiang PU ; Wei JIANG ; Deping ZHAO ; Hecheng LI ; Xiaolong YAN ; Lijie TAN ; Junqiang FAN ; Guibin QIAO ; Qiang NIE ; Mingqiang KANG ; Weibing WU ; Hao ZHANG ; Zhigang LI ; Zihao CHEN ; Shugeng GAO ; Yilong WU
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(02):141-152
With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.
6.Endoscopic spine surgery for obesity-related surgical challenges: a systematic review and meta-analysis of current evidence
Wongthawat LIAWRUNGRUEANG ; Watcharaporn CHOLAMJIAK ; Peem SARASOMBATH ; Yudha Mathan SAKTI ; Pang Hung WU ; Meng-Huang WU ; Yu-Jen LU ; Lo Cho YAU ; Zenya ITO ; Sung Tan CHO ; Dong-Gune CHANG ; Kang Taek LIM
Asian Spine Journal 2025;19(2):292-310
Obesity presents significant challenges in spinal surgery, including higher rates of perioperative complications, prolonged operative times, and delayed recovery. Traditional open spine surgery often exacerbates these risks, particularly in patients with obesity, because of extensive tissue dissection and larger incisions. Endoscopic spine surgery (ESS) has emerged as a promising minimally invasive alternative, offering advantages such as reduced tissue trauma, minimal blood loss, lower infection rates, and faster recovery. This systematic review and meta-analysis aimed to evaluate the safety, efficacy, and outcomes of ESS techniques, including fully endoscopic and biportal endoscopic lumbar discectomy and decompression, in patients with obesity and lumbar spine pathologies. A comprehensive literature search of the PubMed/Medline, Embase, and Scopus databases yielded 2,975 studies published between 2000 and 2024, of which 10 met the inclusion criteria. The meta-analysis revealed significant improvements in pain relief (Visual Analog Scale) and functional outcomes (Oswestry Disability Index), with comparable results between patients with and without obesity. Patients who are obese experienced longer operative times and have a slightly higher risk of symptom recurrence; however, ESS demonstrated lower rates of wound infections, shorter hospital stays, and faster recovery than traditional surgery. These findings position ESS as a viable and effective option for managing lumbar spine conditions in patients with obesity, addressing obesity-related surgical challenges while maintaining favorable clinical outcomes. However, limitations such as study heterogeneity and the lack of randomized controlled trials highlight the need for further high-quality research to refine ESS techniques and optimize patient care in this high-risk population.
7.Endoscopic spine surgery for obesity-related surgical challenges: a systematic review and meta-analysis of current evidence
Wongthawat LIAWRUNGRUEANG ; Watcharaporn CHOLAMJIAK ; Peem SARASOMBATH ; Yudha Mathan SAKTI ; Pang Hung WU ; Meng-Huang WU ; Yu-Jen LU ; Lo Cho YAU ; Zenya ITO ; Sung Tan CHO ; Dong-Gune CHANG ; Kang Taek LIM
Asian Spine Journal 2025;19(2):292-310
Obesity presents significant challenges in spinal surgery, including higher rates of perioperative complications, prolonged operative times, and delayed recovery. Traditional open spine surgery often exacerbates these risks, particularly in patients with obesity, because of extensive tissue dissection and larger incisions. Endoscopic spine surgery (ESS) has emerged as a promising minimally invasive alternative, offering advantages such as reduced tissue trauma, minimal blood loss, lower infection rates, and faster recovery. This systematic review and meta-analysis aimed to evaluate the safety, efficacy, and outcomes of ESS techniques, including fully endoscopic and biportal endoscopic lumbar discectomy and decompression, in patients with obesity and lumbar spine pathologies. A comprehensive literature search of the PubMed/Medline, Embase, and Scopus databases yielded 2,975 studies published between 2000 and 2024, of which 10 met the inclusion criteria. The meta-analysis revealed significant improvements in pain relief (Visual Analog Scale) and functional outcomes (Oswestry Disability Index), with comparable results between patients with and without obesity. Patients who are obese experienced longer operative times and have a slightly higher risk of symptom recurrence; however, ESS demonstrated lower rates of wound infections, shorter hospital stays, and faster recovery than traditional surgery. These findings position ESS as a viable and effective option for managing lumbar spine conditions in patients with obesity, addressing obesity-related surgical challenges while maintaining favorable clinical outcomes. However, limitations such as study heterogeneity and the lack of randomized controlled trials highlight the need for further high-quality research to refine ESS techniques and optimize patient care in this high-risk population.
8.Endoscopic spine surgery for obesity-related surgical challenges: a systematic review and meta-analysis of current evidence
Wongthawat LIAWRUNGRUEANG ; Watcharaporn CHOLAMJIAK ; Peem SARASOMBATH ; Yudha Mathan SAKTI ; Pang Hung WU ; Meng-Huang WU ; Yu-Jen LU ; Lo Cho YAU ; Zenya ITO ; Sung Tan CHO ; Dong-Gune CHANG ; Kang Taek LIM
Asian Spine Journal 2025;19(2):292-310
Obesity presents significant challenges in spinal surgery, including higher rates of perioperative complications, prolonged operative times, and delayed recovery. Traditional open spine surgery often exacerbates these risks, particularly in patients with obesity, because of extensive tissue dissection and larger incisions. Endoscopic spine surgery (ESS) has emerged as a promising minimally invasive alternative, offering advantages such as reduced tissue trauma, minimal blood loss, lower infection rates, and faster recovery. This systematic review and meta-analysis aimed to evaluate the safety, efficacy, and outcomes of ESS techniques, including fully endoscopic and biportal endoscopic lumbar discectomy and decompression, in patients with obesity and lumbar spine pathologies. A comprehensive literature search of the PubMed/Medline, Embase, and Scopus databases yielded 2,975 studies published between 2000 and 2024, of which 10 met the inclusion criteria. The meta-analysis revealed significant improvements in pain relief (Visual Analog Scale) and functional outcomes (Oswestry Disability Index), with comparable results between patients with and without obesity. Patients who are obese experienced longer operative times and have a slightly higher risk of symptom recurrence; however, ESS demonstrated lower rates of wound infections, shorter hospital stays, and faster recovery than traditional surgery. These findings position ESS as a viable and effective option for managing lumbar spine conditions in patients with obesity, addressing obesity-related surgical challenges while maintaining favorable clinical outcomes. However, limitations such as study heterogeneity and the lack of randomized controlled trials highlight the need for further high-quality research to refine ESS techniques and optimize patient care in this high-risk population.
9.Effect of Video-based Educational Intervention Combined with Maternal Presence on Perioperative Adverse Outcomes in Preschool Children under General Anesthesia
Jiayu TAN ; Fengqiu GONG ; Wenqi HUANG ; Xia FENG ; Qiongfang ZHU ; Yubo KANG ; Wenyan WU ; Xiuhong LI
Journal of Sun Yat-sen University(Medical Sciences) 2025;46(3):519-527
ObjectiveTo investigate the effect of video-based educational intervention combined with maternal presence on perioperative adverse outcomes in preschool children undergoing general anesthesia, including cooperation in anesthesia induction, perioperative anxiety, pain and agitation during recovery. MethodsA total of 300 preschool children scheduled for general anesthesia in our hospital from June to December 2023 were randomly assigned to control group (n=150) and intervention group (n=150). The control group received routine recovery care. For the intervention group, in addition to routine recovery care, a preoperative visit was scheduled one day before surgery. During this visit, mothers were guided to watch anesthesia videos with their children. During the waiting period in the operating room and 30 minutes after awakening, the mothers were guided to accompany the children for more than 30 minutes. Recovery conditions were recorded using the surgical anesthesia information system, and the children’s anesthetic induction compliance, perioperative anxiety, pain, and agitation were evaluated and recorded using the modified Yale Preoperative Anxiety Scale (m-YPAS), the Induction Compliance Scale (ICC), the Children’s Pain Behavior Scale (FLACC), and the Pediatric Agitation and Emergence Delirium Scale (PAED). ResultsOn the preoperative visit day, there were no statistically significant differences in baseline data between the two groups (P > 0.05). For perioperative anxiety, the m-YPAS scores of the intervention group were significantly lower than those of the control group, both when entering the operating room waiting area (35.27±6.48 vs. 41.79±6.68, P < 0.05) and 30 minutes after postoperative recovery (20.13±7.05 vs. 35.75±9.51, P < 0.05). In terms of anesthesia induction cooperation, the ICC scores of the intervention group were significantly lower than those of the control group (1.84±0.95 vs. 3.17±0.62, P < 0.05), and the proportion of good induction cooperation was significantly higher than that of the control group (24.00% vs. 12.67%, P < 0.05). There was no significant difference in awakening duration between the two groups, but the intervention group had a significantly shorter length of stay in the post-anesthesia care unit than the control group (0.90±0.29 hours vs. 1.29±0.42 hours, P < 0.001). For perioperative agitation, the PAED scores of the intervention group were significantly lower than those of the control group (entering in the operating room waiting area: 8.5 vs. 9.2, P < 0.05; 30 minutes after postoperative recovery: 4.2 vs. 7.8, P < 0.05). In terms of pain scores, the FLACC scores of the intervention group were also significantly lower than those of the control group, both when entering the operating room waiting area ( 5.3 vs. 6.7, P < 0.05; 30 minutes after postoperative recovery: 2.1 vs. 4.9, P < 0.05). ConclusionsVideo-based educational intervention combined with maternal presence reduces the perioperative anxiety, pain and agitation of preschool children undergoing general anesthesia, and improved the compliance of anesthesia induction. It is recommended to promote this intervention measure in clinical practice.
10.Investigation on an outbreak of acute hemorrhagic conjunctivitis at a boarding middle school in Guangdong Province
Chinese Journal of School Health 2025;46(6):878-882
Objective:
To investigate the characteristics and risk factors of an outbreak of acute hemorrhagic conjunctivitis (AHC) in a boarding middle school in Guangdong Province, in order to provide a scientific evidence for effective prevention and control of campus AHC outbreaks.
Methods:
From September 1st to 28th 2023, case identification was conducted among 559 students and 60 faculty members using standardized definition. Descriptive analysis was conducted on the three distrubution patterns of the outbreak. Questionnaires were designed, and a case-control study was adopted to analyze the possible risk factors of the disease transmission. The propensity score matching (PSM) method was used to control the difference of baseline data.
Results:
A total of 269 cases of AHC were identified, with an attack rate of 43.46%. The pathogen was confirmed as Coxsackie virus A24 variant (CA24v). Among these, 264 cases were students (attack rate of 47.23%) and 5 were staff (attack rate of 8.33%). A total of 153 pairs of PSM were successfully matched. After PSM matching, there were no statistically significant differences in gender, grade and class between the case group and the control group ( χ 2=0.12, 5.41, 11.24, P >0.05). The results of multivariate Logistic regression analysis showed that middle school students whose towels contacted with others ( OR =1.81), and direct contact with other AHC cases recently ( OR =4.89) were more likely to have AHC; while wearing glasses ( OR =0.43) and frequent use of hand sanitizer ( OR = 0.37 ) were less likely to have AHC ( P <0.05).
Conclusion
The outbreak of AHC is caused by CA24v, demonstrating rapid spread and extensive impact within the school setting.


Result Analysis
Print
Save
E-mail