AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Introduction: Capivasertib is a selective oral AKT inhibitor approved for hormone receptor-positive, HER2-negative advanced breast cancer with AKT pathway mutations. As AKT is integral to insulin signaling, its inhibition predisposes patients to hyperglycemia. We report a case of severe capivasertib-induced hyperglycemia with profound insulin resistance in a non-diabetic patient. Case: A 56-year-old female with metastatic breast cancer (ER/ PR-positive, HER2-negative, AKT1- and ESR1-mutated, TMB-high) presented with severe hyperglycemia following capivasertib initiation. She had no prior diabetes history, with a baseline hemoglobin A1c of 5.6%. Her first cycle (200 mg twice daily, 7 April 2025) was uncomplicated metabolically. The second cycle was escalated to 400 mg twice daily on 21 April 2025. By Day 3, blood glucose rose significantly. Premixed insulin 20 units failed to achieve glycemic control, necessitating intravenous insulin infusion. Despite escalation to 30 units per hour, euglycemia could not be achieved. Notably, there was no biochemical evidence of diabetic ketoacidosis or hyperosmolar hyperglycemic state, and the patient remained hemodynamically stable. No corticosteroids or other contributing medications were administered. Blood glucose normalized spontaneously approximately 36 hours after the last capivasertib dose, and all insulin was weaned and discontinued by 26 April 2025. She remained euglycemic without antidiabetic therapy thereafter. The patient and family opted for palliative care, and she passed away on 6 May 2025. Conclusion Capivasertib can precipitate severe, insulin-resistant hyperglycemia even in non-diabetic patients, without progression to overt hyperglycemic crisis. Spontaneous resolution upon drug cessation supports a direct drugmediated mechanism via AKT-disrupted insulin signaling. Clinicians should monitor glucose closely during therapy and consider drug cessation in refractory cases. Further studies are warranted to guide optimal glycemic management.
capivasertib ; Hyperglycemia ; Insulins

To formulate an expert consensus on the principles of preoperative hair removal and provide scientific guidance for standardized removal of hair before surgical procedures so as to reduce the incidence of surgical site infections.METHODS Led by the Hospital Management Institute of National Health Commission of the People's Republic of China,this consensus was reached with the joint efforts from the expects of relevant fields such as surgeries,interventional therapies,nursing,and infection prevention and control.The consensus facilitates the classification and evaluation of literatures by following the evidence grade formulated by Oxford Evidence-based Medicine Center and focuses on the association of preoperative hair removal with surgical site infection,it reaches the evidence grade of expert consensus and recommendation intensity by integrating with discussions on meetings and clinical experience of the expects from relevant fields.RESULTS A total of 6 items of consensus were reached by summarizing the latest evidence on the aspects including the indications for preoperative hair removal,tools,range,timing and places.CONCLUSION The consensus,to some extent,make supplements to and complete the exiting regulations and standards.It provides guidance for the medical institutions to carry out the preoperative hair removal.

Objective To explore the effects of different education and examination methods on the examination results during the screening/evaluation of patent foramen ovale by contrast-enhanced transcranial Doppler(cTCD).Methods Patients who underwent cTCD screening/evaluation for patent foramen ovale in our hospital from May 2023 to February 2024 were retrospectively selected as the research subjects.The patients were divided into the observation group and the control group according to different education and examination methods during the peri-examination period.Patients who received video education,modified Valsalva maneuver,and injection of contrast agent with 20 mL syringe were included into the observation group,and patients who received artificial education,Valsalva maneuver,and injection of contrast agent with 10 mL syringe were included into the control group.The positive detection rate of patent foramen ovale,right-to-left shunt microbubble grading during Valsalva/modified Valsalva maneuver,systolic blood flow velocity,pulsatility index(PI),resistive index(RI),examination duration,total physician-patient communication time,whether occlusion surgery was performed,and patient satisfaction were compared between the two groups.Results The positive detection rate of patent foramen ovale by cTCD(82.93%vs.95.92%),the detection rate of the maximum amout(grade Ⅲ)of microbubbles(39.02%vs.61.22%),the total physician-patient communication time during the peri-examination period[11.30(10.00,14.00)minutes vs.8.23(7.00,10.00)minutes],the rate of occlusion surgery(48.78%vs.73.47%),and the total patient satisfaction(80.49%vs.91.84%)showed statistically significant differences between the control group and the observation group(P<0.05).Additionally,the receiver operating characteristic(ROC)curve analysis showed that the area under the curve(AUC)for diagnosing patent foramen ovale were 0.718 in the control group and 0.855 in the observation group.Conclusion Peri-examination interventions such as video education,modified Valsalva maneuver,and injection of contrast agent with 20 mL syringe can improve the positive detection rate of patent foramen ovale,reduce ineffective physician-patient communication,and improve patient satisfaction.

Objective:To explore the independent risk factors for uremic encephalopathy(UE)in maintenance hemodialysis(MHD)patients and provide evidence for early clinical warning and intervention.Methods:A case-control study was conducted,enrolling 67 MHD patients diagnosed with UE(UE group)at Laibin People's Hospital from January 2010 to December 2024,and 67 non-UE patients during the same period(control group).Demographic characteristics,dialysis parameters,laboratory indicators,and infection events were collected.Univariate and multivariate logistic regression analyses were used to identify independent risk factors for UE.Results:The UE group had significantly higher rates of infection(58.2％vs.29.9％),serum creatinine(789 vs.702 μmol/L),and iPTH levels(568 vs.385 pg/mL)compared to the control group(P＜0.05).Multivariate analysis revealed that concurrent infection(OR=3.022,95％CI:1.312-6.958),elevated serum creatinine(OR=1.004,95％CI:1.000-1.008),and elevated iPTH(OR=1.002,95％CI:1.001-1.003)were independent risk factors for UE(P＜0.05).The combined prediction model achieved an AUC of 0.878(95％CI:0.822-0.934),with 82.1％sensitivity and 80.6％specificity.Conclusion:Infection,elevated serum creatinine,and elevated iPTH significantly increase the risk of UE in MHD patients.Clinical management should emphasize infection prevention,toxin clearance optimization,and parathyroid function regulation to reduce UE incidence.

BACKGROUND:Neuroinflammation is a major cause of exacerbation after spinal cord injury.In recent years,pyroptosis has received much attention due to its remarkable pro-inflammatory features.Some of these natural products can significantly inhibit the inflammatory response and improve the damaged nerve function by regulating the level of pyroptosis after spinal cord injury,which provides a new therapeutic idea for spinal cord injury.OBJECTIVE:To summarize the mechanism of action of natural products in regulating pyroptosis for the treatment of spinal cord injury,with a view to providing lessons and references for future research on the treatment of spinal cord injury.METHODS:The search terms"spinal cord injury,pyroptosis,inflammasome,natural products,natural compounds,traditional Chinese medicine"in Chinese and English were used to search for relevant literature since the establishment of the database up to September 2024 in the databases of PubMed,Web of Science,WanFang,and CNKI.According to the inclusion and exclusion criteria,75 relevant articles were finally obtained.RESULTS AND CONCLUSION:(1)Pyroptosis is an important pro-inflammatory pathway in spinal cord injury,and controlling pyroptosis is an effective way to improve damaged nerve function.(2)Some natural products can regulate pyroptosis via the NLRP3/Caspase-1 classical pyroptosis pathway,the NF-κB-related pathway,other upstream pathways such as Nrf2/HO-1,and autophagy,thereby affecting the level of tissue inflammation and accelerating neurological recovery after spinal cord injury.(3)The anti-pyroptosis effects of these natural products are mostly dependent on the NLRP3 classical pyroptosis pathway,and there is a lack of studies on other pyroptosis pathways.(4)There are still many problems in this field,such as the fact that these natural products are not currently supported by evidence from appropriate clinical studies.(5)The natural product has great potential in regulating pyroptosis and is expected to be a powerful weapon in the treatment of spinal cord injury.

To formulate an expert consensus on the principles of preoperative hair removal and provide scientific guidance for standardized removal of hair before surgical procedures so as to reduce the incidence of surgical site infections.METHODS Led by the Hospital Management Institute of National Health Commission of the People's Republic of China,this consensus was reached with the joint efforts from the expects of relevant fields such as surgeries,interventional therapies,nursing,and infection prevention and control.The consensus facilitates the classification and evaluation of literatures by following the evidence grade formulated by Oxford Evidence-based Medicine Center and focuses on the association of preoperative hair removal with surgical site infection,it reaches the evidence grade of expert consensus and recommendation intensity by integrating with discussions on meetings and clinical experience of the expects from relevant fields.RESULTS A total of 6 items of consensus were reached by summarizing the latest evidence on the aspects including the indications for preoperative hair removal,tools,range,timing and places.CONCLUSION The consensus,to some extent,make supplements to and complete the exiting regulations and standards.It provides guidance for the medical institutions to carry out the preoperative hair removal.

BACKGROUND:Neuroinflammation is a major cause of exacerbation after spinal cord injury.In recent years,pyroptosis has received much attention due to its remarkable pro-inflammatory features.Some of these natural products can significantly inhibit the inflammatory response and improve the damaged nerve function by regulating the level of pyroptosis after spinal cord injury,which provides a new therapeutic idea for spinal cord injury.OBJECTIVE:To summarize the mechanism of action of natural products in regulating pyroptosis for the treatment of spinal cord injury,with a view to providing lessons and references for future research on the treatment of spinal cord injury.METHODS:The search terms"spinal cord injury,pyroptosis,inflammasome,natural products,natural compounds,traditional Chinese medicine"in Chinese and English were used to search for relevant literature since the establishment of the database up to September 2024 in the databases of PubMed,Web of Science,WanFang,and CNKI.According to the inclusion and exclusion criteria,75 relevant articles were finally obtained.RESULTS AND CONCLUSION:(1)Pyroptosis is an important pro-inflammatory pathway in spinal cord injury,and controlling pyroptosis is an effective way to improve damaged nerve function.(2)Some natural products can regulate pyroptosis via the NLRP3/Caspase-1 classical pyroptosis pathway,the NF-κB-related pathway,other upstream pathways such as Nrf2/HO-1,and autophagy,thereby affecting the level of tissue inflammation and accelerating neurological recovery after spinal cord injury.(3)The anti-pyroptosis effects of these natural products are mostly dependent on the NLRP3 classical pyroptosis pathway,and there is a lack of studies on other pyroptosis pathways.(4)There are still many problems in this field,such as the fact that these natural products are not currently supported by evidence from appropriate clinical studies.(5)The natural product has great potential in regulating pyroptosis and is expected to be a powerful weapon in the treatment of spinal cord injury.

Chikungunya fever is spreading continuously worldwide，posing a growing public health challenge alongside other arboviral diseases. This article systematically reviews the epidemiological characteristics of chikungunya fever，analyzes the pandemic potential of Aedes mosquito-borne diseases and discusses integrated prevention and control strategies for China in the context of increasing importation risk，drawing on containment practices from multiple countries and regions.