AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Introduction: Capivasertib is a selective oral AKT inhibitor approved for hormone receptor-positive, HER2-negative advanced breast cancer with AKT pathway mutations. As AKT is integral to insulin signaling, its inhibition predisposes patients to hyperglycemia. We report a case of severe capivasertib-induced hyperglycemia with profound insulin resistance in a non-diabetic patient. Case: A 56-year-old female with metastatic breast cancer (ER/ PR-positive, HER2-negative, AKT1- and ESR1-mutated, TMB-high) presented with severe hyperglycemia following capivasertib initiation. She had no prior diabetes history, with a baseline hemoglobin A1c of 5.6%. Her first cycle (200 mg twice daily, 7 April 2025) was uncomplicated metabolically. The second cycle was escalated to 400 mg twice daily on 21 April 2025. By Day 3, blood glucose rose significantly. Premixed insulin 20 units failed to achieve glycemic control, necessitating intravenous insulin infusion. Despite escalation to 30 units per hour, euglycemia could not be achieved. Notably, there was no biochemical evidence of diabetic ketoacidosis or hyperosmolar hyperglycemic state, and the patient remained hemodynamically stable. No corticosteroids or other contributing medications were administered. Blood glucose normalized spontaneously approximately 36 hours after the last capivasertib dose, and all insulin was weaned and discontinued by 26 April 2025. She remained euglycemic without antidiabetic therapy thereafter. The patient and family opted for palliative care, and she passed away on 6 May 2025. Conclusion Capivasertib can precipitate severe, insulin-resistant hyperglycemia even in non-diabetic patients, without progression to overt hyperglycemic crisis. Spontaneous resolution upon drug cessation supports a direct drugmediated mechanism via AKT-disrupted insulin signaling. Clinicians should monitor glucose closely during therapy and consider drug cessation in refractory cases. Further studies are warranted to guide optimal glycemic management.
capivasertib ; Hyperglycemia ; Insulins

OBJECTIVE: To explore the methods, fixation points, and effectiveness of staged therapy using external fixation frame in treatment of infectious nonunion near knee joint. METHODS: A retrospective analysis was conducted on the clinical data of 60 patients with infectious nonunion near knee joint, who underwent staged therapy using external fixation frame between June 2021 and June 2024 and were followed up. There were 48 males and 12 females with an average age of 47.9 years (range, 16-70 years). The disease duration ranged from 9 months to 20 years, with a median of 14 months. Among them, 21 cases of infectious nonunion located in the distal femur, 36 cases in the proximal tibia, and 3 cases in the patella; 12 cases exhibited segmental bone defects (≥4 cm), while 48 cases presented with localized bone defects (<4 cm). Osteomyelitis was classified using the Cierny-Mader system, with 3 cases classified as type Ⅰ, 6 cases as type Ⅱ, 35 cases as type Ⅲ, and 16 cases as type Ⅳ. Preoperative C-reactive protein levels ranged from 15.1 to 55.8 mg/L (mean, 36.4 mg/L). The erythrocyte sedimentation rate was 35-80 mm/1 h (mean, 56.9 mm/1 h). The Hospital for Special Surgery (HSS) score for knee joint was 69.3±17.7 and the range of motion was (70.61±40.60)°. After debridement and placement of antibiotic carriers at the first-stage operation, unilateral orbital frames ( n=14), combined frames ( n=27), or Ilizarov frames ( n=19) were used for cross joint fixation ( n=9) or joint preservation fixation ( n=51). After 6-8 weeks of infection control, the bone grafting or bone transport was performed at the second-stage operation based on the type of bone defect, with internal fixation employed as an adjunct if necessary. After operation, the infection control and fracture healing were observed and the bone healing time was recorded. The knee joint function was assessed using the HSS score, and the knee joint range of motion was measured as well as the angle of motion loss. Patients were grouped according to the site of nonunion, type of external fixation frame, and fixation method. The bone healing time, change value of HSS score, and knee joint range of motion loss (difference between pre- and post-operation) were compared between groups. RESULTS: All infection markers returned to the normal range within 6 weeks after the first-stage operation. All patients were followed up 12-48 months (mean, 22.0 months) after the second-stage operation. There were 5 cases of needle tract infection during the external fixation period, and 3 cases of infection recurrence after the second-stage operation, all of which were cured after symptomatic treatment. The bone healing time was 6-18 months (mean, 11.0 months). At last follow-up, the HSS score was 88.5±7.9 and the range of motion was (61.84±40.59)°, with significant differences compared to preoperative values ( P<0.05); the knee joint range of motion loss was (8.77±11.07)°. The bone healing time was significantly longer in the distal femur group than in the proximal tibia group ( P<0.05), and in the unilateral orbital frames group than in the Ilizarov frames group and the combined frames group ( P<0.05). The angle of motion loss was significantly larger in the Ilizarov frames group than in the unilateral orbital frames group and the combined frames group ( P<0.05). The change value of HSS score was significantly higher in the cross joint fixation group than in the joint preservation fixation group ( P<0.05). CONCLUSION During the first-stage operation, debridement is performed and antibiotic carriers are placed to control infection. External fixation frames are then precisely positioned based on the distance between the lesion and the joint surface, avoiding the infected wound while ensuring mechanical balance. During the second-stage operation, bone grafting options are selected according to the extent of bone defects to enhance the bone union. Postoperative early functional exercises of the knee joint are permitted to improve joint function.
Humans ; Male ; Female ; Middle Aged ; Adult ; Fractures, Ununited/surgery* ; Retrospective Studies ; External Fixators ; Aged ; Knee Joint/surgery* ; Adolescent ; Young Adult ; Treatment Outcome ; Osteomyelitis/surgery* ; Fracture Fixation/instrumentation* ; Bone Transplantation ; Tibial Fractures/surgery*

OBJECTIVE: To explore the effectiveness of primary interventional revascularization combined with secondary perforator composite flap in the treatment of peripheral arterial disease (PAD) accompanied by soft tissue defects around the ankle. METHODS: Between January 2022 and January 2025, 12 patients with PAD and soft tissue defects around the ankle were admitted. Among them, there were 9 males and 3 females; their ages ranged from 52 to 82 years, with an average of 68.9 years. The causes of injury included 4 cases of traffic accident, 5 cases of falls, 1 case of falling from height, 1 case of foreign body puncture injury, and 1 case of electric shock injury. The infection duration ranged from 1 month to 35 years, with a median duration of 3.5 months. The wound size ranged from 5.5 cm×3.0 cm to 15.0 cm×9.0 cm. The ankle-brachial index (ABI) was 0.32±0.12. The visual analogue scale (VAS) score for pain was 3.3±0.5. Preoperative vascular stenosis assessment was performed in all patients, with primary intervention to dredge large and medium-sized arteries, followed by secondary repair of the wound using a perforator composite flap. The flap size ranged from 6.5 cm×4.0 cm to 16.0 cm×10.0 cm. The donor sites were sutured directly or repaired with skin grafts. After two stages of treatment, the effectiveness was evaluated by measuring ABI, observing flap survival and wound healing, assessing VAS scores, and American Orthopedic Foot and Ankle Society (AOFAS) scores. RESULTS: All 12 cases completed two stages of treatment; all patients were followed up after the second-stage treatment, with a follow-up period ranging from 7 to 28 months, with an average of 16.8 months. After the first-stage treatment, the skin temperature around the ankle was significantly higher than that before treatment, and the ABI increased to 0.71±0.07, with a significant difference ( t=9.918, P<0.001). After the second-stage treatment, the blisters on the distal end of the skin flap occurred in 3 cases. The flaps survived and the wounds healed, with a healing time ranging from 10 to 14 days (mean, 11.8 days). The incisions at the donor site healed by first intention, and the skin grafts survived. The VAS score was 0.5±0.5 at 3 weeks, which was significantly lower than that before treatment ( t=13.675, P<0.001). No infection recurrence occurred during follow-up. At 6 months after the second-stage treatment, the AOFAS score of the ankle joint ranged from 92 to 97, with an average of 94.7, all reaching excellent. CONCLUSION Interventional revascularization combined with perforator composite flap for staged treatment of PAD with ankle soft tissue defects can obtain good effectiveness, by unclogging the main blood vessels, improving lower limb blood supply, and improving the survival rate of the skin flap.
Humans ; Male ; Female ; Middle Aged ; Aged ; Peripheral Arterial Disease/surgery* ; Soft Tissue Injuries/surgery* ; Perforator Flap/blood supply* ; Plastic Surgery Procedures/methods* ; Aged, 80 and over ; Ankle/blood supply* ; Treatment Outcome ; Ankle Brachial Index ; Skin Transplantation/methods*

OBJECTIVE: To compare clinical efficacy of tibial transverse transport (TTT) microcirculation reconstruction and periosteal distraction in treating patients with early diabetic foot(DF). METHODS: From June 2021 to June 2024, 60 patients with DF were admitted and divided into bone transport group and stretch group according to different treatment methods. There were 30 patients in bone transport group, including 16 males and 14 females;aged from 48 to 65 years old with an average of (55.59±3.78) years old;the course of disease ranged from 2 to 9 months with an average of(5.95±1.32) months;TTT microcirculation reconstruction surgery was performed. There were 30 patients in distraction group, including 17 males and 13 females;aged from 47 to 67 years old with an average of (55.24±3.81) years old;the course of disease ranged from 2 to 10 months with an average of (5.68±1.54) months;periosteal distraction surgery was performed. The skin temperature of the affected feet, the time of getting out of bed and walking after operation, the time of full weight-bearing, the wound healing time and complications were compared between two groups;the pain was evaluated by visual analogue scale (VAS) before operation and one month after operation respectively;the changes of blood flow velocity of dorsal foot arteries, ankle brachial index(ABI), epidermal growth factor (EGF), and basic fibroblast growth factor (bFGF) before and after operation at 3 months were compared between two groups. RESULTS: All patients were followed up for 3 to 4 months with an average of (3.52±0.12) months. There were no statistically significant differences in comparison of foot skin temperature, postoperative walking time, full weight-bearing time and complications between two groups (P>0.05). The wound healing time of bone transport group (61.26±7.31) days was shorter than that of distraction group (70.17±7.15) days, and the difference was statistically significant (P<0.05). Postoperative VAS at 1 month of bone transport group (2.19±0.21) was lower than that of distraction group (2.55±0.20), and the difference was statistically significant (P<0.05). At 3 months after operation, the blood flow velocity of dorsal foot artery, ankle-brachial index, EGF and bFGF in bone transport group were(34.73±4.18) cm·s^-1, (0.95±0.13), (716.61±71.13) pg·ml^-1 and (175.69±31.28) pg·ml^-1, respectively;which were higher than that of distraction group (31.86±3.23) cm·s^-1, (0.84±0.11), (677.37±70.21) pg·ml^-1, (149.26±30.13) pg·ml^-1, and the differences were statistically significant (P<0.05). There was no recurrence of ulcers in situ or at other sites in both groups during follow-up. CONCLUSION Compared with periosteal distraction, TTT microcirculation reconstruction surgery has a definite effect in the treatment of early DF. It could effectively reduce pain level, improve blood flow indicators and vascular endothelial function of the foot, and has a relatively high safety.
Humans ; Male ; Female ; Middle Aged ; Aged ; Tibia/blood supply* ; Diabetic Foot/physiopathology* ; Microcirculation ; Periosteum/surgery* ; Plastic Surgery Procedures/methods* ; Osteogenesis, Distraction

Objective To analyze the medication law and compatibility characteristics of TCM compounds for the treatment of myocardial infarction in the national patent database.Methods TCM compounds for treating myocardial infarction were retrieved from CNIPA patent publication website.A prescription database was built using Excel 2019 software to statistically analyze the frequency of medicinal use and their properties,taste and meridian tropism;SPSS Modeler 18.0 software was used to analyze the association rules of drugs;a network of Chinese materia medica co-occurrence was constructed using Cytoscape 3.10.0,and systematic clustering analysis was performed on the Chinese materia medica in the core network.Results A total of 146 patents of TCM compounds were included,involved 440 kinds of Chinese materia medica.High frequency drugs included Salviea Miltiorrhizae Radix et Rhizoma,Chuanxiong Rhizoma,Angelicae Sinensis Radix,Glycyrrhizae Radix et Rhizoma,etc.The main property was warm,the main tastes were bitter,sweet and pungent,and the medicines mostly belongs to the liver meridian,heart meridian and spleen meridians.Commonly used medicinal pairs included Angelicae Sinensis Radix-Chuanxiong Rhizoma,Astragali Radix-Salviea Miltiorrhizae Radix et Rhizoma,Paeoniae Radix Rubra-Angelicae Sinensis Radix,etc.Commonly used tripartite combinations included Paeoniae Radix Rubra-Chuanxiong Rhizoma-Angelicae Sinensis Radix,Carthami Flos-Angelicae Sinensis Radix-Chuanxiong Rhizoma,Carthami Flos-Chuanxiong Rhizoma-Angelicae Sinensis Radix,etc.Clustering analysis showed four types of combinations.Conclusion TCM compound patents for the treatment of myocardial infarction is based on promoting blood circulation,removing blood stasis,and relieving pain,while also using methods such as eliminating phlegm,tonifying qi,warming yang,and nourishing yin.It can provide references for clinical medication.

Objective:To investigate the effects and molecular mechanisms of Wilms tumor 1-associated proteins(WTAP)on the cell biological properties of esophageal squamous cell carcinoma(ESCC)cells.Methods:31 pairs of ESCC tissues and their paired paracancerous tissues that were surgically resected at the Second Clinical Medical College of Chuanbei Medical College between September 2019 and April 2021 were collected.The esophageal cancer cells KYSE30,KYSE410,KYSE150,KYSE510,TE-1,and normal human esophageal epithelial cells HET-1A were routinely cultured.Transfection reagents were used to transfect si-NC,si-WTAP#1 and si-WTAP#2 nucleic acids into KYSE150 and KYSE510 cells.The cells were divided into si-NC,si-WTAP#1 and si-WTAP#2 groups.The expressions of WTAP and MAP3K9 mRNA were detected in the cells of each group by qPCR assay.CCK-8 assay,clone formation assay,and scratch healing assay,Transwell assay were employed to detect the effects of knockdown of WTAP expression on ESCC cell proliferation,migration,invasion and apoptosis.WB assay was used to detect the expressions of WTAP,MAP3K9,EMT and MAPK pathway-related proteins in ESCC cells of each group knocked down of WTAP;immunohistochemistry to detect the expression of WTAP proteins in ESCC tissues,immunoprecipitation of methylated RNA(MeRIP)-qPCR assay to detect the level of MAP3K9 m6A in ESCC cells,actinomycin D assay to detect the stability of mRNA of MAP3K9,and database data to analyze the expression,target genes,functional enrichment,and interacting RNA of WTAP.Results:WTAP was highly expressed in ESCC tissues and cells(P<0.05 or P<0.01 or P<0.001)and correlated with the degree of differentiation(P<0.01);the expression of WTAP mRNA and its protein were successfully knocked down in KYSE150 and KYSE510 cells(P<0.01 or P<0.001);the knockdown of WTAP significantly inhibited the proliferation,migration and invasion of KYSE150 and KYSE510 cells(P<0.05 or P<0.01 or P<0.001),and promoted the apoptosis of KYSE150 and KYSE510 cells(P<0.05 or P<0.01).Knockdown of WTAP resulted in a significant decrease in the m6A level of MAP3K9(P<0.05),and its mRNA expression level and mRNA stability were both significantly reduced(P<0.05).Database data analysis showed that WTAP target genes clustered in the MAPK signaling pathway;the expression levels of MAP3K9,p-ERK,N-cadherin,and MMP9 were significantly reduced(P<0.05 or P<0.01),and the expression level of E-cadherin was significantly elevated(P<0.05 or P<0.01)in the KYSE150 and KYSE510 cells after knockdown of WTAP.Conclusions:WTAP is highly expressed in ESCC tissues and cells and correlates with their differentiation.It promotes the stability of MAP3K9 mRNA through m6A modification,activates the MAPK pathway and thus promotes the malignant biological behaviors of ESCC cells.

Objective: To investigate the characteristics and risk factors of an outbreak of acute hemorrhagic conjunctivitis (AHC) in a boarding middle school in Guangdong Province, in order to provide a scientific evidence for effective prevention and control of campus AHC outbreaks. Methods: From September 1st to 28th 2023, case identification was conducted among 559 students and 60 faculty members using standardized definition. Descriptive analysis was conducted on the three distrubution patterns of the outbreak. Questionnaires were designed, and a case-control study was adopted to analyze the possible risk factors of the disease transmission. The propensity score matching (PSM) method was used to control the difference of baseline data. Results: A total of 269 cases of AHC were identified, with an attack rate of 43.46%. The pathogen was confirmed as Coxsackie virus A24 variant (CA24v). Among these, 264 cases were students (attack rate of 47.23%) and 5 were staff (attack rate of 8.33%). A total of 153 pairs of PSM were successfully matched. After PSM matching, there were no statistically significant differences in gender, grade and class between the case group and the control group ( χ 2=0.12, 5.41, 11.24, P >0.05). The results of multivariate Logistic regression analysis showed that middle school students whose towels contacted with others ( OR =1.81), and direct contact with other AHC cases recently ( OR =4.89) were more likely to have AHC; while wearing glasses ( OR =0.43) and frequent use of hand sanitizer ( OR = 0.37 ) were less likely to have AHC ( P <0.05). Conclusion The outbreak of AHC is caused by CA24v, demonstrating rapid spread and extensive impact within the school setting.

Objective To investigate the expansion margins of the planning target volume (PTV) and the planning organ at risk volume (PRV) in nasopharyngeal carcinoma patients immobilized with Styrofoam and head-neck-shoulder mask. Methods A convenient sample of 33 nasopharyngeal carcinoma patients who received radiotherapy at Huanggang Central Hospital from January to October 2024 were selected as the research subjects. All patients underwent cone beam CT scans during the first three treatments and weekly thereafter. After registration and calibration, the setup errors in the X (LAT), Y (LNG), and Z (VRT) directions were recorded. Statistical analysis was performed on the setup errors in each direction to determine differences, and the expansion margins for PTV and PRV were calculated using empirical formulas. Results A total of 229 cone beam CT images were collected. Statistical analysis found that the setup errors (systematic error ± random error) of the patients in the X, Y, and Z directions were 1.05 ± 0.72, 1.30 ± 0.80, and 1.29 ± 0.82 mm, respectively. The expansion margins for PTV in the left-right, superior-inferior, and anterior-posterior directions were 1.40, 1.76, and 1.8 mm, respectively. The expansion margins for PRV in these directions were 0.83, 1.02, and 1.05 mm, respectively. Conclusion For patients immobilized using Styrofoam and head-neck-shoulder mask, it is recommended that the expansion margins for PTV and PRV be set at 2 mm and 1 mm, respectively, in the left-right, superior-inferior, and anterior-posterior directions, and the PRV margin for the spinal cord be set at 3 mm in all directions.