AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Introduction: Capivasertib is a selective oral AKT inhibitor approved for hormone receptor-positive, HER2-negative advanced breast cancer with AKT pathway mutations. As AKT is integral to insulin signaling, its inhibition predisposes patients to hyperglycemia. We report a case of severe capivasertib-induced hyperglycemia with profound insulin resistance in a non-diabetic patient. Case: A 56-year-old female with metastatic breast cancer (ER/ PR-positive, HER2-negative, AKT1- and ESR1-mutated, TMB-high) presented with severe hyperglycemia following capivasertib initiation. She had no prior diabetes history, with a baseline hemoglobin A1c of 5.6%. Her first cycle (200 mg twice daily, 7 April 2025) was uncomplicated metabolically. The second cycle was escalated to 400 mg twice daily on 21 April 2025. By Day 3, blood glucose rose significantly. Premixed insulin 20 units failed to achieve glycemic control, necessitating intravenous insulin infusion. Despite escalation to 30 units per hour, euglycemia could not be achieved. Notably, there was no biochemical evidence of diabetic ketoacidosis or hyperosmolar hyperglycemic state, and the patient remained hemodynamically stable. No corticosteroids or other contributing medications were administered. Blood glucose normalized spontaneously approximately 36 hours after the last capivasertib dose, and all insulin was weaned and discontinued by 26 April 2025. She remained euglycemic without antidiabetic therapy thereafter. The patient and family opted for palliative care, and she passed away on 6 May 2025. Conclusion Capivasertib can precipitate severe, insulin-resistant hyperglycemia even in non-diabetic patients, without progression to overt hyperglycemic crisis. Spontaneous resolution upon drug cessation supports a direct drugmediated mechanism via AKT-disrupted insulin signaling. Clinicians should monitor glucose closely during therapy and consider drug cessation in refractory cases. Further studies are warranted to guide optimal glycemic management.
capivasertib ; Hyperglycemia ; Insulins

Objective:To investigate the effects and molecular mechanisms of Wilms tumor 1-associated proteins(WTAP)on the cell biological properties of esophageal squamous cell carcinoma(ESCC)cells.Methods:31 pairs of ESCC tissues and their paired paracancerous tissues that were surgically resected at the Second Clinical Medical College of Chuanbei Medical College between September 2019 and April 2021 were collected.The esophageal cancer cells KYSE30,KYSE410,KYSE150,KYSE510,TE-1,and normal human esophageal epithelial cells HET-1A were routinely cultured.Transfection reagents were used to transfect si-NC,si-WTAP#1 and si-WTAP#2 nucleic acids into KYSE150 and KYSE510 cells.The cells were divided into si-NC,si-WTAP#1 and si-WTAP#2 groups.The expressions of WTAP and MAP3K9 mRNA were detected in the cells of each group by qPCR assay.CCK-8 assay,clone formation assay,and scratch healing assay,Transwell assay were employed to detect the effects of knockdown of WTAP expression on ESCC cell proliferation,migration,invasion and apoptosis.WB assay was used to detect the expressions of WTAP,MAP3K9,EMT and MAPK pathway-related proteins in ESCC cells of each group knocked down of WTAP;immunohistochemistry to detect the expression of WTAP proteins in ESCC tissues,immunoprecipitation of methylated RNA(MeRIP)-qPCR assay to detect the level of MAP3K9 m6A in ESCC cells,actinomycin D assay to detect the stability of mRNA of MAP3K9,and database data to analyze the expression,target genes,functional enrichment,and interacting RNA of WTAP.Results:WTAP was highly expressed in ESCC tissues and cells(P<0.05 or P<0.01 or P<0.001)and correlated with the degree of differentiation(P<0.01);the expression of WTAP mRNA and its protein were successfully knocked down in KYSE150 and KYSE510 cells(P<0.01 or P<0.001);the knockdown of WTAP significantly inhibited the proliferation,migration and invasion of KYSE150 and KYSE510 cells(P<0.05 or P<0.01 or P<0.001),and promoted the apoptosis of KYSE150 and KYSE510 cells(P<0.05 or P<0.01).Knockdown of WTAP resulted in a significant decrease in the m6A level of MAP3K9(P<0.05),and its mRNA expression level and mRNA stability were both significantly reduced(P<0.05).Database data analysis showed that WTAP target genes clustered in the MAPK signaling pathway;the expression levels of MAP3K9,p-ERK,N-cadherin,and MMP9 were significantly reduced(P<0.05 or P<0.01),and the expression level of E-cadherin was significantly elevated(P<0.05 or P<0.01)in the KYSE150 and KYSE510 cells after knockdown of WTAP.Conclusions:WTAP is highly expressed in ESCC tissues and cells and correlates with their differentiation.It promotes the stability of MAP3K9 mRNA through m6A modification,activates the MAPK pathway and thus promotes the malignant biological behaviors of ESCC cells.

Objective To explore the acceptability of routine biochemical test results for serum samples with varying degrees of chylous high triglyceride(TG).Methods Blood samples of 69 patients with different degrees of lipids were collected,including 33 patients with mild to moderate lipids(1.7 mmol/L≤TG<5.6 mmol/L)and 36 patients with severe lipids(TG≥5.6 mmol/L).Twenty-nine biochemical tests were detected before and after high-speed centrifugation.The result acceptability before high speed centrifugation of serum was compared with the results after high speed centrifugation as the gold standard[TG and total cholesterol(TC)before centrifugation].The acceptable criteria were subject to the following three conditions at the same time.Firstly,correlation coefficient(R2)was greater than or equal to 0.95.Secondly,the slope of linear re-gression equation was 1.00±0.05.Thirdly,for the same index,the number of samples whose result bias be-fore and after centrifugation was less than 1/2 total allowable error(TEa)in more than 90%of the total sam-ple numbers.Results Firstly,in the mild to moderate lipemia group,22 tests met the criteria,7 tests did not,including total protein(TP),albumin(ALB),TG,aspartate aminotransferase(AST),carbon dioxide(CO2),α-L-fucosidase(AFU),lactate dehydrogenase(LDH)(bias<10%),and the coincidence rate was 75.9%.In the severe lipemia group,12 tests met the criteria,17 tests did not,including pre-albumin(PA),AFU,γ-glu-tamyltransferase(γ-GT),LDH,AST,TC,direct bilirubin(DBIL),CO2,5'-nucleotidase(5'-NT),small and low-density lipoprotein cholesterol(sd-LDL-C),high density lipoprotein cholesterol(HDL-C),low-density lipoprotein cholesterol(LDL-C),adenosine deaminase(ADA),cystatin C(CysC),glycosylated albumin(GA),total bilirubin(TBIL)(bias>10%),the coincidence rate was 41.4%,and there was a statistically sig-nificant difference in the coincidence rate between the two groups(P<0.05).Secondly,there was no statisti-cally significant difference in the acceptability of results between continuous monitoring method and endpoint method detection methods(P>0.05).Conclusion Most test results of direct determination with mild or moderate lipemia samples are acceptable,and the bias of unacceptable tests is small(<10%),so it is recom-mended to issue a test report without further sample treatment.However,due to the large number of unacceptable tests and larger bias(>10%),severe lipemia samples should be determined after high-speed centrifugation.

Objective:To explore the effect of nursing scheme based on self-regulation theory (SRT) on self-efficacy and quality of life of patients with chronic pancreatitis, and to provide basis for better promoting patients′ rehabilitation.Methods:Using a non-random historical control study, 55 patients with chronic pancreatitis admitted to The Fifth Affiliated Hospital of Southern Medical University from November 2021 to October 2022 were classified as the control group, and 55 patients with chronic pancreatitis admitted from November 2022 to October 2023 were classified as the research group. The control group received routine nursing intervention, while the research group received SRT-based nursing intervention. Both groups received a 3-month intervention. The General Self-Efficacy Scale, Exercise of Self-Care Agency Scale, Self Rated Abilities for Health Practices Scale, and Gastrointestinal Quality of Life Index were used to evaluate the self-efficacy, self-care ability, health behavior, and quality of life of two groups before and after the intervention, and statistical comparisons were made.Results:Both groups of patients completed the study. There were 28 males and 27 females in the control group. The age was (45.33 ± 12.26) years old. There were 30 males and 25 females in the research group. The age was (45.48 ± 12.61) years old. After the intervention, the score of the self-efficacy in the research group was (29.32 ± 2.88) points, which was higher than that in the control group (19.28 ± 1.95) points, the difference was significant ( t=21.41, P<0.05). The scores of self-care skills, self-responsibility, self-concept, health knowledge and the total score of the self-care ability in the research group were (35.32 ± 2.31), (22.85 ± 1.42), (25.88 ± 1.93), (64.32 ± 5.22), (148.34 ± 8.33) points respectively. They were all higher than those of the control group (28.66 ± 1.77), (17.22 ± 1.23), (18.67 ± 1.86), (60.08 ± 4.52), (124.56 ± 8.92) points. The differences were significant ( t values were 4.55-22.23, all P<0.05). The scores of exercise, nutrition, health responsibility, psychological comfort and the total score of the health behavior in the research group were (25.58 ± 1.41), (25.02 ± 2.03), (24.31 ± 2.34), (25.16 ± 1.63), (100.05 ± 7.36) points respectively. They were all higher than those of the control group (22.31 ± 2.03), (20.15 ± 2.82), (20.16 ± 2.89), (21.15 ± 2.17), (83.79 ± 7.84) points. The differences were significant ( t values were 8.28-11.21, all P<0.05). The scores of social activity, psychological state, physiological function, self-conscious symptoms and the total score of the quality of life in the research group were (16.78 ± 1.26), (17.03 ± 1.85), (22.43 ± 1.96), (17.09 ± 0.88), (73.41 ± 4.22) points respectively. They were all higher than those of the control group (15.32 ± 1.15), (15.34 ± 1.76), (20.86 ± 1.59), (16.03 ± 0.75), (67.52 ± 4.18) points. The differences were significant ( t values were 4.61-7.35, all P<0.05). Conclusions:SRT-based nursing scheme can effectively improve the self-efficacy and self-care ability of patients with chronic pancreatitis, and improve their health behavior and quality of life.

Osteoporosis is a prevalent skeletal condition characterized by reduced bone mass and strength, leading to increased fragility. Buqi-Tongluo (BQTL) decoction, a traditional Chinese medicine (TCM) prescription, has yet to be fully evaluated for its potential in treating bone diseases such as osteoporosis. To investigate the mechanism by which BQTL decoction inhibits osteoclast differentiation in vitro and validate these findings through in vivo experiments. We employed MTS assays to assess the potential proliferative or toxic effects of BQTL on bone marrow macrophages (BMMs) at various concentrations. TRAcP experiments were conducted to examine BQTL's impact on osteoclast differentiation. RT-PCR and Western blot analyses were utilized to evaluate the relative expression levels of osteoclast-specific genes and proteins under BQTL stimulation. Finally, in vivo experiments were performed using an osteoporosis model to further validate the in vitro findings. This study revealed that BQTL suppressed receptor activator of NF-κB ligand (RANKL)-induced osteoclastogenesis and osteoclast resorption activity in vitro in a dose-dependent manner without observable cytotoxicity. The inhibitory effects of BQTL on osteoclast formation and function were attributed to the downregulation of NFATc1 and c-fos activity, primarily through attenuation of the MAPK, NF-κB, and Calcineurin signaling pathways. BQTL's inhibitory capacity was further examined in vivo using an ovariectomized (OVX) rat model, demonstrating a strong protective effect against bone loss. BQTL may serve as an effective therapeutic TCM for the treatment of postmenopausal osteoporosis and the alleviation of bone loss induced by estrogen deficiency and related conditions.
Animals ; NFATC Transcription Factors/genetics* ; Drugs, Chinese Herbal/pharmacology* ; Ovariectomy ; Osteoclasts/metabolism* ; Female ; Osteogenesis/drug effects* ; Rats, Sprague-Dawley ; Rats ; NF-kappa B/genetics* ; Osteoporosis/genetics* ; Signal Transduction/drug effects* ; Bone Resorption/genetics* ; Cell Differentiation/drug effects* ; Humans ; RANK Ligand/metabolism* ; Mitogen-Activated Protein Kinases/genetics* ; Transcription Factors

Objective:To analyze the prenatal ultrasonographic features and prognosis of fetal perirenal urinoma.Methods:This retrospective study included eight fetuses with perirenal urinoma diagnosed by prenatal ultrasound in the Women and Children's Hospital of Chongqing Medical University from January 2017 to August 2023. Descriptive analysis was performed on their prenatal ultrasonographic features, intrauterine intervention measures, postnatal treatment, and prognosis.Results:Among the eight cases, the prenatal ultrasonographic diagnosis was consistent with the postnatal clinical diagnosis in seven cases, with one misdiagnosis (postnatally confirmed as giant renal cyst with multicystic dysplastic kidney). Prenatal ultrasonographic features of fetal perirenal urinoma included cystic mass adjacent to the renal capsule; obvious compression of the surrounding organs and the affected kidney; increased craniocaudal diameter of the affected kidney with thin parenchyma, increased echogenicity, indistinct corticomedullary differentiation, and pyeletasis; poorly visualized partial renal arteries; normal or mildly enlarged contralateral kidney; adequate bladder filling; normal amniotic fluid volume. Two cases underwent intrauterine cyst aspiration with subsequent cyst size reduction (slight re-enlargement during follow-up). Among the remaining six untreated cases, one case showed stable cyst size, while five cases exhibited initial significant cyst enlargement followed by stabilization or regression trend. All eight cases were born at full term (three delivered vaginally and five by cesarean section). The affected kidney was significantly atrophied within one week after birth by ultrasound observation. Impaired function of the affected kidney was shown in four patients by follow-up after discharge (including two cases of intrauterine treatment),one case abandoned treatment due to other illnesses, two cases were lost to follow-up after discharge.Conclusions:Prenatal ultrasound images of perirenal urinary cysts infetuses exhibit typical features. Intrauterine treatment can reduce the compression of large cysts and hydronephrosis on fetal organs, but there is no significant improvement in the recovery of renal function.

Modelling an Unhealthy Behaviour Index among School-Going Adolescents in Timor-Leste: A Two-Part Approach IntroductionThe burden of unhealthy behaviours in the adolescent population is a worldwide public health concern. This study develops an unhealthy behaviour index and examines its associated factors within a large sample of adolescents from Timor-Leste.MethodsThe data of 3455 adolescents from a nationally representative sample were analysed. The unhealthy behaviour index was developed based on the number of involvements in unhealthy behaviours (consumption of soft drink and fast food, low intake of fruit and vegetables, physical inactivity, smoking, alcohol drinking, illicit drug use). A two-part model was applied to assess the influences of demographic, environmental, personal and parental factors on the participation decisions of unhealthy behaviours and the unhealthy behaviour index.ResultsParental closeness was associated with participation decisions. Age, being involved in physical fights, suicide attempt and parental connectedness were correlated with unhealthy behaviour index. Bullying victimisation and truancy affected both participation and index. There were interaction effects of gender and loneliness on the unhealthy behaviour index.ConclusionsAdolescents who engage in unhealthy behaviours are more likely to be younger, be involved in physical fights, experience bullying, attempt suicide, play truant and have no parental closeness and connectedness. The specific policy recommendations include discouraging male adolescents who do not encounter loneliness as well as those in lower-secondary education from indulging in unhealthy lifestyles. Additionally, parents should collaborate with educators on monitoring adolescents’ environmental stressors, mental health condition and class attendance, and be prepared to provide support in a timely manner.

Objective:To explore the application value of three-dimensional visualization reconstruction technology in robot-assisted laparoscopic partial nephrectomy（RAPN）for the treatment of highly complex（R.E.N.A.L. score≥10）renal hilar tumors.Methods:The clinical data of 87 patients with highly complex renal hilar tumors with R.E.N.A.L. scores ≥10 who were treated in First Affiliated Hospital of Nanchang University from January 2021 to December 2024 were retrospectively analyzed，of which 36 underwent 3D visualization reconstruction and 51 underwent conventional CT. The 3D visualization reconstruction method was to import the patient’s enhanced CT images in DICOM format into the 3D reconstruction image data processing software to produce a 3D visualization model. There were 22 males and 14 females in the 3D visualization group，with an average age of（54.2 ± 9.5）years，a body mass index of（24.8 ± 4.5）kg/m 2，and a tumor size of（4.3 ± 1.0）cm. Tumors were located on the left side in 16 cases and on the right side in 20 cases. Tumor stages were classified as T 1a in 11 cases，T 1b in 21 cases，and T 2a in 4 cases. The R.E.N.A.L. scores were distributed as follows：10 points in 21 cases，11 points in 12 cases，and 12 points in 3 cases. The estimated glomerular filtration rate（eGFR）before operation was（78.2±9.6）ml/（min·1.73 m 2）. There were 35 males and 16 females in the conventional CT group，with an average age of（51.3±8.9）years，a body mass index of（25.4 ± 3.9）kg/m 2，and a tumor size of（4.1 ± 1.2）cm. Tumors were located on the left side in 25 cases and on the right side in 26 cases. Tumor stages were classified as T 1a in 12 cases，T 1b in 33 cases，and T 2a in 6 cases. The R.E.N.A.L. scores were distributed as follows：10 points in 31 cases，11 points in 18 cases，and 12 points in 2 cases . The preoperative eGFR was（80.6 ± 8.8）ml/（min·1.73 m 2）. There was no statistical difference in general data and preoperative renal function between the two groups（ P > 0.05）. Both groups underwent RAPN. The two groups were analyzed and compared in terms of operation time，warm ischemia time，intraoperative blood loss，postoperative hospital stay，postoperative complications，and changes in renal function 3 months after surgery. Results:There were no cases of conversion to radical treatment or open surgery in both the 3D visualization group and the conventional CT group. The 3D visualization group had shorter operation time［（94.6 ± 18.5）min vs.（110.2 ± 17.2）min， P < 0.001］，shorter renal artery occlusion time［（23.3 ± 4.0）min vs.（27.2 ± 3.3）min， P < 0.001］，less intraoperative blood loss［120（100，250）ml vs. 150（120，300）ml， P = 0.018］，and a lower proportion of intraoperative collecting system incision（19/36 vs. 38/51， P = 0.042）than the conventional CT group. There was no significant statistical difference in the time of postoperative drainage tube removal and postoperative hospital stay between the two groups（ P > 0.05）. One case in the 3D visualization group had postoperative fever，and two cases in the conventional CT group had postoperative obvious macroscopic hematuria. Postoperative pathological diagnosis of the patients was clear cell carcinoma in 78 cases，papillary cell carcinoma in 6 cases，chromophobe cell carcinoma in 2 cases，and oncocytoma in 1 case. No positive resection margin was found in both groups. Three months after surgery，there was no significant statistical difference in eGFR between the two groups［（70.6 ± 8.5）ml/（min·1.73 m 2）vs.（71.4 ± 9.2）ml/（min·1.73 m 2）， P = 0.681］. During the median follow-up of 17.8 months，no tumor recurrence or metastasis was observed in either group. Conclusions:RAPN has good safety and feasibility in the treatment of highly complex（R.E.N.A.L. score ≥10）renal hilar tumors. Preoperative three-dimensional visualization reconstruction technology helps to reduce RAPN operation time，renal artery occlusion time and intraoperative blood loss，and has good clinical application value.