AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo investigate the effect of Naoqingtong decoction （NQT） on the kidney damage and the inflammatory factors NOD-like receptor protein 3 （NLRP3）， apoptosis-associated speck-like protein containing a C-terminal caspase recruitment domain （ASC）， cysteinyl aspartate-specific proteinase-1 （Caspase-1）， interleukin-6 （IL-6）， and tumor necrosis factor-α （TNF-α） in spontaneously hypertensive rats （SHRs）. MethodsTwenty-four SHRs were randomized into a model group， a low-dose （12.9 g·kg^-1·d^-1） NQT （NQT-L） group， a high-dose （25.8 g·kg^-1·d^-1） NQT group （NQT-H）， and a captopril （CTP， 20 mg·kg^-1·d^-1） group， with 6 rats in each group. In addition， 6 homozygous male Wistar-Kyoto rats were used as the control group. The control and model groups were administrated with the same amount of normal saline by gavage for 8 weeks. General behaviors of rats were observed during the intervention period， and the blood pressure was measured periodically. At the end of intervention， the body mass was weighed， and both kidneys were collected and weighed for the calculation of the renal index. Hematoxylin-eosin staining was performed to observe the pathological changes in the kidney tissue. Real-time fluorescence quantitative polymerase chain reaction （Real-time PCR） and Western blot were employed to determine the expression levels of NLRP3， ASC， Caspase-1， IL-6， and TNF-α in the kidney tissue. ResultsDuring the experiment period， the control group had normal mental status， food intake， and activity， while the model group showed thinning of hair， loss of luster， reduced activity， loss of appetite， fecal adhesion， and irritability， and some of the skin had scratches or blood scabs. The above symptoms were alleviated to different degrees after 8 weeks of NQT administration. An intelligent non-invasive sphygmomanometer was used to measure the tail artery pressure of rats， which showed that the systolic and diastolic blood pressure of rats in the model group was higher than that in the control group （P<0.01）. Compared with the model group， drug interventions lowered the systolic and diastolic blood pressure （P<0.05， P<0.01）. Compared with the control group， the model group showed severe pathological damage in the kidney tissue， which was alleviated in each drug intervention group. Compared with the control group， the model group showed up-regulated expression levels of NLRP3， ASC， Caspase-1， IL-6， and TNF-α in the kidney tissue （P<0.05， P<0.01）. Compared with the model group， the drug intervention groups showed down-regulated expression levels of NLRP3， ASC， Caspase-1， IL-6， and TNF-α in the kidney tissue （P<0.05， P<0.01）. ConclusionNQT can lower the blood pressure in SHRs by inhibiting the activation of NLRP3 inflammasomes， suppressing renal inflammation， and ameliorating hypertensive kidney damage.

Surgical treatment is one of the key approaches for non-small cell lung cancer (NSCLC). Regular postoperative follow-up is crucial for early detection and timely management of tumor recurrence, metastasis, or second primary tumors. A scientifically sound and reasonable follow-up strategy not only extends patient survival but also significantly improves quality of life, thereby enhancing overall prognosis. This consensus aims to build upon the previous version by incorporating the latest clinical research advancements and refining postoperative follow-up protocols for early-stage NSCLC patients based on different treatment modalities. It provides a scientific and practical reference for clinicians involved in the postoperative follow-up management of NSCLC. By optimizing follow-up strategies, this consensus seeks to promote the standardization and normalization of lung cancer diagnosis and treatment in China, helping more patients receive high-quality care and long-term management. Additionally, the release of this consensus is expected to provide insights for related research and clinical practice both domestically and internationally, driving continuous development and innovation in the field of postoperative management for NSCLC.

Cardiovascular diseases （CVD），a group of common diseases in clinical practice，are witnessing a steady rise in both incidence and mortality rates，posing a challenge to public health. Gualou Xiebai Banxiatang，originating from Synopsis of the Golden Chamber （《金匮要略》），was initially used to treat severe cases of chest impediment. The formula consists of Trichosanthis Fructus，Allii Macrostemonis Bulbus，Pinelliae Rhizoma，and Baijiu. It has a wide range of clinical applications，with therapeutic effects including moving Qi to relieve depression，activating Yang to dissipate mass，and expelling phlegm to alleviate chest congestion. In recent years，clinical research has confirmed that Gualou Xiebai Banxiatang，with or without modification，used alone or in combination with Western medicine，has definite effects in the treatment of CVD such as hyperlipidemia，coronary atherosclerotic heart disease，hypertension，heart failure，and arrhythmia. It can alleviate disease symptoms and reduce the risk of re-hospitalization. Basic research indicates that the mechanisms of Gualou Xiebai Banxiatang include improving endothelial functions，exhibiting anti-inflammatory properties，countering oxidative stress，preventing apoptosis，inhibiting ventricular remodeling，regulating mitochondrial functions，improving hemorheology，and modulating autophagy and neurotransmitters. This article reviews relevant articles in recent years with focuses on the compatibility，clinical application，and mechanism of Gualou Xiebai Banxiatang. This review is expected to provide a theoretical basis for the mechanism research and clinical application of this formula in treating CVD and to offer ideas and reference for in-depth research.

Objective To explore the effects of different education and examination methods on the examination results during the screening/evaluation of patent foramen ovale by contrast-enhanced transcranial Doppler(cTCD).Methods Patients who underwent cTCD screening/evaluation for patent foramen ovale in our hospital from May 2023 to February 2024 were retrospectively selected as the research subjects.The patients were divided into the observation group and the control group according to different education and examination methods during the peri-examination period.Patients who received video education,modified Valsalva maneuver,and injection of contrast agent with 20 mL syringe were included into the observation group,and patients who received artificial education,Valsalva maneuver,and injection of contrast agent with 10 mL syringe were included into the control group.The positive detection rate of patent foramen ovale,right-to-left shunt microbubble grading during Valsalva/modified Valsalva maneuver,systolic blood flow velocity,pulsatility index(PI),resistive index(RI),examination duration,total physician-patient communication time,whether occlusion surgery was performed,and patient satisfaction were compared between the two groups.Results The positive detection rate of patent foramen ovale by cTCD(82.93%vs.95.92%),the detection rate of the maximum amout(grade Ⅲ)of microbubbles(39.02%vs.61.22%),the total physician-patient communication time during the peri-examination period[11.30(10.00,14.00)minutes vs.8.23(7.00,10.00)minutes],the rate of occlusion surgery(48.78%vs.73.47%),and the total patient satisfaction(80.49%vs.91.84%)showed statistically significant differences between the control group and the observation group(P<0.05).Additionally,the receiver operating characteristic(ROC)curve analysis showed that the area under the curve(AUC)for diagnosing patent foramen ovale were 0.718 in the control group and 0.855 in the observation group.Conclusion Peri-examination interventions such as video education,modified Valsalva maneuver,and injection of contrast agent with 20 mL syringe can improve the positive detection rate of patent foramen ovale,reduce ineffective physician-patient communication,and improve patient satisfaction.

Objective:To explore the independent risk factors for uremic encephalopathy(UE)in maintenance hemodialysis(MHD)patients and provide evidence for early clinical warning and intervention.Methods:A case-control study was conducted,enrolling 67 MHD patients diagnosed with UE(UE group)at Laibin People's Hospital from January 2010 to December 2024,and 67 non-UE patients during the same period(control group).Demographic characteristics,dialysis parameters,laboratory indicators,and infection events were collected.Univariate and multivariate logistic regression analyses were used to identify independent risk factors for UE.Results:The UE group had significantly higher rates of infection(58.2％vs.29.9％),serum creatinine(789 vs.702 μmol/L),and iPTH levels(568 vs.385 pg/mL)compared to the control group(P＜0.05).Multivariate analysis revealed that concurrent infection(OR=3.022,95％CI:1.312-6.958),elevated serum creatinine(OR=1.004,95％CI:1.000-1.008),and elevated iPTH(OR=1.002,95％CI:1.001-1.003)were independent risk factors for UE(P＜0.05).The combined prediction model achieved an AUC of 0.878(95％CI:0.822-0.934),with 82.1％sensitivity and 80.6％specificity.Conclusion:Infection,elevated serum creatinine,and elevated iPTH significantly increase the risk of UE in MHD patients.Clinical management should emphasize infection prevention,toxin clearance optimization,and parathyroid function regulation to reduce UE incidence.

Objective To analyze the medication law and compatibility characteristics of TCM compounds for the treatment of myocardial infarction in the national patent database.Methods TCM compounds for treating myocardial infarction were retrieved from CNIPA patent publication website.A prescription database was built using Excel 2019 software to statistically analyze the frequency of medicinal use and their properties,taste and meridian tropism;SPSS Modeler 18.0 software was used to analyze the association rules of drugs;a network of Chinese materia medica co-occurrence was constructed using Cytoscape 3.10.0,and systematic clustering analysis was performed on the Chinese materia medica in the core network.Results A total of 146 patents of TCM compounds were included,involved 440 kinds of Chinese materia medica.High frequency drugs included Salviea Miltiorrhizae Radix et Rhizoma,Chuanxiong Rhizoma,Angelicae Sinensis Radix,Glycyrrhizae Radix et Rhizoma,etc.The main property was warm,the main tastes were bitter,sweet and pungent,and the medicines mostly belongs to the liver meridian,heart meridian and spleen meridians.Commonly used medicinal pairs included Angelicae Sinensis Radix-Chuanxiong Rhizoma,Astragali Radix-Salviea Miltiorrhizae Radix et Rhizoma,Paeoniae Radix Rubra-Angelicae Sinensis Radix,etc.Commonly used tripartite combinations included Paeoniae Radix Rubra-Chuanxiong Rhizoma-Angelicae Sinensis Radix,Carthami Flos-Angelicae Sinensis Radix-Chuanxiong Rhizoma,Carthami Flos-Chuanxiong Rhizoma-Angelicae Sinensis Radix,etc.Clustering analysis showed four types of combinations.Conclusion TCM compound patents for the treatment of myocardial infarction is based on promoting blood circulation,removing blood stasis,and relieving pain,while also using methods such as eliminating phlegm,tonifying qi,warming yang,and nourishing yin.It can provide references for clinical medication.

Objective:To explore the effect of nursing scheme based on self-regulation theory (SRT) on self-efficacy and quality of life of patients with chronic pancreatitis, and to provide basis for better promoting patients′ rehabilitation.Methods:Using a non-random historical control study, 55 patients with chronic pancreatitis admitted to The Fifth Affiliated Hospital of Southern Medical University from November 2021 to October 2022 were classified as the control group, and 55 patients with chronic pancreatitis admitted from November 2022 to October 2023 were classified as the research group. The control group received routine nursing intervention, while the research group received SRT-based nursing intervention. Both groups received a 3-month intervention. The General Self-Efficacy Scale, Exercise of Self-Care Agency Scale, Self Rated Abilities for Health Practices Scale, and Gastrointestinal Quality of Life Index were used to evaluate the self-efficacy, self-care ability, health behavior, and quality of life of two groups before and after the intervention, and statistical comparisons were made.Results:Both groups of patients completed the study. There were 28 males and 27 females in the control group. The age was (45.33 ± 12.26) years old. There were 30 males and 25 females in the research group. The age was (45.48 ± 12.61) years old. After the intervention, the score of the self-efficacy in the research group was (29.32 ± 2.88) points, which was higher than that in the control group (19.28 ± 1.95) points, the difference was significant ( t=21.41, P<0.05). The scores of self-care skills, self-responsibility, self-concept, health knowledge and the total score of the self-care ability in the research group were (35.32 ± 2.31), (22.85 ± 1.42), (25.88 ± 1.93), (64.32 ± 5.22), (148.34 ± 8.33) points respectively. They were all higher than those of the control group (28.66 ± 1.77), (17.22 ± 1.23), (18.67 ± 1.86), (60.08 ± 4.52), (124.56 ± 8.92) points. The differences were significant ( t values were 4.55-22.23, all P<0.05). The scores of exercise, nutrition, health responsibility, psychological comfort and the total score of the health behavior in the research group were (25.58 ± 1.41), (25.02 ± 2.03), (24.31 ± 2.34), (25.16 ± 1.63), (100.05 ± 7.36) points respectively. They were all higher than those of the control group (22.31 ± 2.03), (20.15 ± 2.82), (20.16 ± 2.89), (21.15 ± 2.17), (83.79 ± 7.84) points. The differences were significant ( t values were 8.28-11.21, all P<0.05). The scores of social activity, psychological state, physiological function, self-conscious symptoms and the total score of the quality of life in the research group were (16.78 ± 1.26), (17.03 ± 1.85), (22.43 ± 1.96), (17.09 ± 0.88), (73.41 ± 4.22) points respectively. They were all higher than those of the control group (15.32 ± 1.15), (15.34 ± 1.76), (20.86 ± 1.59), (16.03 ± 0.75), (67.52 ± 4.18) points. The differences were significant ( t values were 4.61-7.35, all P<0.05). Conclusions:SRT-based nursing scheme can effectively improve the self-efficacy and self-care ability of patients with chronic pancreatitis, and improve their health behavior and quality of life.

Objective To analyze the medication law and compatibility characteristics of TCM compounds for the treatment of myocardial infarction in the national patent database.Methods TCM compounds for treating myocardial infarction were retrieved from CNIPA patent publication website.A prescription database was built using Excel 2019 software to statistically analyze the frequency of medicinal use and their properties,taste and meridian tropism;SPSS Modeler 18.0 software was used to analyze the association rules of drugs;a network of Chinese materia medica co-occurrence was constructed using Cytoscape 3.10.0,and systematic clustering analysis was performed on the Chinese materia medica in the core network.Results A total of 146 patents of TCM compounds were included,involved 440 kinds of Chinese materia medica.High frequency drugs included Salviea Miltiorrhizae Radix et Rhizoma,Chuanxiong Rhizoma,Angelicae Sinensis Radix,Glycyrrhizae Radix et Rhizoma,etc.The main property was warm,the main tastes were bitter,sweet and pungent,and the medicines mostly belongs to the liver meridian,heart meridian and spleen meridians.Commonly used medicinal pairs included Angelicae Sinensis Radix-Chuanxiong Rhizoma,Astragali Radix-Salviea Miltiorrhizae Radix et Rhizoma,Paeoniae Radix Rubra-Angelicae Sinensis Radix,etc.Commonly used tripartite combinations included Paeoniae Radix Rubra-Chuanxiong Rhizoma-Angelicae Sinensis Radix,Carthami Flos-Angelicae Sinensis Radix-Chuanxiong Rhizoma,Carthami Flos-Chuanxiong Rhizoma-Angelicae Sinensis Radix,etc.Clustering analysis showed four types of combinations.Conclusion TCM compound patents for the treatment of myocardial infarction is based on promoting blood circulation,removing blood stasis,and relieving pain,while also using methods such as eliminating phlegm,tonifying qi,warming yang,and nourishing yin.It can provide references for clinical medication.

Objective:To investigate the effects and molecular mechanisms of Wilms tumor 1-associated proteins(WTAP)on the cell biological properties of esophageal squamous cell carcinoma(ESCC)cells.Methods:31 pairs of ESCC tissues and their paired paracancerous tissues that were surgically resected at the Second Clinical Medical College of Chuanbei Medical College between September 2019 and April 2021 were collected.The esophageal cancer cells KYSE30,KYSE410,KYSE150,KYSE510,TE-1,and normal human esophageal epithelial cells HET-1A were routinely cultured.Transfection reagents were used to transfect si-NC,si-WTAP#1 and si-WTAP#2 nucleic acids into KYSE150 and KYSE510 cells.The cells were divided into si-NC,si-WTAP#1 and si-WTAP#2 groups.The expressions of WTAP and MAP3K9 mRNA were detected in the cells of each group by qPCR assay.CCK-8 assay,clone formation assay,and scratch healing assay,Transwell assay were employed to detect the effects of knockdown of WTAP expression on ESCC cell proliferation,migration,invasion and apoptosis.WB assay was used to detect the expressions of WTAP,MAP3K9,EMT and MAPK pathway-related proteins in ESCC cells of each group knocked down of WTAP;immunohistochemistry to detect the expression of WTAP proteins in ESCC tissues,immunoprecipitation of methylated RNA(MeRIP)-qPCR assay to detect the level of MAP3K9 m6A in ESCC cells,actinomycin D assay to detect the stability of mRNA of MAP3K9,and database data to analyze the expression,target genes,functional enrichment,and interacting RNA of WTAP.Results:WTAP was highly expressed in ESCC tissues and cells(P<0.05 or P<0.01 or P<0.001)and correlated with the degree of differentiation(P<0.01);the expression of WTAP mRNA and its protein were successfully knocked down in KYSE150 and KYSE510 cells(P<0.01 or P<0.001);the knockdown of WTAP significantly inhibited the proliferation,migration and invasion of KYSE150 and KYSE510 cells(P<0.05 or P<0.01 or P<0.001),and promoted the apoptosis of KYSE150 and KYSE510 cells(P<0.05 or P<0.01).Knockdown of WTAP resulted in a significant decrease in the m6A level of MAP3K9(P<0.05),and its mRNA expression level and mRNA stability were both significantly reduced(P<0.05).Database data analysis showed that WTAP target genes clustered in the MAPK signaling pathway;the expression levels of MAP3K9,p-ERK,N-cadherin,and MMP9 were significantly reduced(P<0.05 or P<0.01),and the expression level of E-cadherin was significantly elevated(P<0.05 or P<0.01)in the KYSE150 and KYSE510 cells after knockdown of WTAP.Conclusions:WTAP is highly expressed in ESCC tissues and cells and correlates with their differentiation.It promotes the stability of MAP3K9 mRNA through m6A modification,activates the MAPK pathway and thus promotes the malignant biological behaviors of ESCC cells.