AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective:To explore the clinical characteristics, diagnosis and treatment strategies, and prognosis of pulmonary embolism (PE) complicating childhood rheumatic diseases.Methods:A retrospective case series study was performed on the demographic data, laboratory indicators, imaging features, treatment regimens, and follow-up data of 8 children with rheumatic diseases complicated by PE who were admitted to the Department of Rheumatology and Immunology, Capital Center for Children′s Health, Capital Medical University from January 2014 to October 2023.Results:Among the 8 children, there were 4 boys and 4 girls, with an age of 12.0 (7.5, 13.0) years. Among the primary diseases, there were 3 cases of systemic lupus erythematosus, 2 cases of Beh?et′s disease, 2 cases of Takayasu arteritis, and 1 case of antiphospholipid syndrome. All children developed PE during the active phase of the primary disease. PE was detected at the onset of the primary disease in 3 cases, and the median time from the diagnosis of the primary disease to the development of PE was 10.0 (6.0, 25.0) months in the remaining 5 cases. Fever was present in all 8 children, 4 cases were accompanied by chest tightness, dyspnea, etc., and 2 cases only presented with fever. Laboratory examinations revealed the following results: erythrocyte sedimentation rate was 42.0 (17.0, 78.0) mm/1 h, high-sensitivity C-reactive protein was 12.7 (2.6, 78.7) mg/L, white blood cell count was 9.6 (7.2, 18.7)×10 9/L; D-dimer was 2.3 (0.9, 6.2) mg/L; and hemoglobin was (109±16) g/L.Imaging examinations revealed that 5 cases had involvement of the bilateral lower pulmonary arteries, 5 cases had peripheral embolism, and 3 cases had central PE. Complications included 3 cases of deep vein thrombosis, 2 cases of intracranial venous sinus thrombosis, and 1 case of mild pulmonary hypertension.In terms of treatment, 7 cases received anticoagulation with heparin followed by warfarin. Immunomodulation was mainly based on glucocorticoids combined with immunosuppressants, and 4 cases were combined with biological agents. The follow-up time of 4.17 (1.75, 7.17) years, the time for complete absorption of PE was 10.5 (6.0, 18.0) months; all 8 children had no target events, with no recurrence or chronic thromboembolic pulmonary hypertension, and the pulmonary artery remodeling was good. Conclusions:PE complicating childhood rheumatic diseases is closely related to the activity of the primary disease. The clinical manifestations are insidious, with fever as the main symptom. Imaging examination is the key to diagnosis.Early adoption of heparin followed by warfarin anticoagulation and glucocorticoids combined with immunosuppressants and (or) biological agents to control the primary disease can achieve a favorable prognosis.

OBJECTIVE To form an expert consensus on the clinical application of parenteral direct thrombin inhibitors （DTIs） in patients during the perioperative period. METHODS Led by Sichuan Academy of Medical Sciences & Sichuan Provincial People’s Hospital （the Affiliated Hospital of UESTC）， a multidisciplinary working group was established. Through literature review and the Delphi method， clinical questions related to the rational perioperative use of parenteral DTIs were identified. A structured design was adopted using the “Population-Intervention-Comparison-Outcome” framework； systematic searches were conducted in CNKI， Medline， Embase and other databases. Relevant evidence from randomized controlled trials and cohort studies was included and synthesized. Evidence quality was assessed using the Grades of Recommendations Assessment，Development and Evaluation （GRADE） approach， and recommendations were formulated through multiple rounds of Delphi surveys and expert consensus meetings. RESULTS &CONCLUSIONS Seven recommendations （each with an expert consensus rate exceeding 90%） on the use of parenteral DTIs in perioperative patients were developed. These recommendations specify drug selection， dosing ranges， key monitoring points， and safety management strategies for parenteral DTIs in various scenarios， including the perioperative period of ventricular assist device implantation， the perioperative period of cardiac surgery， perioperative patients with lower-extremity atherosclerotic disease， the perioperative period of percutaneous coronary intervention in patients with acute coronary syndrome， the perioperative period of carotid artery stenting in patients with carotid stenosis， the perioperative period of patients with right heart thrombosis， and patients who develop related thrombosis and dysfunction after a central venous catheter insertion. In addition， warning and management pathways for perioperative bleeding and thrombotic events were proposed. This expert consensus， which is formulated based on the best available evidence， provides evidence-based guidance for standardized and individualized use of parenteral DTIs in perioperative period.

Background Work-related musculoskeletal disorders (WMSDs) are a major occupational health concern, particularly among workers exposed to adverse ergonomic conditions. Manganese production involves heavy physical demands, yet research on WMSDs among manganese workers remains limited. Objective To investigate the prevalence and influencing factors of WMSDs among manganese workers in a manganese enterprise in Guangxi. Methods A cross-sectional survey was conducted from May to June 2024 on workers at a manganese factory in Guangxi. The Chinese Musculoskeletal Disorders Questionnaire was used to collect information on demographic characteristics, distribution of musculoskeletal symptoms, and work-related exposures. χ² test was applied to compare differences in positive WMSDs rates across groups, and logistic regression analysis was performed to identify associated factors. Results A total of 1476 workers were enrolled in the study after pre-determined inclusion and exclusion criteria. The overall prevalence of WMSDs was 34.15%. The most commonly affected body regions were the lower back (17.28%), neck (16.67%), and shoulders (13.82%). The results of logistic regression analysis indicated that female, older age, and education level of college or above were associated with a higher risk of WMSDs (P<0.05). Awkward working postures were significantly associated with WMSDs in corresponding body regions; in particular, awkward postures of the neck, upper limbs, trunk, and lower limbs were related to an increased risk of WMSDs in multiple body sites (P<0.05). In addition, poor lighting conditions, high workplace temperature, frequent or sustained arm support during work, and high job demands were associated with an increased risk of overall or site-specific WMSDs (P<0.05). Conclusion The high prevalence of WMSDs among manganese workers is closely associated with demographic characteristics, working postures, and work environment and organizational factors. Targeted ergonomic interventions focusing on high-risk body regions and key ergonomic exposures are warranted to reduce the risk of WMSDs among manganese workers.

ObjectivePost-ischemic acute inflammation and the subsequent persistent dysregulation of the immune microenvironment represent major pathological drivers that aggravate neuronal injury and severely restrict functional recovery following ischemic stroke. Although current reperfusion therapies partially restore blood flow, they fail to effectively modulate the secondary inflammatory cascade and oxidative stress, which remain critical barriers to neurological restoration. To address this challenge, this study aimed to engineer and systematically evaluate a biomimetic nanosystem composed of transforming growth factor-β1 (TGF-β1)-loaded platelet membrane-camouflaged lipid nanoparticles (PLP). This nanosystem was designed to achieve dual lesion-targeted delivery and immune microenvironment remodeling. By verifying its spatiotemporal accumulation, anti-inflammatory activity, and neuroprotective efficacy, we sought to establish an integrated therapeutic strategy that simultaneously enables lesion targeting, immune regulation, and functional recovery after ischemic injury. MethodsThe physicochemical properties of PLP, including hydrodynamic particle size, zeta potential, structural stability, and morphology, were characterized using dynamic light scattering, zeta potential analysis, and transmission electron microscopy. The preservation of platelet membrane-derived adhesion and immunoregulatory proteins was confirmed by SDS-PAGE through comparative analysis of protein band profiles between PLP and native platelet membranes. The in vitro biological activities of PLP were evaluated using two complementary cellular models. LPS-induced M1-polarized RAW264.7 macrophages were employed to assess inflammatory modulation, while oxygen glucose deprivation/reperfusion (OGD/R)-induced BV2 microglial cells and SH-SY5Y neuronal cells were utilized to investigate neuroinflammatory regulation and neuronal protection. For in vivo validation, a transient middle cerebral artery occlusion (tMCAO) mouse model was established to mimic ischemia-reperfusion injury. The spatiotemporal biodistribution and lesion-targeting capability of the PLP were monitored through live fluorescence imaging. Therapeutic efficacy was comprehensively evaluated by triphenyltetrazolium chloride (TTC) staining, glial fibrillary acidic protein (GFAP) immunofluorescence analysis, body weight monitoring, and neurological severity score (NSS) assessment. ResultsPLP nanoparticles displayed a uniform spherical morphology, nanoscale particle size distribution, and stable negative surface charge, indicating favorable colloidal stability and circulation potential. SDS-PAGE results confirmed the effective retention of key platelet membrane proteins associated with endothelial adhesion, immune evasion, and inflammatory regulation, demonstrating the successful biomimetic construction. Optimal therapeutic concentrations were determined in OGD/R-induced BV2 cells, where PLP exhibited excellent cytocompatibility and anti-inflammatory activity.In vitro experiments demonstrated that PLP significantly inhibited the polarization of RAW264.7 macrophages toward the pro-inflammatory M1 phenotype and markedly reduced neuronal apoptosis under ischemia-reperfusion conditions. In vivo fluorescence imaging revealed that PLP rapidly accumulated in the ischemic brain hemisphere and maintained prolonged retention for up to 7 d, suggesting enhanced lesion-specific targeting and sustained drug release. Compared with control group, PLP treatment significantly reduced cerebral infarct volume, attenuated reactive astrogliosis, improved weight recovery, and accelerated neurological functional restoration, as reflected by significantly improved NSS scores. ConclusionThis study establishes a multifunctional biomimetic nanoplatform that integrates platelet membrane-mediated active targeting with the anti-inflammatory, antioxidative, and neuroprotective properties of TGF-β1. The PLP system enables rapid lesion homing and long-term retention while synergistically regulating the post-stroke inflammatory microenvironment by suppressing pro-inflammatory immune activation, reducing neuronal apoptosis, and limiting excessive astrocyte reactivity. Importantly, this study proposes a conceptually therapeutic paradigm that combines targeted delivery with immune microenvironment remodeling to achieve comprehensive neurovascular protection. These findings provide strong experimental evidence supporting the translational potential of biomimetic nanotherapeutics as next-generation precision interventions for ischemic stroke.

ObjectiveDonkey hide is the sole legally designated raw material for the preparation of the traditional Chinese medicine Ejiao. The quality stability of donkey hide during preservation directly determines the efficacy and safety of Ejiao. This study focuses on the dynamic succession of microbial communities during the preservation of donkey hides from different origins, aiming to clarify the correlation between microbial biodiversity difference and the degradation profiles of hide collagen and critical biochemical components, thereby providing a theoretical foundation for developing targeted preservation strategies based on microbial regulation. MethodsDonkey hides originating from four different regions were subjected to an accelerated microbial aging assay to simulate the spoilage process. The microbial community succession was analyzed using high-throughput sequencing. Microstructure changes and pore structure characteristics were assessed by scanning electron microscopy and mercury intrusion porosimetry, respectively. Additionally, the content of major components, including lipids, proteins, and sugars were determined by biochemical methods. ResultsAfter 96 h of aging, the collagen fiber structure in Africa donkey hides (ADH) exhibited significant degradation and collapse, followed by Xinjiang donkey hides (XDH). Instead, the microstructure of Dong’e black donkey hides (DDH) and Peru donkey hides (PDH) remained relatively intact. The porosities of DDH, XDH, PDH, and ADH increased from 27.9%, 15.7%, 30.3%, and 46.2% to 36.5%, 52.6%, 42.8%, and 57.7%, respectively, during the aging process, which suggested that the originally compact fiber structure was disrupted by microbial aging. Fourier transform infrared spectrometer analysis revealed the amide bands in XDH exhibited relatively weak intensity, and no collagen amide I band was observed in ADH. Meanwhile, the lipid and protein contents decreased in all four types of donkey hides, indicating that these components served as the primary nutrient sources for the growth of microorganism. Notably, the most severe collagen degradation was observed in XDH and ADH. A substantial increase was detected in the total soluble sugar in PDH aging solution and hydroxyproline in the ADH aging solution, respectively. These results indicated that donkey hides exhibit distinct patterns of structural degradation and nutrient utilization. Furthermore, the viable cells number of donkey hides increased sharply after 48 h of aging. Metagenomic analysis revealed that the relative abundance of Euryarchaeota in ADH, PDH and XDH declining from initial 93.19%, 97.73% and 30.08% to 0.79%, 1.43% and 0.02% after 96 h, respectively. Conversely, a significantly increase was observed in the abundance of Bacillota, with a marked increase in ADH, peaking at 92.75%. Additionally, the abundance of Pseudomonadota in PDH increased from 0.10% to 87.84%, suggesting that Bacillota and Pseudomonadota may be key factors exacerbating donkey hide spoilage. Unlike the other three types of donkey hides, the dominant bacterial phylum in DDH shifted from Pseudomonadota to Bacteroidota, characterized by a substantial abundance increase of Bacteroidota from 0.13% to 44.22%. ConclusionRegional variation in origin significantly influence the microbial aging of donkey hides, leading to distinct patterns of structural deterioration and differential nutrient utilization. Therefore, implementing origin-specific preservation strategies, through the precisely controlling environmental factors to suppress harmful phyla such as Bacillota and Pseudomonadota, is crucial for enhancing the storage quality of donkey hides.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

Objective: To explore a simple, effective, and safe method for excluding false positives and identifying infections by comprehensively evaluating blood donors with reactive HIV screening results, thereby providing a basis for developing management strategies for such donors. Methods: HIV testing data of blood donors from our laboratory from January 2022 to December 2024 were collected. The results of ELISA and nucleic acid testing (NAT) were combined with confirmatory results from the CDC and analyzed. Results: A total of 605 929 samples were tested for HIV over the three-year period, with 682 reactive samples (reactive rate: 11.25 per 10 000). All were sent to the CDC for Western blot (WB) confirmation, resulting in 53 confirmed positives ((confirmed positive rate: 7.77%). Among these, 619 samples showed isolated HIV Ag&Ab reactivity with non-reactive NAT (HIV Ag&Ab+-&HIV RNA or NAT NR), with a confirmed infection rate of 0%; 9 samples showed dual HIV Ag&Ab reactivity with non-reactive NAT (HIV Ag&Ab++&HIV RNA NR or NAT NR), also with 0% confirmed infection; 52 samples showed dual HIV Ag&Ab reactivity and reactive NAT (HIV Ag&Ab++&HIV RNA R or NAT R), all confirmed as positive (100% infection rate); and 2 HIV Ag&Ab dual-reactive samples without NAT detection were also confirmed infected (100%). For all four HIV Ag&Ab assays, the S/CO values in the true positive group with dual reactivity were significantly higher than those in the false-positive groups (P<0.05). The S/CO distributions for both single-reactive false positives and dual-reactive false positives were narrow, with the upper box (Q3, 75th percentile) below optimal cutoff values in all cases (The optimal cutoff values for the four reagents were 5.00, 11.67, 8.50, and 20.90, respectively). Conclusion: Blood donors with positive NAT results in HIV blood screening are permanently deferred. Donors with dual positive HIV Ag&Ab but negative NAT results are classified and managed based on the S/CO values of HIV Ag&Ab and the optimal screening thresholds. Donors with single positive HIV Ag&Ab but negative NAT results are placed under evaluation status and retain their eligibility to donate blood. Optimizing the management measures for blood donors and establishing a scientific stratified management and assessment mechanism can effectively maintain the stability of the blood donor team.

Dry eye disease(DED)and depression(DEP), though anatomically and clinically distinct, show significant epidemiological, pathophysiological, and prognostic interplay. Their co-occurrence has risen sharply in recent years, yet the mechanisms driving this comorbidity remain under-investigated. This review systematically synthesizes current evidence, highlighting that pro-inflammatory cytokines, neuro-regulatory imbalance, mitochondrial dysfunction, and gut-microbiota dysbiosis constitute a shared molecular network, while sleep deprivation and antidepressant use further amplify the vicious cycle. By identifying limitations in existing studies, this review proposes future research directions to offer new theoretical and clinical insights for managing DED-DEP comorbidity.