AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Surgical treatment is one of the key approaches for non-small cell lung cancer (NSCLC). Regular postoperative follow-up is crucial for early detection and timely management of tumor recurrence, metastasis, or second primary tumors. A scientifically sound and reasonable follow-up strategy not only extends patient survival but also significantly improves quality of life, thereby enhancing overall prognosis. This consensus aims to build upon the previous version by incorporating the latest clinical research advancements and refining postoperative follow-up protocols for early-stage NSCLC patients based on different treatment modalities. It provides a scientific and practical reference for clinicians involved in the postoperative follow-up management of NSCLC. By optimizing follow-up strategies, this consensus seeks to promote the standardization and normalization of lung cancer diagnosis and treatment in China, helping more patients receive high-quality care and long-term management. Additionally, the release of this consensus is expected to provide insights for related research and clinical practice both domestically and internationally, driving continuous development and innovation in the field of postoperative management for NSCLC.

BACKGROUND:Cervical disc herniation can cause pain in the neck and shoulder area,as well as radiating pain in the upper limbs.The incidence rate is increasing year by year and tends to affect younger individuals.Fully understanding the biomechanical characteristics of the cervical spine in adolescents is of great significance for preventing and delaying the onset of cervical disc herniation in this age group. OBJECTIVE:To reconstruct cervical spine models for both healthy adolescents and adolescent patients with cervical disc herniation utilizing finite element analysis techniques,to analyze the motion range of the C1-T1 cervical vertebrae as well as the biomechanical characteristics of the annulus fibrosus,nucleus pulposus,endplates,and the cartilage of the small joints. METHODS:A normal adolescent's cervical spine and an adolescent patient with cervical disc herniation were selected in this study.The continuous scan cervical spine CT raw image data were imported into Mimics 21.0 in DICOM format.The C1-T1 vertebrae were reconstructed separately.Subsequently,the established models were imported into the 3-Matic software for disc reconstruction.The perfected models were then imported into Hypermesh software for meshing of the vertebrae,nucleus pulposus,annulus fibrosus,and ligaments,creating valid geometric models.After assigning material properties,the final models were imported into ABAQUS software to observe the joint motion range of the C1-C7 cervical vertebrae segments under different conditions,and to analyze the biomechanical characteristics of the annulus fibrosus,nucleus pulposus,endplates,and small joint cartilage of each cervical spine segment. RESULTS AND CONCLUSION:(1)In six different conditions,the joint motion range of the C1 vertebra in the cervical spine models of both normal adolescent and adolescent patient with cervical disc herniation was higher than that of the other vertebrae.Additionally,the joint motion range of each cervical spine segment in normal adolescent was greater than that in adolescent patient with cervical disc herniation.(2)In the cervical spine model of normal adolescent,the maximum stress values in the annulus fibrosus and nucleus pulposus were found on the left side during C2-3 flexion conditions(0.43 MPa and 0.17 MPa,respectively).In the cervical spine model of adolescent patient with cervical disc herniation,the maximum stress values were found on the left side during C7-T1 flexion conditions(0.54 MPa and 0.18 MPa,respectively).(3)In the cervical spine model of normal adolescent,the maximum stress value on the endplate was found on the left side of the upper endplate of C3 during flexion conditions(1.46 MPa).In the model of adolescent patient with cervical disc herniation,the maximum stress value on the endplate was found on the left side of the lower endplate of C7 during flexion conditions(1.32 MPa).(4)In the cervical spine model of normal adolescent,the maximum stress value in the small joint cartilage was found in the C2-3 left rotation conditions(0.98 MPa).In adolescent patient with cervical disc herniation,the stress in the small joint cartilage significantly increased under different conditions,especially in C1-2,with the maximum stress found during left flexion(3.50 MPa).(5)It is concluded that compared to normal adolescent,adolescent patient with cervical disc herniation exhibits altered cervical curvature and a decrease in overall joint motion range in the cervical spine.In adolescent with cervical disc herniation,there is a significant increase in stress on the annulus fibrosus,nucleus pulposus,and endplates in the C7-T1 segment.The stress on the left articular cartilage of the C1-2 is notable.Abnormal cervical curvature may be the primary factor causing these stress changes.

With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.

Neoadjuvant therapy has become the standard treatment for locally advanced resectable esophageal cancer, significantly improving long-term survival compared to surgery alone. Neoadjuvant therapy has evolved to include various strategies, such as concurrent chemoradiotherapy, chemotherapy, immunotherapy, or targeted combination therapy. This enriches clinical treatment options and provides a more personalized and scientific treatment approach for patients. This article aims to comprehensively summarize current academic research hot topics, review the rationale and evaluation measures of neoadjuvant therapy, discuss challenges in restaging methods after neoadjuvant therapy, and identify the advantages and disadvantages of various neoadjuvant therapeutic strategies.

ObjectiveTo explore the effects of different dosage forms of Kaixinsan （KXS） on the morphology and function of mitochondria in rat models of Alzheimer's disease （AD） and potential mechanisms of action. MethodsMale SD rats were randomly assigned to a sham group， model group， treatment groups receiving KXS decoction， powders， and granules （3.08 g·kg^-1）， as well as donepezil group （0.51×10^-3 g·kg^-1）， with 10 rats in each group. AD model was created using intracerebroventricular injection of streptozocin （STZ）. After 30 days of administration， behavioral assessments were conducted， and mitochondrial morphology was observed using transmission electron microscopy. Mitochondrial respiratory chain complex content was measured via enzyme-linked immunosorbent assay （ELISA）. Changes in mitochondrial membrane potential were measured via JC-1 staining， and superoxide dismutase （SOD） activity and reactive oxygen species （ROS） levels were measured via biochemical assays. The mRNA expression of adenosine 5'-monophosphate-activated protein kinase （AMPK）， peroxisome proliferator-activated receptor gamma coactivator-1α （PGC-1α）， and silent information regulator 3 （SIRT3） was detected by real-time fluorescent quantitative polymerase chain reaction （Real-time PCR）， and Western blot was used to examine the protein expression levels of optic atrophy protein1 （OPA1）， mitochondrial fission protein 1 （FIS1）， AMPK， p-AMPK， PGC-1α， and SIRT3. ResultsCompared with the sham group， rats in the model group had significantly lower recognition index， spontaneous alternation rate， escape latency， number of platform crossings， time spent in the target quadrant， and percentage of distance traveled in the target quadrant distance （P<0.05， P<0.01）. Significant mitochondrial damage was observed in the hippocampal tissue， with a marked decrease in mitochondrial respiratory chain complex content （P<0.01） and reduced mitochondrial membrane potential （P<0.05）. Additionally， the SOD activity was reduced， while ROS levels were elevated （P<0.01）. The mRNA expression of PGC-1α and SIRT3 was significantly downregulated （P<0.01）， along with decreased protein expression levels of OPA1， p-AMPK/AMPK， PGC-1α， and SIRT3， whereas FIS1 protein expression was significantly upregulated （P<0.05， P<0.01）. Compared with the model group， rats in KXS-treated groups （various dosage forms） showed significant improvement in behavioral indexes （P<0.05， P<0.01）， reduced hippocampal mitochondrial damage， and more organized mitochondrial cristae. Mitochondrial respiratory chain complex content was significantly increased （P<0.05， P<0.01）， and mitochondrial membrane potentials were elevated （P<0.05）. SOD activity was elevated， and ROS levels were significantly reduced （P<0.05， P<0.01）. Furthermore， the mRNA expression of PGC-1α and SIRT3 was upregulated， with increased protein levels of OPA1， p-AMPK/AMPK， PGC-1α， and SIRT3， while FIS1 protein expression levels were significantly reduced （P<0.05， P<0.01）. Across the KXS-treated groups， the granule group showed a higher spontaneous alternation rate than the decoction and powder groups （P<0.05）. ConclusionKXS decoction， powders， and granules can improve the learning and memory ability of rats， with granules being the most effective. The mechanism of action may involve activation of the AMPK/PGC-1α/SIRT3 signaling pathway， improvement of the mitochondrial function， and subsequent amelioration of the brain energy metabolism disorders.

ObjectiveTo investigate the effects of Shenxiong Huanglian Jiedu decoction on the clearance of amyloid β-protein （Aβ） and neuronal damage in the mouse model of Alzheimer's disease （AD）. MethodsA total of 36 SPF-grade 2-month-old C57BL/6J mice were used in this study， and the modeling was performed by bilateral hippocampal injection of Aβ oligomers in C57BL/6J mice. The experiment was conducted with a blank group， a sham operation group， a model group， low- and high-dose （3.27，6.54 g·kg^-1， respectively） Shenxiong Huanglian Jiedu decoction groups， and a positive control （donepezil hydrochloride， 0.65 mg·kg^-1） group. At the end of the drug intervention， the learning and memory abilities and the activities of mice were evaluated by the Morris water maze and open field tests. Brain histopathology was examined by hematoxylin-eosin and Nissl staining. Additionally， in vivo imaging was employed to measure the metabolism of fluorescent Aβ in the cerebrospinal fluid， and staining of ionized calcium-binding adapter molecule-1 （Iba-1） was employed to assess microglial activation in the hippocampal tissue. Additionally， neurotrophin-3 （NT-3） and brain-derived neurotrophic factor （BDNF） levels in the brain tissue and serum were determined by the immunofluorescence assay and enzyme-linked immunosorbent assay. Western blot was conducted to determine the expression of inflammation and pathway-related proteins in the hippocampal tissue. ResultsCompared with the blank group and the sham operation group， the escape latency of the mice in the model group was prolonged， the platform residence time was shortened， the hippocampal tissue showed pathological manifestations such as neuronal pyknosis， Nissl body dissolution， and microglia activation. The metabolic rate of fluorescent Aβ through cerebrospinal fluid was slowed down， and the expression levels of BDNF， NT-3， and interleukin-10 （IL-10） in the hippocampus were significantly decreased （P<0.01）. The expression levels of tumor necrosis factor-α （TNF-α）， interleukin-6 （IL-6）， interleukin-1β （IL-1β）， Toll-like receptor 4 （TLR4）， myeloid differentiation factor 88 （MyD88） and phosphorylated nuclear transcription factor-κB （p-NF-κB p65） in hippocampus were significantly increased （P<0.05， P<0.01）. Compared with the model group， the escape latency of mice in the low and high dose groups of Chinese medicine and donepezil group was shortened， and the platform residence time was prolonged. Neuronal karyopyknosis， Nissl body dissolution and microglia activation in hippocampus were improved. Fluorescence Aβ was metabolized faster by cerebrospinal fluid. The expression of BDNF and NT-3 in hippocampus was increased （P<0.01）， and the expression of TLR4， MyD88 and p-NF-κB p65 was significantly decreased （P<0.05， P<0.01）. The expression of TNF-α in the hippocampus of the high-dose group was significantly decreased （P<0.05）， and the expression of IL-10 was significantly increased （P<0.05）. The expression of TNF-α， IL-6 and IL-1β in the hippocampus of the donepezil group was significantly decreased （P<0.05， P<0.01）. ConclusionShenxiong Huanglian Jiedu decoction may mitigate neuronal damage and enhance cerebrospinal fluid flow in the mouse model of AD， thereby promoting the clearance of Aβ and improving the learning and memory abilities. These beneficial effects are likely mediated through the inhibition of microglial activation， reduction of inflammation， and modulation of the TLR4/MyD88/NF-κB signaling pathway.

ObjectiveTo explore the effects of different dosage forms of Kaixinsan （KXS） on the morphology and function of mitochondria in rat models of Alzheimer's disease （AD） and potential mechanisms of action. MethodsMale SD rats were randomly assigned to a sham group， model group， treatment groups receiving KXS decoction， powders， and granules （3.08 g·kg^-1）， as well as donepezil group （0.51×10^-3 g·kg^-1）， with 10 rats in each group. AD model was created using intracerebroventricular injection of streptozocin （STZ）. After 30 days of administration， behavioral assessments were conducted， and mitochondrial morphology was observed using transmission electron microscopy. Mitochondrial respiratory chain complex content was measured via enzyme-linked immunosorbent assay （ELISA）. Changes in mitochondrial membrane potential were measured via JC-1 staining， and superoxide dismutase （SOD） activity and reactive oxygen species （ROS） levels were measured via biochemical assays. The mRNA expression of adenosine 5'-monophosphate-activated protein kinase （AMPK）， peroxisome proliferator-activated receptor gamma coactivator-1α （PGC-1α）， and silent information regulator 3 （SIRT3） was detected by real-time fluorescent quantitative polymerase chain reaction （Real-time PCR）， and Western blot was used to examine the protein expression levels of optic atrophy protein1 （OPA1）， mitochondrial fission protein 1 （FIS1）， AMPK， p-AMPK， PGC-1α， and SIRT3. ResultsCompared with the sham group， rats in the model group had significantly lower recognition index， spontaneous alternation rate， escape latency， number of platform crossings， time spent in the target quadrant， and percentage of distance traveled in the target quadrant distance （P<0.05， P<0.01）. Significant mitochondrial damage was observed in the hippocampal tissue， with a marked decrease in mitochondrial respiratory chain complex content （P<0.01） and reduced mitochondrial membrane potential （P<0.05）. Additionally， the SOD activity was reduced， while ROS levels were elevated （P<0.01）. The mRNA expression of PGC-1α and SIRT3 was significantly downregulated （P<0.01）， along with decreased protein expression levels of OPA1， p-AMPK/AMPK， PGC-1α， and SIRT3， whereas FIS1 protein expression was significantly upregulated （P<0.05， P<0.01）. Compared with the model group， rats in KXS-treated groups （various dosage forms） showed significant improvement in behavioral indexes （P<0.05， P<0.01）， reduced hippocampal mitochondrial damage， and more organized mitochondrial cristae. Mitochondrial respiratory chain complex content was significantly increased （P<0.05， P<0.01）， and mitochondrial membrane potentials were elevated （P<0.05）. SOD activity was elevated， and ROS levels were significantly reduced （P<0.05， P<0.01）. Furthermore， the mRNA expression of PGC-1α and SIRT3 was upregulated， with increased protein levels of OPA1， p-AMPK/AMPK， PGC-1α， and SIRT3， while FIS1 protein expression levels were significantly reduced （P<0.05， P<0.01）. Across the KXS-treated groups， the granule group showed a higher spontaneous alternation rate than the decoction and powder groups （P<0.05）. ConclusionKXS decoction， powders， and granules can improve the learning and memory ability of rats， with granules being the most effective. The mechanism of action may involve activation of the AMPK/PGC-1α/SIRT3 signaling pathway， improvement of the mitochondrial function， and subsequent amelioration of the brain energy metabolism disorders.

ObjectiveTo investigate the effects of Shenxiong Huanglian Jiedu decoction on the clearance of amyloid β-protein （Aβ） and neuronal damage in the mouse model of Alzheimer's disease （AD）. MethodsA total of 36 SPF-grade 2-month-old C57BL/6J mice were used in this study， and the modeling was performed by bilateral hippocampal injection of Aβ oligomers in C57BL/6J mice. The experiment was conducted with a blank group， a sham operation group， a model group， low- and high-dose （3.27，6.54 g·kg^-1， respectively） Shenxiong Huanglian Jiedu decoction groups， and a positive control （donepezil hydrochloride， 0.65 mg·kg^-1） group. At the end of the drug intervention， the learning and memory abilities and the activities of mice were evaluated by the Morris water maze and open field tests. Brain histopathology was examined by hematoxylin-eosin and Nissl staining. Additionally， in vivo imaging was employed to measure the metabolism of fluorescent Aβ in the cerebrospinal fluid， and staining of ionized calcium-binding adapter molecule-1 （Iba-1） was employed to assess microglial activation in the hippocampal tissue. Additionally， neurotrophin-3 （NT-3） and brain-derived neurotrophic factor （BDNF） levels in the brain tissue and serum were determined by the immunofluorescence assay and enzyme-linked immunosorbent assay. Western blot was conducted to determine the expression of inflammation and pathway-related proteins in the hippocampal tissue. ResultsCompared with the blank group and the sham operation group， the escape latency of the mice in the model group was prolonged， the platform residence time was shortened， the hippocampal tissue showed pathological manifestations such as neuronal pyknosis， Nissl body dissolution， and microglia activation. The metabolic rate of fluorescent Aβ through cerebrospinal fluid was slowed down， and the expression levels of BDNF， NT-3， and interleukin-10 （IL-10） in the hippocampus were significantly decreased （P<0.01）. The expression levels of tumor necrosis factor-α （TNF-α）， interleukin-6 （IL-6）， interleukin-1β （IL-1β）， Toll-like receptor 4 （TLR4）， myeloid differentiation factor 88 （MyD88） and phosphorylated nuclear transcription factor-κB （p-NF-κB p65） in hippocampus were significantly increased （P<0.05， P<0.01）. Compared with the model group， the escape latency of mice in the low and high dose groups of Chinese medicine and donepezil group was shortened， and the platform residence time was prolonged. Neuronal karyopyknosis， Nissl body dissolution and microglia activation in hippocampus were improved. Fluorescence Aβ was metabolized faster by cerebrospinal fluid. The expression of BDNF and NT-3 in hippocampus was increased （P<0.01）， and the expression of TLR4， MyD88 and p-NF-κB p65 was significantly decreased （P<0.05， P<0.01）. The expression of TNF-α in the hippocampus of the high-dose group was significantly decreased （P<0.05）， and the expression of IL-10 was significantly increased （P<0.05）. The expression of TNF-α， IL-6 and IL-1β in the hippocampus of the donepezil group was significantly decreased （P<0.05， P<0.01）. ConclusionShenxiong Huanglian Jiedu decoction may mitigate neuronal damage and enhance cerebrospinal fluid flow in the mouse model of AD， thereby promoting the clearance of Aβ and improving the learning and memory abilities. These beneficial effects are likely mediated through the inhibition of microglial activation， reduction of inflammation， and modulation of the TLR4/MyD88/NF-κB signaling pathway.

Objective: To explore the correlation between the expression levels of endoplasmic reticulum stress(ERS) and trophoblast apoptosis-related markers and severe preeclampsia(SPE) in placental tissues of pregnant women with early-and late-onset SPE and normal pregnancy. Methods: Placental tissues from 20 early and late haired severe preeclamptic singleton pregnant women who attended the Hospital were collected(early-onset group, late-onset group), and 20 cases pregnant women of normal blood pressure and no other pregnancy complications who delivered in our hospital during the same period were selected as the normal group. Transmission electron microscopy was used to observe the ultrastructure of the endoplasmic reticulum of trophoblast cells in placental tissues. Protein blotting assay was used to detect the expression levels of endoplasmic reticulum stress-related proteins, including Glucose-regulated protein 78(GRP78), C/EBP homologous protein(CHOP), Phosphorylated eukaryotic translation initiation factor 2α(p-eIF2α) and Phosphatidylinositol-requiring enzyme 1(p-IRE1)α. Immunohistochemistry assay was used to detect the expression of proliferating cell nuclear antigen(Ki67), a proliferation marker, in placental tissues, and TUNEL staining was used to detect placental tissue trophoblast apoptosis. Results: The endoplasmic reticulum of trophoblast cells in the placental tissues of the normal pregnant women group was normal in volume, with no dilatation or swelling. In contrast, the endoplasmic reticulum of placental tissues in the severe preeclampsia group showed obvious edema and significant dilatation, and the dilatation was more obvious in the early-onset group than in the late-onset group. The expression level of endoplasmic reticulum stress-related proteins GRP78(P<0.001,P<0.05) and CHOP(P<0.01,P<0.001), the phosphorylation levels of eIF2α(P<0.000 1,P<0.01) and IRE1α(P<0.000 1,P<0.001) increased in placental tissues of both early-onset and late-onset groups compared to those of the normal group. The p-eIF2α/eIF2α(P<0.001) to p-IRE1α/IRE1α ratio(P<0.05) and GRP78(P<0.01) protein expression levels were significantly higher in the early-onset group than in the late-onset group. Compared with the normal group, the number of Ki67-positive cells per field of view was significantly reduced in the early-onset and late-onset groups(P<0.000 1,P<0.05), and the number of Ki67-positive cells was significantly lower in the early-onset group than in the late-onset group(P<0.01). There were more positive apoptotic cells per field of view in the placental tissues of the early-onset group, and the apoptosis rate of trophoblast cells was significantly higher than that in the other two groups(P<0.001,P<0.01). Conclusion Increased trophoblast apoptosis and suppressed proliferation in placental tissues of patients with severe preeclampsia may be associated with endoplasmic reticulum stress overactivation, and the activation level is higher in placental tissues of early-onset severe preeclampsia than that of late-onset group.