ObjectiveTo establish an ultra-performance liquid fingerprint and multi-components determination method for Naomaili granules. To evaluate the quality of different batches by chemometrics， and the anti-neuroinflammatory effects of water extract and main components of Naomaili granules were tested in vitro. MethodsThe similarity and common peaks of 27 batches of Naomaili granules were evaluated by using Ultra performance liquid chromatography （UPLC） fingerprint detection. Ultra-performance liquid chromatography-tandem mass spectrometry （UPLC-MS/MS） technology was used to determine the content of the index components in Naomaili granules and to evaluate the quality of different batches of Naomaili granules by chemometrics. LPS-induced BV-2 cell inflammation model was used to investigate the anti-neuroinflammatory effects of the water extract and main components of Naomaili granules. ResultsThe similarity of fingerprints of 27 batches of samples was > 0.90. A total of 32 common peaks were calibrated， and 23 of them were identified and assigned. In 27 batches of Naomaili granules， the mass fractions of 14 components that were stachydrine hydrochloride， leonurine hydrochloride， calycosin-7-O-glucoside， calycosin，tanshinoneⅠ， cryptotanshinone， tanshinoneⅡ_A， ginsenoside Rb₁， notoginsenoside R₁， ginsenoside Rg₁， paeoniflorin， albiflorin， lactiflorin， and salvianolic acid B were found to be 2.902-3.498， 0.233-0.343， 0.111-0.301， 0.07-0.152， 0.136-0.228， 0.195-0.390， 0.324-0.482， 1.056-1.435， 0.271-0.397， 1.318-1.649， 3.038-4.059， 2.263-3.455， 0.152-0.232， 2.931-3.991 mg∙g^-1， respectively. Multivariate statistical analysis showed that paeoniflorin， ginsenoside Rg₁， ginsenoside Rb₁ and staphylline hydrochloride were quality difference markers to control the stability of the preparation. The results of bioactive experiment showed that the water extract of Naomaili granules and the eight main components with high content in the prescription had a dose-dependent inhibitory effect on the release of NO in the cell supernatant. Among them， salvianolic acid B and ginsenoside Rb₁ had strong anti-inflammatory activity， with IC₅₀ values of （36.11±0.15） mg∙L^-1 and （27.24±0.54） mg∙L^-1， respectively. ConclusionThe quality evaluation method of Naomaili granules established in this study was accurate and reproducible. Four quality difference markers were screened out， and eight key pharmacodynamic substances of Naomaili granules against neuroinflammation were screened out by in vitro cell experiments.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective: To fabricate a hydrogel loaded with inositol hexaphosphate-zinc and preliminarily evaluate its performance in self-mineralization and osteoinduction, thereby providing a theoretical basis for the development of bone regeneration materials. Methods: The hydrogel framework (designated DF0) was formed by copolymerizing methacryloyloxyethyltrimethylammonium chloride and four-armed poly(ethylene glycol) acrylate, followed by sequentially loading inositol hexaphosphate anions via electrostatic interaction and zinc ions via chelation. The hydrogel loaded only with inositol hexaphosphate anions was named DF1, while the co-loaded hydrogel was named DF2. The self-mineralization efficacy of the DF0 , DF1 and DF2 hydrogels was characterized using scanning electron microscopy, transmission electron microscopy (TEM), energy dispersive spectroscopy (EDS), and selected area electron diffraction (SAED). The biocompatibility was assessed via live/dead cell staining and a CCK-8 assay. The osteoinductive capacity of the DF0 , DF1 and DF2 hydrogels on MC3T3-E1 cells was assessed via alkaline phosphatase (ALP) and Alizarin Red S (ARS) staining. In the aforementioned cell experiments, cells cultured in standard medium served as the control group Results: The DF0, DF1, and DF2 hydrogels were successfully synthesized. Notably, DF1 and DF2 exhibited distinct self-mineralization within 6 days. Results from TEM, EDS, and SAED confirmed that the mineralization products were amorphous calcium phosphate in group DF1, and amorphous calciumzinc phosphate in group DF2. Biocompatibility tests revealed that none of the hydrogels (DF0, DF1, and DF2) adversely affected cell viability or proliferation. In osteogenic induction experiments, both ALP and ARS staining were intensified in the DF1 and DF2 groups, with the most profound staining observed in the DF2 group. Conclusion The developed inositol hexaphosphate-zinc hydrogel (DF2) demonstrates the dual capacity to generate calcium-phosphate compounds through self-mineralization while exhibiting excellent osteoinductive properties. This biocompatible, dual-promoting osteogenic hydrogel presents a novel strategy for bone regeneration.

With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.

Neoadjuvant therapy has become the standard treatment for locally advanced resectable esophageal cancer, significantly improving long-term survival compared to surgery alone. Neoadjuvant therapy has evolved to include various strategies, such as concurrent chemoradiotherapy, chemotherapy, immunotherapy, or targeted combination therapy. This enriches clinical treatment options and provides a more personalized and scientific treatment approach for patients. This article aims to comprehensively summarize current academic research hot topics, review the rationale and evaluation measures of neoadjuvant therapy, discuss challenges in restaging methods after neoadjuvant therapy, and identify the advantages and disadvantages of various neoadjuvant therapeutic strategies.

This comprehensive review systematically explores the multifaceted applications, inherent challenges, and promising future directions of artificial intelligence (AI) within the medical domain. It meticulously examines AI's specific contributions to basic medical research, disease prevention, intelligent diagnosis, treatment, rehabilitation, nursing, and health management. Furthermore, the review delves into AI's innovative practices and pivotal roles in clinical trials, hospital administration, medical education, as well as the realms of medical ethics and policy formulation. Notably, the review identifies several key challenges confronting AI in healthcare, encompassing issues such as inadequate algorithm transparency, data privacy concerns, absent regulatory standards, and incomplete risk assessment frameworks. Looking ahead, the future trajectory of AI in healthcare encompasses enhancing algorithm interpretability, propelling generative AI applications, establishing robust data-sharing mechanisms, refining regulatory policies and standards, nurturing interdisciplinary talent, fostering collaboration among industry, academia, and medical institutions, and advancing inclusive, personalized precision medicine. Emphasizing the synergy between AI and emerging technologies like 5G, big data, and cloud computing, this review anticipates a new era of intelligent collaboration and inclusive sharing in healthcare. Through a multidimensional analysis, it presents a holistic overview of AI's medical applications and development prospects, catering to researchers, practitioners, and policymakers in the healthcare sector. Ultimately, this review aims to catalyze the deep integration and innovative deployment of AI technology in healthcare, thereby driving the sustainable advancement of smart healthcare.

Objective: Inflammatory cascade reactions play a crucial role in secondary neuronal injury in acute ischemic stroke (AIS). The aim of this study was to explore the correlations between specific serological indicators, early neurological deterioration (END), disease prognosis, and syndrome factors in AIS based on this injury mechanism. Methods: The data for this study were collected from 135 patients with AIS admitted to the emergency department of Fangshan Hospital, Beijing University of Chinese Medicine, within 24 h of onset between November 2019 and May 2021. Among these, 29 patients had complete data and experienced END. Additionally, 9 non-END patients were matched from the remaining 90 patients with complete data, resulting in a total of 38 patients for statistical analysis. Statistical methods, including logistic regression and receiver operating curves, were used to analyze the correlation between serum levels of tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), interleukin-10 (IL-10), vascular endothelial growth factor (VEGF), and intercellular adhesion molecule-1 (ICAM-1) within 24 h of END onset, disease prognosis, and syndrome factors. Grouping criteria included END occurrence, presence of syndrome elements on the first and third day post-onset, and prognosis at 90 days post-onset. Results: All 38 cases had onset time of less than 12 h, and there were no significant differences in age, gender, and onset time between the END and non-END groups. The TNF-α serum level within 24 h of onset was not associated with the occurrence of END but was negatively correlated with all-cause mortality at 90 days [0.110; P<0.05). An elevated IL-10 serum level within 24 h of onset showed a strong negative correlation with non-disabling and good functional outcomes at 90 days post-onset (0.110; P<0.05). When the ICAM-1 serum levels exceeded 233 599.500 μg/L and 125 141.500 μg/L, respectively, the susceptibility to endogenous wind and endogenous fire on the third day of onset was 15.364 times and 6.071 times higher, respectively, than that in patients with serum levels below these thresholds. Conclusion As accessible and objective biomarkers, inflammatory serum indicators are closely associated with both disease progression and traditional Chinese medicine (TCM) syndrome elements. They enhance AIS diagnosis, assessment, and treatment and contribute to a deeper understanding of the role of TCM syndrome differentiation in AIS diagnosis and treatment.

ObjectiveTo explore the effects of different dosage forms of Kaixinsan （KXS） on the morphology and function of mitochondria in rat models of Alzheimer's disease （AD） and potential mechanisms of action. MethodsMale SD rats were randomly assigned to a sham group， model group， treatment groups receiving KXS decoction， powders， and granules （3.08 g·kg^-1）， as well as donepezil group （0.51×10^-3 g·kg^-1）， with 10 rats in each group. AD model was created using intracerebroventricular injection of streptozocin （STZ）. After 30 days of administration， behavioral assessments were conducted， and mitochondrial morphology was observed using transmission electron microscopy. Mitochondrial respiratory chain complex content was measured via enzyme-linked immunosorbent assay （ELISA）. Changes in mitochondrial membrane potential were measured via JC-1 staining， and superoxide dismutase （SOD） activity and reactive oxygen species （ROS） levels were measured via biochemical assays. The mRNA expression of adenosine 5'-monophosphate-activated protein kinase （AMPK）， peroxisome proliferator-activated receptor gamma coactivator-1α （PGC-1α）， and silent information regulator 3 （SIRT3） was detected by real-time fluorescent quantitative polymerase chain reaction （Real-time PCR）， and Western blot was used to examine the protein expression levels of optic atrophy protein1 （OPA1）， mitochondrial fission protein 1 （FIS1）， AMPK， p-AMPK， PGC-1α， and SIRT3. ResultsCompared with the sham group， rats in the model group had significantly lower recognition index， spontaneous alternation rate， escape latency， number of platform crossings， time spent in the target quadrant， and percentage of distance traveled in the target quadrant distance （P<0.05， P<0.01）. Significant mitochondrial damage was observed in the hippocampal tissue， with a marked decrease in mitochondrial respiratory chain complex content （P<0.01） and reduced mitochondrial membrane potential （P<0.05）. Additionally， the SOD activity was reduced， while ROS levels were elevated （P<0.01）. The mRNA expression of PGC-1α and SIRT3 was significantly downregulated （P<0.01）， along with decreased protein expression levels of OPA1， p-AMPK/AMPK， PGC-1α， and SIRT3， whereas FIS1 protein expression was significantly upregulated （P<0.05， P<0.01）. Compared with the model group， rats in KXS-treated groups （various dosage forms） showed significant improvement in behavioral indexes （P<0.05， P<0.01）， reduced hippocampal mitochondrial damage， and more organized mitochondrial cristae. Mitochondrial respiratory chain complex content was significantly increased （P<0.05， P<0.01）， and mitochondrial membrane potentials were elevated （P<0.05）. SOD activity was elevated， and ROS levels were significantly reduced （P<0.05， P<0.01）. Furthermore， the mRNA expression of PGC-1α and SIRT3 was upregulated， with increased protein levels of OPA1， p-AMPK/AMPK， PGC-1α， and SIRT3， while FIS1 protein expression levels were significantly reduced （P<0.05， P<0.01）. Across the KXS-treated groups， the granule group showed a higher spontaneous alternation rate than the decoction and powder groups （P<0.05）. ConclusionKXS decoction， powders， and granules can improve the learning and memory ability of rats， with granules being the most effective. The mechanism of action may involve activation of the AMPK/PGC-1α/SIRT3 signaling pathway， improvement of the mitochondrial function， and subsequent amelioration of the brain energy metabolism disorders.

ObjectiveTo investigate the effects of Shenxiong Huanglian Jiedu decoction on the clearance of amyloid β-protein （Aβ） and neuronal damage in the mouse model of Alzheimer's disease （AD）. MethodsA total of 36 SPF-grade 2-month-old C57BL/6J mice were used in this study， and the modeling was performed by bilateral hippocampal injection of Aβ oligomers in C57BL/6J mice. The experiment was conducted with a blank group， a sham operation group， a model group， low- and high-dose （3.27，6.54 g·kg^-1， respectively） Shenxiong Huanglian Jiedu decoction groups， and a positive control （donepezil hydrochloride， 0.65 mg·kg^-1） group. At the end of the drug intervention， the learning and memory abilities and the activities of mice were evaluated by the Morris water maze and open field tests. Brain histopathology was examined by hematoxylin-eosin and Nissl staining. Additionally， in vivo imaging was employed to measure the metabolism of fluorescent Aβ in the cerebrospinal fluid， and staining of ionized calcium-binding adapter molecule-1 （Iba-1） was employed to assess microglial activation in the hippocampal tissue. Additionally， neurotrophin-3 （NT-3） and brain-derived neurotrophic factor （BDNF） levels in the brain tissue and serum were determined by the immunofluorescence assay and enzyme-linked immunosorbent assay. Western blot was conducted to determine the expression of inflammation and pathway-related proteins in the hippocampal tissue. ResultsCompared with the blank group and the sham operation group， the escape latency of the mice in the model group was prolonged， the platform residence time was shortened， the hippocampal tissue showed pathological manifestations such as neuronal pyknosis， Nissl body dissolution， and microglia activation. The metabolic rate of fluorescent Aβ through cerebrospinal fluid was slowed down， and the expression levels of BDNF， NT-3， and interleukin-10 （IL-10） in the hippocampus were significantly decreased （P<0.01）. The expression levels of tumor necrosis factor-α （TNF-α）， interleukin-6 （IL-6）， interleukin-1β （IL-1β）， Toll-like receptor 4 （TLR4）， myeloid differentiation factor 88 （MyD88） and phosphorylated nuclear transcription factor-κB （p-NF-κB p65） in hippocampus were significantly increased （P<0.05， P<0.01）. Compared with the model group， the escape latency of mice in the low and high dose groups of Chinese medicine and donepezil group was shortened， and the platform residence time was prolonged. Neuronal karyopyknosis， Nissl body dissolution and microglia activation in hippocampus were improved. Fluorescence Aβ was metabolized faster by cerebrospinal fluid. The expression of BDNF and NT-3 in hippocampus was increased （P<0.01）， and the expression of TLR4， MyD88 and p-NF-κB p65 was significantly decreased （P<0.05， P<0.01）. The expression of TNF-α in the hippocampus of the high-dose group was significantly decreased （P<0.05）， and the expression of IL-10 was significantly increased （P<0.05）. The expression of TNF-α， IL-6 and IL-1β in the hippocampus of the donepezil group was significantly decreased （P<0.05， P<0.01）. ConclusionShenxiong Huanglian Jiedu decoction may mitigate neuronal damage and enhance cerebrospinal fluid flow in the mouse model of AD， thereby promoting the clearance of Aβ and improving the learning and memory abilities. These beneficial effects are likely mediated through the inhibition of microglial activation， reduction of inflammation， and modulation of the TLR4/MyD88/NF-κB signaling pathway.

ObjectiveTo explore the effects of different dosage forms of Kaixinsan （KXS） on the morphology and function of mitochondria in rat models of Alzheimer's disease （AD） and potential mechanisms of action. MethodsMale SD rats were randomly assigned to a sham group， model group， treatment groups receiving KXS decoction， powders， and granules （3.08 g·kg^-1）， as well as donepezil group （0.51×10^-3 g·kg^-1）， with 10 rats in each group. AD model was created using intracerebroventricular injection of streptozocin （STZ）. After 30 days of administration， behavioral assessments were conducted， and mitochondrial morphology was observed using transmission electron microscopy. Mitochondrial respiratory chain complex content was measured via enzyme-linked immunosorbent assay （ELISA）. Changes in mitochondrial membrane potential were measured via JC-1 staining， and superoxide dismutase （SOD） activity and reactive oxygen species （ROS） levels were measured via biochemical assays. The mRNA expression of adenosine 5'-monophosphate-activated protein kinase （AMPK）， peroxisome proliferator-activated receptor gamma coactivator-1α （PGC-1α）， and silent information regulator 3 （SIRT3） was detected by real-time fluorescent quantitative polymerase chain reaction （Real-time PCR）， and Western blot was used to examine the protein expression levels of optic atrophy protein1 （OPA1）， mitochondrial fission protein 1 （FIS1）， AMPK， p-AMPK， PGC-1α， and SIRT3. ResultsCompared with the sham group， rats in the model group had significantly lower recognition index， spontaneous alternation rate， escape latency， number of platform crossings， time spent in the target quadrant， and percentage of distance traveled in the target quadrant distance （P<0.05， P<0.01）. Significant mitochondrial damage was observed in the hippocampal tissue， with a marked decrease in mitochondrial respiratory chain complex content （P<0.01） and reduced mitochondrial membrane potential （P<0.05）. Additionally， the SOD activity was reduced， while ROS levels were elevated （P<0.01）. The mRNA expression of PGC-1α and SIRT3 was significantly downregulated （P<0.01）， along with decreased protein expression levels of OPA1， p-AMPK/AMPK， PGC-1α， and SIRT3， whereas FIS1 protein expression was significantly upregulated （P<0.05， P<0.01）. Compared with the model group， rats in KXS-treated groups （various dosage forms） showed significant improvement in behavioral indexes （P<0.05， P<0.01）， reduced hippocampal mitochondrial damage， and more organized mitochondrial cristae. Mitochondrial respiratory chain complex content was significantly increased （P<0.05， P<0.01）， and mitochondrial membrane potentials were elevated （P<0.05）. SOD activity was elevated， and ROS levels were significantly reduced （P<0.05， P<0.01）. Furthermore， the mRNA expression of PGC-1α and SIRT3 was upregulated， with increased protein levels of OPA1， p-AMPK/AMPK， PGC-1α， and SIRT3， while FIS1 protein expression levels were significantly reduced （P<0.05， P<0.01）. Across the KXS-treated groups， the granule group showed a higher spontaneous alternation rate than the decoction and powder groups （P<0.05）. ConclusionKXS decoction， powders， and granules can improve the learning and memory ability of rats， with granules being the most effective. The mechanism of action may involve activation of the AMPK/PGC-1α/SIRT3 signaling pathway， improvement of the mitochondrial function， and subsequent amelioration of the brain energy metabolism disorders.