ObjectiveTo establish an ultra-performance liquid fingerprint and multi-components determination method for Naomaili granules. To evaluate the quality of different batches by chemometrics， and the anti-neuroinflammatory effects of water extract and main components of Naomaili granules were tested in vitro. MethodsThe similarity and common peaks of 27 batches of Naomaili granules were evaluated by using Ultra performance liquid chromatography （UPLC） fingerprint detection. Ultra-performance liquid chromatography-tandem mass spectrometry （UPLC-MS/MS） technology was used to determine the content of the index components in Naomaili granules and to evaluate the quality of different batches of Naomaili granules by chemometrics. LPS-induced BV-2 cell inflammation model was used to investigate the anti-neuroinflammatory effects of the water extract and main components of Naomaili granules. ResultsThe similarity of fingerprints of 27 batches of samples was > 0.90. A total of 32 common peaks were calibrated， and 23 of them were identified and assigned. In 27 batches of Naomaili granules， the mass fractions of 14 components that were stachydrine hydrochloride， leonurine hydrochloride， calycosin-7-O-glucoside， calycosin，tanshinoneⅠ， cryptotanshinone， tanshinoneⅡ_A， ginsenoside Rb₁， notoginsenoside R₁， ginsenoside Rg₁， paeoniflorin， albiflorin， lactiflorin， and salvianolic acid B were found to be 2.902-3.498， 0.233-0.343， 0.111-0.301， 0.07-0.152， 0.136-0.228， 0.195-0.390， 0.324-0.482， 1.056-1.435， 0.271-0.397， 1.318-1.649， 3.038-4.059， 2.263-3.455， 0.152-0.232， 2.931-3.991 mg∙g^-1， respectively. Multivariate statistical analysis showed that paeoniflorin， ginsenoside Rg₁， ginsenoside Rb₁ and staphylline hydrochloride were quality difference markers to control the stability of the preparation. The results of bioactive experiment showed that the water extract of Naomaili granules and the eight main components with high content in the prescription had a dose-dependent inhibitory effect on the release of NO in the cell supernatant. Among them， salvianolic acid B and ginsenoside Rb₁ had strong anti-inflammatory activity， with IC₅₀ values of （36.11±0.15） mg∙L^-1 and （27.24±0.54） mg∙L^-1， respectively. ConclusionThe quality evaluation method of Naomaili granules established in this study was accurate and reproducible. Four quality difference markers were screened out， and eight key pharmacodynamic substances of Naomaili granules against neuroinflammation were screened out by in vitro cell experiments.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective: To fabricate a hydrogel loaded with inositol hexaphosphate-zinc and preliminarily evaluate its performance in self-mineralization and osteoinduction, thereby providing a theoretical basis for the development of bone regeneration materials. Methods: The hydrogel framework (designated DF0) was formed by copolymerizing methacryloyloxyethyltrimethylammonium chloride and four-armed poly(ethylene glycol) acrylate, followed by sequentially loading inositol hexaphosphate anions via electrostatic interaction and zinc ions via chelation. The hydrogel loaded only with inositol hexaphosphate anions was named DF1, while the co-loaded hydrogel was named DF2. The self-mineralization efficacy of the DF0 , DF1 and DF2 hydrogels was characterized using scanning electron microscopy, transmission electron microscopy (TEM), energy dispersive spectroscopy (EDS), and selected area electron diffraction (SAED). The biocompatibility was assessed via live/dead cell staining and a CCK-8 assay. The osteoinductive capacity of the DF0 , DF1 and DF2 hydrogels on MC3T3-E1 cells was assessed via alkaline phosphatase (ALP) and Alizarin Red S (ARS) staining. In the aforementioned cell experiments, cells cultured in standard medium served as the control group Results: The DF0, DF1, and DF2 hydrogels were successfully synthesized. Notably, DF1 and DF2 exhibited distinct self-mineralization within 6 days. Results from TEM, EDS, and SAED confirmed that the mineralization products were amorphous calcium phosphate in group DF1, and amorphous calciumzinc phosphate in group DF2. Biocompatibility tests revealed that none of the hydrogels (DF0, DF1, and DF2) adversely affected cell viability or proliferation. In osteogenic induction experiments, both ALP and ARS staining were intensified in the DF1 and DF2 groups, with the most profound staining observed in the DF2 group. Conclusion The developed inositol hexaphosphate-zinc hydrogel (DF2) demonstrates the dual capacity to generate calcium-phosphate compounds through self-mineralization while exhibiting excellent osteoinductive properties. This biocompatible, dual-promoting osteogenic hydrogel presents a novel strategy for bone regeneration.

OBJECTIVE To conduct a clinical rapid evaluation of the marketed proprotein convertase subtilisin/kexin type 9 （PCSK9） inhibitors in China， including evolocumab， tafolecimab， recaticimab， ebronucimab， ongericimab and inclisiran. METHODS Based on the Rapid Guide for Drug Evaluation and Selection in Chinese Medical Institutions （second edition）， drug instructions， clinical diagnosis and treatment guidelines， and literature for six drugs were retrieved from CNKI， Wanfang Data， VIP， PubMed， Embase， Cochrane Library and related official websites. The clinical rapid evaluation was conducted from five aspects： pharmaceutical characteristics， effectiveness， safety， economy， and other attributes. RESULTS The pharmaceutical characteristics， effectiveness， safety， economy， other attributes， and total score of evolocumab scored 24， 27， 15.7， 10， 5.3， and 82 points， respectively. Tafolecimab scored 23.5， 23， 11.5， 9.97， 4.6， and 72.57 points， respectively. Recaticimab scored 20.5， 22， 15.5， 6.37， 3.5， and 67.87 points. Ebronucimab scored 20， 23， 11， 6.48， 3.5， and 63.98 points. Ongericimab scored 20.5， 23， 8.5， 4.83， 3.5， and 60.33 points. Inclisiran scored 25.5， 24， 13， 6.48， 5， and 73.98 points. CONCLUSIONS Evolocumab is the optimal choice for treating hypercholesterolemia and is recommended as the first-line option. Tafolecimab is the second-line option， and recaticimab is suitable for patients who are sensitive to drug adverse reactions. Inclisiran is suitable for patients with poor compliance. Ebronucimab and ongericimab are weakly recommended due to their later market introduction. Clinicians should make individualized drug selections based on factors such as patient risk level and compliance requirements.

OBJECTIVE To evaluate the cost-effectiveness of cefiderocol versus best available therapy （BAT） or standard-of- care （SOC） for the treatment of confirmed or suspected carbapenem-resistant Gram-negative bacterial （CRGNB） serious infections from the perspective of the Chinese healthcare system， and to explore its reasonable pricing. METHODS A decision tree model was constructed based on data from two phase Ⅲ clinical trials （CREDIBLE-CR and GAME CHANGER） to simulate the cost- effectiveness of cefiderocol in two scenarios： salvage therapy for confirmed CRGNB infection （scenario 1） and empirical therapy for suspected CRGNB infection （scenario 2）. The primary outcome measure was the incremental cost-effectiveness ratio （ICER）. The willingness-to-pay （WTP） was set at 1 to 3 times China’s per capita GDP in 2024. To verify the robustness of the results， one- way and probabilistic sensitivity analyses were conducted， and based on these， a reasonable price range for cefiderocol in the Chinese market was explored. RESULTS The results for scenario 1 showed that the clinical cure rate in the cefiderocol group was higher than that in the BAT group （47.50% vs. 34.21%）， but its ICER was 415 065.03 yuan per cured case， exceeding three times China’s GDP per capita. Scenario 2 revealed that the ICER for cefiderocol relative to SOC was as high as 1 362 446.16 yuan per cured case， far exceeding the WTP. Sensitivity analysis indicated that the treatment duration and price of cefiderocol were key factors affecting its cost-effectiveness. In the two scenarios described above， the unit price of cefiderocol must fall below 683.47 and 242.00 yuan/g， respectively， to be considered cost-effective. CONCLUSIONS Based on the current market price， cefiderocol lacks sufficient cost-effectiveness for treating confirmed or suspected CRGNB serious infections within China’s healthcare system. To improve its accessibility， price negotiations or a tiered medical insurance payment strategy are required.

ObjectiveTo explore the effects of different dosage forms of Kaixinsan （KXS） on the morphology and function of mitochondria in rat models of Alzheimer's disease （AD） and potential mechanisms of action. MethodsMale SD rats were randomly assigned to a sham group， model group， treatment groups receiving KXS decoction， powders， and granules （3.08 g·kg^-1）， as well as donepezil group （0.51×10^-3 g·kg^-1）， with 10 rats in each group. AD model was created using intracerebroventricular injection of streptozocin （STZ）. After 30 days of administration， behavioral assessments were conducted， and mitochondrial morphology was observed using transmission electron microscopy. Mitochondrial respiratory chain complex content was measured via enzyme-linked immunosorbent assay （ELISA）. Changes in mitochondrial membrane potential were measured via JC-1 staining， and superoxide dismutase （SOD） activity and reactive oxygen species （ROS） levels were measured via biochemical assays. The mRNA expression of adenosine 5'-monophosphate-activated protein kinase （AMPK）， peroxisome proliferator-activated receptor gamma coactivator-1α （PGC-1α）， and silent information regulator 3 （SIRT3） was detected by real-time fluorescent quantitative polymerase chain reaction （Real-time PCR）， and Western blot was used to examine the protein expression levels of optic atrophy protein1 （OPA1）， mitochondrial fission protein 1 （FIS1）， AMPK， p-AMPK， PGC-1α， and SIRT3. ResultsCompared with the sham group， rats in the model group had significantly lower recognition index， spontaneous alternation rate， escape latency， number of platform crossings， time spent in the target quadrant， and percentage of distance traveled in the target quadrant distance （P<0.05， P<0.01）. Significant mitochondrial damage was observed in the hippocampal tissue， with a marked decrease in mitochondrial respiratory chain complex content （P<0.01） and reduced mitochondrial membrane potential （P<0.05）. Additionally， the SOD activity was reduced， while ROS levels were elevated （P<0.01）. The mRNA expression of PGC-1α and SIRT3 was significantly downregulated （P<0.01）， along with decreased protein expression levels of OPA1， p-AMPK/AMPK， PGC-1α， and SIRT3， whereas FIS1 protein expression was significantly upregulated （P<0.05， P<0.01）. Compared with the model group， rats in KXS-treated groups （various dosage forms） showed significant improvement in behavioral indexes （P<0.05， P<0.01）， reduced hippocampal mitochondrial damage， and more organized mitochondrial cristae. Mitochondrial respiratory chain complex content was significantly increased （P<0.05， P<0.01）， and mitochondrial membrane potentials were elevated （P<0.05）. SOD activity was elevated， and ROS levels were significantly reduced （P<0.05， P<0.01）. Furthermore， the mRNA expression of PGC-1α and SIRT3 was upregulated， with increased protein levels of OPA1， p-AMPK/AMPK， PGC-1α， and SIRT3， while FIS1 protein expression levels were significantly reduced （P<0.05， P<0.01）. Across the KXS-treated groups， the granule group showed a higher spontaneous alternation rate than the decoction and powder groups （P<0.05）. ConclusionKXS decoction， powders， and granules can improve the learning and memory ability of rats， with granules being the most effective. The mechanism of action may involve activation of the AMPK/PGC-1α/SIRT3 signaling pathway， improvement of the mitochondrial function， and subsequent amelioration of the brain energy metabolism disorders.

ObjectiveTo investigate the effects of Shenxiong Huanglian Jiedu decoction on the clearance of amyloid β-protein （Aβ） and neuronal damage in the mouse model of Alzheimer's disease （AD）. MethodsA total of 36 SPF-grade 2-month-old C57BL/6J mice were used in this study， and the modeling was performed by bilateral hippocampal injection of Aβ oligomers in C57BL/6J mice. The experiment was conducted with a blank group， a sham operation group， a model group， low- and high-dose （3.27，6.54 g·kg^-1， respectively） Shenxiong Huanglian Jiedu decoction groups， and a positive control （donepezil hydrochloride， 0.65 mg·kg^-1） group. At the end of the drug intervention， the learning and memory abilities and the activities of mice were evaluated by the Morris water maze and open field tests. Brain histopathology was examined by hematoxylin-eosin and Nissl staining. Additionally， in vivo imaging was employed to measure the metabolism of fluorescent Aβ in the cerebrospinal fluid， and staining of ionized calcium-binding adapter molecule-1 （Iba-1） was employed to assess microglial activation in the hippocampal tissue. Additionally， neurotrophin-3 （NT-3） and brain-derived neurotrophic factor （BDNF） levels in the brain tissue and serum were determined by the immunofluorescence assay and enzyme-linked immunosorbent assay. Western blot was conducted to determine the expression of inflammation and pathway-related proteins in the hippocampal tissue. ResultsCompared with the blank group and the sham operation group， the escape latency of the mice in the model group was prolonged， the platform residence time was shortened， the hippocampal tissue showed pathological manifestations such as neuronal pyknosis， Nissl body dissolution， and microglia activation. The metabolic rate of fluorescent Aβ through cerebrospinal fluid was slowed down， and the expression levels of BDNF， NT-3， and interleukin-10 （IL-10） in the hippocampus were significantly decreased （P<0.01）. The expression levels of tumor necrosis factor-α （TNF-α）， interleukin-6 （IL-6）， interleukin-1β （IL-1β）， Toll-like receptor 4 （TLR4）， myeloid differentiation factor 88 （MyD88） and phosphorylated nuclear transcription factor-κB （p-NF-κB p65） in hippocampus were significantly increased （P<0.05， P<0.01）. Compared with the model group， the escape latency of mice in the low and high dose groups of Chinese medicine and donepezil group was shortened， and the platform residence time was prolonged. Neuronal karyopyknosis， Nissl body dissolution and microglia activation in hippocampus were improved. Fluorescence Aβ was metabolized faster by cerebrospinal fluid. The expression of BDNF and NT-3 in hippocampus was increased （P<0.01）， and the expression of TLR4， MyD88 and p-NF-κB p65 was significantly decreased （P<0.05， P<0.01）. The expression of TNF-α in the hippocampus of the high-dose group was significantly decreased （P<0.05）， and the expression of IL-10 was significantly increased （P<0.05）. The expression of TNF-α， IL-6 and IL-1β in the hippocampus of the donepezil group was significantly decreased （P<0.05， P<0.01）. ConclusionShenxiong Huanglian Jiedu decoction may mitigate neuronal damage and enhance cerebrospinal fluid flow in the mouse model of AD， thereby promoting the clearance of Aβ and improving the learning and memory abilities. These beneficial effects are likely mediated through the inhibition of microglial activation， reduction of inflammation， and modulation of the TLR4/MyD88/NF-κB signaling pathway.

ObjectiveTo explore the effects of different dosage forms of Kaixinsan （KXS） on the morphology and function of mitochondria in rat models of Alzheimer's disease （AD） and potential mechanisms of action. MethodsMale SD rats were randomly assigned to a sham group， model group， treatment groups receiving KXS decoction， powders， and granules （3.08 g·kg^-1）， as well as donepezil group （0.51×10^-3 g·kg^-1）， with 10 rats in each group. AD model was created using intracerebroventricular injection of streptozocin （STZ）. After 30 days of administration， behavioral assessments were conducted， and mitochondrial morphology was observed using transmission electron microscopy. Mitochondrial respiratory chain complex content was measured via enzyme-linked immunosorbent assay （ELISA）. Changes in mitochondrial membrane potential were measured via JC-1 staining， and superoxide dismutase （SOD） activity and reactive oxygen species （ROS） levels were measured via biochemical assays. The mRNA expression of adenosine 5'-monophosphate-activated protein kinase （AMPK）， peroxisome proliferator-activated receptor gamma coactivator-1α （PGC-1α）， and silent information regulator 3 （SIRT3） was detected by real-time fluorescent quantitative polymerase chain reaction （Real-time PCR）， and Western blot was used to examine the protein expression levels of optic atrophy protein1 （OPA1）， mitochondrial fission protein 1 （FIS1）， AMPK， p-AMPK， PGC-1α， and SIRT3. ResultsCompared with the sham group， rats in the model group had significantly lower recognition index， spontaneous alternation rate， escape latency， number of platform crossings， time spent in the target quadrant， and percentage of distance traveled in the target quadrant distance （P<0.05， P<0.01）. Significant mitochondrial damage was observed in the hippocampal tissue， with a marked decrease in mitochondrial respiratory chain complex content （P<0.01） and reduced mitochondrial membrane potential （P<0.05）. Additionally， the SOD activity was reduced， while ROS levels were elevated （P<0.01）. The mRNA expression of PGC-1α and SIRT3 was significantly downregulated （P<0.01）， along with decreased protein expression levels of OPA1， p-AMPK/AMPK， PGC-1α， and SIRT3， whereas FIS1 protein expression was significantly upregulated （P<0.05， P<0.01）. Compared with the model group， rats in KXS-treated groups （various dosage forms） showed significant improvement in behavioral indexes （P<0.05， P<0.01）， reduced hippocampal mitochondrial damage， and more organized mitochondrial cristae. Mitochondrial respiratory chain complex content was significantly increased （P<0.05， P<0.01）， and mitochondrial membrane potentials were elevated （P<0.05）. SOD activity was elevated， and ROS levels were significantly reduced （P<0.05， P<0.01）. Furthermore， the mRNA expression of PGC-1α and SIRT3 was upregulated， with increased protein levels of OPA1， p-AMPK/AMPK， PGC-1α， and SIRT3， while FIS1 protein expression levels were significantly reduced （P<0.05， P<0.01）. Across the KXS-treated groups， the granule group showed a higher spontaneous alternation rate than the decoction and powder groups （P<0.05）. ConclusionKXS decoction， powders， and granules can improve the learning and memory ability of rats， with granules being the most effective. The mechanism of action may involve activation of the AMPK/PGC-1α/SIRT3 signaling pathway， improvement of the mitochondrial function， and subsequent amelioration of the brain energy metabolism disorders.

ObjectiveTo investigate the effects of Shenxiong Huanglian Jiedu decoction on the clearance of amyloid β-protein （Aβ） and neuronal damage in the mouse model of Alzheimer's disease （AD）. MethodsA total of 36 SPF-grade 2-month-old C57BL/6J mice were used in this study， and the modeling was performed by bilateral hippocampal injection of Aβ oligomers in C57BL/6J mice. The experiment was conducted with a blank group， a sham operation group， a model group， low- and high-dose （3.27，6.54 g·kg^-1， respectively） Shenxiong Huanglian Jiedu decoction groups， and a positive control （donepezil hydrochloride， 0.65 mg·kg^-1） group. At the end of the drug intervention， the learning and memory abilities and the activities of mice were evaluated by the Morris water maze and open field tests. Brain histopathology was examined by hematoxylin-eosin and Nissl staining. Additionally， in vivo imaging was employed to measure the metabolism of fluorescent Aβ in the cerebrospinal fluid， and staining of ionized calcium-binding adapter molecule-1 （Iba-1） was employed to assess microglial activation in the hippocampal tissue. Additionally， neurotrophin-3 （NT-3） and brain-derived neurotrophic factor （BDNF） levels in the brain tissue and serum were determined by the immunofluorescence assay and enzyme-linked immunosorbent assay. Western blot was conducted to determine the expression of inflammation and pathway-related proteins in the hippocampal tissue. ResultsCompared with the blank group and the sham operation group， the escape latency of the mice in the model group was prolonged， the platform residence time was shortened， the hippocampal tissue showed pathological manifestations such as neuronal pyknosis， Nissl body dissolution， and microglia activation. The metabolic rate of fluorescent Aβ through cerebrospinal fluid was slowed down， and the expression levels of BDNF， NT-3， and interleukin-10 （IL-10） in the hippocampus were significantly decreased （P<0.01）. The expression levels of tumor necrosis factor-α （TNF-α）， interleukin-6 （IL-6）， interleukin-1β （IL-1β）， Toll-like receptor 4 （TLR4）， myeloid differentiation factor 88 （MyD88） and phosphorylated nuclear transcription factor-κB （p-NF-κB p65） in hippocampus were significantly increased （P<0.05， P<0.01）. Compared with the model group， the escape latency of mice in the low and high dose groups of Chinese medicine and donepezil group was shortened， and the platform residence time was prolonged. Neuronal karyopyknosis， Nissl body dissolution and microglia activation in hippocampus were improved. Fluorescence Aβ was metabolized faster by cerebrospinal fluid. The expression of BDNF and NT-3 in hippocampus was increased （P<0.01）， and the expression of TLR4， MyD88 and p-NF-κB p65 was significantly decreased （P<0.05， P<0.01）. The expression of TNF-α in the hippocampus of the high-dose group was significantly decreased （P<0.05）， and the expression of IL-10 was significantly increased （P<0.05）. The expression of TNF-α， IL-6 and IL-1β in the hippocampus of the donepezil group was significantly decreased （P<0.05， P<0.01）. ConclusionShenxiong Huanglian Jiedu decoction may mitigate neuronal damage and enhance cerebrospinal fluid flow in the mouse model of AD， thereby promoting the clearance of Aβ and improving the learning and memory abilities. These beneficial effects are likely mediated through the inhibition of microglial activation， reduction of inflammation， and modulation of the TLR4/MyD88/NF-κB signaling pathway.

Objective: To explore the correlation between the expression levels of endoplasmic reticulum stress(ERS) and trophoblast apoptosis-related markers and severe preeclampsia(SPE) in placental tissues of pregnant women with early-and late-onset SPE and normal pregnancy. Methods: Placental tissues from 20 early and late haired severe preeclamptic singleton pregnant women who attended the Hospital were collected(early-onset group, late-onset group), and 20 cases pregnant women of normal blood pressure and no other pregnancy complications who delivered in our hospital during the same period were selected as the normal group. Transmission electron microscopy was used to observe the ultrastructure of the endoplasmic reticulum of trophoblast cells in placental tissues. Protein blotting assay was used to detect the expression levels of endoplasmic reticulum stress-related proteins, including Glucose-regulated protein 78(GRP78), C/EBP homologous protein(CHOP), Phosphorylated eukaryotic translation initiation factor 2α(p-eIF2α) and Phosphatidylinositol-requiring enzyme 1(p-IRE1)α. Immunohistochemistry assay was used to detect the expression of proliferating cell nuclear antigen(Ki67), a proliferation marker, in placental tissues, and TUNEL staining was used to detect placental tissue trophoblast apoptosis. Results: The endoplasmic reticulum of trophoblast cells in the placental tissues of the normal pregnant women group was normal in volume, with no dilatation or swelling. In contrast, the endoplasmic reticulum of placental tissues in the severe preeclampsia group showed obvious edema and significant dilatation, and the dilatation was more obvious in the early-onset group than in the late-onset group. The expression level of endoplasmic reticulum stress-related proteins GRP78(P<0.001,P<0.05) and CHOP(P<0.01,P<0.001), the phosphorylation levels of eIF2α(P<0.000 1,P<0.01) and IRE1α(P<0.000 1,P<0.001) increased in placental tissues of both early-onset and late-onset groups compared to those of the normal group. The p-eIF2α/eIF2α(P<0.001) to p-IRE1α/IRE1α ratio(P<0.05) and GRP78(P<0.01) protein expression levels were significantly higher in the early-onset group than in the late-onset group. Compared with the normal group, the number of Ki67-positive cells per field of view was significantly reduced in the early-onset and late-onset groups(P<0.000 1,P<0.05), and the number of Ki67-positive cells was significantly lower in the early-onset group than in the late-onset group(P<0.01). There were more positive apoptotic cells per field of view in the placental tissues of the early-onset group, and the apoptosis rate of trophoblast cells was significantly higher than that in the other two groups(P<0.001,P<0.01). Conclusion Increased trophoblast apoptosis and suppressed proliferation in placental tissues of patients with severe preeclampsia may be associated with endoplasmic reticulum stress overactivation, and the activation level is higher in placental tissues of early-onset severe preeclampsia than that of late-onset group.