1.Action Mechanism of Huamoyan Granules in Treatment of Knee Osteoarthritis Based on TRPV1/p38 MAPK Pathway
Jin ZHANG ; Lili YANG ; Canwen ZHENG ; Jing KANG ; Yanlei MA ; Yue SHI ; Lei LI ; Hongxu MENG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(4):79-89
ObjectiveThis paper aims to observe the protective effect of Huamoyan granules on knee osteoarthritis (KOA) and explore whether its protective effect is oriented toward an anti-inflammatory direction by regulation of macrophage polarization, which can effectively inhibit the progression of pathological inflammatory response, reduce the release of inflammatory pain mediators, and downregulate the protein expression level of transient receptor potential vanilloid 1 (TRPV1), so as to provide experimental evidence for its clinical application and investigate its action mechanism. MethodsAfter adaptive feeding, Sprague-Dawley (SD) rats were randomly divided into six groups: sham group, model group, celecoxib group, and high, medium, and low-dose synovitis granule groups (9.6, 4.8, 2.4 g·kg-1). The administration dose of celecoxib capsules was 20 mg·kg-1. There were 10 rats in the sham group and 12 rats in the model group and each administration group. A KOA animal model was established by means of intra-articular injection of sodium iodoacetate into the knee joint. From the 10th day of the experiment, each administration group was given intragastric administration at a dose of 10 mL·kg-1 for 4 weeks. General conditions of rats in each group were assessed daily. The pressure pain threshold (PPT) to mechanical stimulation and joint diameter were recorded. X-ray examination was performed on the right knee joints of rats for imaging analysis. Enzyme linked immunosorbent assay (ELISA) was performed to detect the tumor necrosis factor-α (TNF-α), serum interleukin-1β (IL-1β), and other pro-inflammatory cytokines in rat serum samples, as well as the expression levels of neurogenic inflammatory mediators such as nerve growth factor (NGF) and calcitonin gene-related peptide (CGRP). Histopathological changes in the knee joint synovial tissues were examined by hematoxylineosin (HE) staining. Safranin O-fast green staining was performed to observe and evaluate the degree of knee cartilage lesions. Western blot was employed to quantitatively analyze TRPV1, p38 mitogen-activated protein kinase (p38 MAPK), and phosphorylated (p)-p38 MAPK in rat knee synovial tissues. Immunofluorescence (IF) was used to measure and assess M1/M2 macrophage polarization. ResultsCompared with those in the sham group, the circumference and joint diameter of the right knee were markedly enlarged in the model group (P<0.01), while PPTs of rats showed a significant reduction (P<0.01). The contents of IL-1β, TNF-α, CGRP, and NGF in rats' serum were significantly elevated (P<0.01), and the synovial Krenn score was increased (P<0.01). The Mankin score of cartilage tissue was increased (P<0.01), and the protein expressions of TRPV1 and p-p38 MAPK/p38 MAPK were significantly upregulated (P<0.01). The experimental intervention significantly reduced the proportion of pro-inflammatory M1 macrophages in the total macrophage population (P<0.01), and the percentage of M2 macrophages was decreased (P<0.01). The M1/M2 macrophage ratio was significantly elevated (P<0.01). Knee joint diameters of all dose groups of Huamoyan granules and the celecoxib group were reduced (P<0.01) compared with those of the model group, and the PPT recovery speeds in the high and medium-dose groups of Huamoyan granules were more obvious (P<0.05). The contents of IL-1β, CGRP, and NGF in the rats' serum in all administration groups were significantly reduced (P<0.05, P<0.01), and the content of TNF-α in rats' serum was significantly reduced (P<0.01). All dose groups of Huamoyan granules demonstrated significant reductions in both synovial Krenn score (P<0.05, P<0.01) and protein expression of TRPV1 and p-p38 MAPK/p38 MAPK in rats' synovial tissues (P<0.01). The percentage of M1 macrophages in the synovial tissues of the celecoxib group and all dose groups of Huamoyan granules was decreased (P<0.01). The percentage of M2 macrophages was increased (P<0.05), and the M1/M2 ratio was decreased (P<0.01). ConclusionHuamoyan granules can alleviate the inflammatory response of KOA, reduce the release of inflammatory pain mediators, and downregulate TRPV1 protein expression by regulating macrophage polarization. Its mechanism may be related to the TRPV1/p38 MAPK signaling pathway, thereby achieving the effect of improving peripheral pain hypersensitivity in KOA.
2.Construction and Application of A Digital System for "Disease-pulse-syndrome-treatment Differentiation" Paradigm
Tiantian FAN ; Ying LYU ; Ru NIU ; Xiaojie KANG ; Fenglan WANG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(4):217-225
In the context of the digital-intelligent era of traditional Chinese medicine (TCM), the lack of clinical thinking is a pressing issue that limits the overall effectiveness of TCM and talent cultivation. The "disease-pulse-syndrome-treatment differentiation" thinking model, originally developed by ZHANG Zhongjing in the Treatise on Cold Damage and Miscellaneous Diseases (Shang Han Za Bing Lun), has served as a guideline and paradigm followed by generations of medical practitioners. This study aims to construct a digitalized "disease-pulse-syndrome-treatment differentiation" thinking system, develop a digital assessment system, and implement it for practical application. The goal is to recommend a digitalized assessment model for TCM and provide a reference for the integrated innovation of talent cultivation in medicine, education, and research. First, based on the complex diagnostic and treatment framework of the Treatise on Cold Damage Diseases (Shang Han Lun), the research team previously established a "process" + "result" thinking model that included four processes and ten steps. This study integrates knowledge unit theory and digital technology to create a digital system for "disease-pulse-syndrome-treatment differentiation" with a dual-control model of "process control" and "result control". The system consists of 46 items across three categories: knowledge body (W=20%), knowledge element (W=30%), and knowledge element associations (W=50%). Second, a mixed-methods research design was employed, combining qualitative and quantitative approaches. The Delphi method was used to establish hierarchical levels and screen items, while the analytic hierarchy process (AHP) was used to assign weights. Expert surveys were conducted to reach a consensus and further validate the rationale and necessity of the system. Finally, based on the system architecture and integrating key computer technologies, a digital assessment system for "disease-pulse-syndrome-treatment differentiation" was developed. The Treatise on Cold Damage Diseases (Shang Han Lun) was used as a case study to validate the system's feasibility. Statistical results showed that the difficulty level of the assessment question bank was moderate (DL ranging from 0.65 to 0.89), with good discrimination (D>0.4), and reasonable reliability and validity (Cronbach's α=0.84, KMO=0.72, Bartlett's test P<0.01). The system can perform process-oriented evaluations of candidates' thinking in "disease-pulse-syndrome-treatment differentiation" and effectively achieve the goal of clinical thinking assessment through a combination of "process control" and "result control". The examination system offers three major advantages. It standardizes, objectifies, and streamlines the assessment of thought processes, facilitates the organic transformation of TCM education from outcome-based education to thinking-based education, and from exam-oriented education to competency-oriented education, and promotes the practical transformation of TCM assessments from qualitative to quantitative evaluation, as well as from theory to practice. In summary, this system not only represents a technological upgrade to traditional examinations but also empowers the cultivation and assessment of clinical talent in the digital-intelligent era, demonstrating broad application prospects.
3.Research progress in the signaling pathways of thyroid-associated ophthalmopathy
Xiaoying LIU ; Xianfang PU ; Jianshu KANG
International Eye Science 2026;26(3):467-472
Thyroid-associated ophthalmopathy(TAO)is a common autoimmune complication in thyroid diseases. Its pathogenesis is complex and involves the abnormal activation of multiple signaling pathways. With the rapid development of molecular biology and genomics technologies, the signal transduction mechanisms and regulatory networks related to TAO have been deeply analyzed. At present, studies have found that the interaction between the TSH receptor(TSHR)and the insulin-like growth factor-1 receptor(IGF-1R)signaling pathway, as well as immune inflammation-related pathways, oxidative stress, and calcium signaling pathways, play important roles in the pathogenesis of TAO. In addition, the research on the regulatory mechanism of non-coding RNA and fibrosis-related signaling molecules has gradually become the focus. Despite much advancement, there are still many unsolved mysteries regarding the exact pathogenesis of TAO. This article aims to systematically review the latest research progress of the main signaling pathways of TAO. By combining the latest achievements in gene expression profiles, single-cell sequencing and drug design, it analyzes potential therapeutic targets and the development directions of innovative drugs, providing a theoretical basis for the pathological mechanism of TAO and a scientific basis for the optimization of clinical treatment strategies at the same time.
4.Research Advances in Construction Methods and Novel Technologies for Animal Models of Pulmonary Hypertension
Ziyi CHEN ; Hongyan SUN ; Pinfang KANG ; Wenjuan WU
Laboratory Animal and Comparative Medicine 2026;46(1):81-93
Pulmonary hypertension (PH), marked by sustained elevation of pulmonary artery pressure, imposes a heavy burden on the right ventricle and may culminate in right heart failure. Its pathogenesis is multifaceted, encompassing endothelial dysfunction, vascular smooth muscle proliferation, inflammation, thrombosis, and genetic factors. Animal models serve as core tools for exploring PH mechanisms and therapies, each with unique strengths and limitations. The single-dose monocrotaline (MCT) model is one of the most commonly used experimental animal models of PH and is widely applied in mechanistic studies, drug screening, and efficacy evaluation; it offers simplicity and cost-effectiveness, can induce PH within a short period, yet its pathophysiology differs to some extent from human idiopathic PH. In contrast, the Sugen5416 combined with chronic hypoxia model better mimics PH progression by placing animals under hypoxic conditions to induce pulmonary vasoconstriction and vascular remodeling, but it requires a longer modelling time, and the degree of hypoxia has a substantial impact on experimental outcomes. Beyond these two commonly used modeling approaches, a variety of emerging techniques have been applied in PH research; gene-editing technologies enable precise investigation of specific gene functions in PH. Additionally, induced pluripotent stem cell-based 3D organoid technology allows for individualized modelling while preserving patients' genetic information for precise clinical translation. Each model or technology can simulate different aspects of the pathological processes of human PH, and their findings provide key insights into the nature of the disease and serve as an important platform for the development of novel therapeutic targets. This paper comprehensively describes various animal models and emerging technologies used in PH research, analyzing their characteristics, applications, and limitations, with the aim of providing experimental and technical support for the development of new therapeutic strategies and drugs.
5.Quality Evaluation of Naomaili Granules Based on Multi-component Content Determination and Fingerprint and Screening of Its Anti-neuroinflammatory Substance Basis
Ya WANG ; Yanan KANG ; Bo LIU ; Zimo WANG ; Xuan ZHANG ; Wei LAN ; Wen ZHANG ; Lu YANG ; Yi SUN
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(2):170-178
ObjectiveTo establish an ultra-performance liquid fingerprint and multi-components determination method for Naomaili granules. To evaluate the quality of different batches by chemometrics, and the anti-neuroinflammatory effects of water extract and main components of Naomaili granules were tested in vitro. MethodsThe similarity and common peaks of 27 batches of Naomaili granules were evaluated by using Ultra performance liquid chromatography (UPLC) fingerprint detection. Ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS) technology was used to determine the content of the index components in Naomaili granules and to evaluate the quality of different batches of Naomaili granules by chemometrics. LPS-induced BV-2 cell inflammation model was used to investigate the anti-neuroinflammatory effects of the water extract and main components of Naomaili granules. ResultsThe similarity of fingerprints of 27 batches of samples was > 0.90. A total of 32 common peaks were calibrated, and 23 of them were identified and assigned. In 27 batches of Naomaili granules, the mass fractions of 14 components that were stachydrine hydrochloride, leonurine hydrochloride, calycosin-7-O-glucoside, calycosin,tanshinoneⅠ, cryptotanshinone, tanshinoneⅡA, ginsenoside Rb1, notoginsenoside R1, ginsenoside Rg1, paeoniflorin, albiflorin, lactiflorin, and salvianolic acid B were found to be 2.902-3.498, 0.233-0.343, 0.111-0.301, 0.07-0.152, 0.136-0.228, 0.195-0.390, 0.324-0.482, 1.056-1.435, 0.271-0.397, 1.318-1.649, 3.038-4.059, 2.263-3.455, 0.152-0.232, 2.931-3.991 mg∙g-1, respectively. Multivariate statistical analysis showed that paeoniflorin, ginsenoside Rg1, ginsenoside Rb1 and staphylline hydrochloride were quality difference markers to control the stability of the preparation. The results of bioactive experiment showed that the water extract of Naomaili granules and the eight main components with high content in the prescription had a dose-dependent inhibitory effect on the release of NO in the cell supernatant. Among them, salvianolic acid B and ginsenoside Rb1 had strong anti-inflammatory activity, with IC50 values of (36.11±0.15) mg∙L-1 and (27.24±0.54) mg∙L-1, respectively. ConclusionThe quality evaluation method of Naomaili granules established in this study was accurate and reproducible. Four quality difference markers were screened out, and eight key pharmacodynamic substances of Naomaili granules against neuroinflammation were screened out by in vitro cell experiments.
6.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
7.Cerium dioxide nanoparticles regulate expression of inflammatory factors in M1 macrophages and affect fibroblast co-culture system
Peisen XIE ; Zhenpeng GUAN ; Xianjie WEI ; Keshi ZHANG ; Qingyuan KANG ; Wentao XIAO ; Xiaoshuai GUO
Chinese Journal of Tissue Engineering Research 2026;30(2):375-383
BACKGROUND:Macrophage polarization plays a key role in chronic inflammatory joint diseases such as rheumatoid arthritis.Cerium dioxide(CeO2)nanoparticles have a wide range of biomedical applications such as modulating the local inflammatory microenvironment of tissues.OBJECTIVE:To investigate the role of CeO2 nanoparticles on macrophage polarization and inflammatory factor expression,as well as inflammatory modulation in a co-culture system of macrophages and fibroblasts.METHODS:(1)CeO2 nanoparticles were dispersed and observed morphologically by transmission electron microscopy.(2)Human leukemia monocytes(THP-1)were induced to differentiate and establish the M1 macrophage pro-inflammatory cell model of rheumatoid arthritis.The cells were divided into M0 group(undifferentiated macrophages),M1 group(successful macrophage modeling),CeO2 nanoparticle treatment group(M1 group with CeO2 nanoparticle treatment),and dexamethasone control group(M1 group with dexamethasone treatment)and incubated for 48 hours.The effects of CeO2 nanoparticles on the expression of inflammatory factors(endogenous nitric oxide synthase,CD86,CD80)in M1 macrophages and M1 macrophage phenotype(CD80,CD206)were detected by RT-qPCR,western blot assay,and flow cytometry.(3)A co-culture system of macrophages and fibroblasts was established,and CeO2 nanoparticles acted on the upper macrophages.The regulation of CeO2 nanoparticles on the expression of inflammatory factors(interleukin-6,tumor necrosis factor-α,cyclooxygenase-2,and endogenous nitric oxide synthase)of fibroblasts in the co-culture system was observed at the mRNA and protein levels.RESULTS AND CONCLUSION:(1)Transmission electron microscopy showed that the diameter of CeO2 nanoparticles was(19.5±2.0)nm.(2)Compared with the M0 group,the mRNA of endogenous nitric oxide synthase and CD86,and the protein expression of endogenous nitric oxide synthase and CD80 in the M1 group were upregulated.Compared with the M1 group,the mRNA expression of endogenous nitric oxide synthase and CD86,and the protein expression of endogenous nitric oxide synthase and CD80 in the CeO2 nanoparticle treatment group were downregulated.Flow cytometry showed that 20 nm CeO2 nanoparticles downregulated the number of M1 macrophages.(3)Compared with the M1 group,20 nm CeO2 nanoparticles downregulated the mRNA and protein expression of inflammatory factors(tumor necrosis factor α,interleukin 6,cyclooxygenase 2,and endogenous nitric oxide synthase)in the co-culture system HFL1 cells.(4)The results showed that 20 nm CeO2 nanoparticles can alleviate inflammation in the co-culture system by inhibiting the expression of pro-inflammatory factors in M1 macrophages,providing a new idea for the treatment of inflammatory diseases such as rheumatoid arthritis.
8.Mitogen-activated protein kinase signaling pathway regulates the development of osteoarthritis:guiding targeted therapy with traditional Chinese medicine
Hao LI ; Hongcheng TAO ; Ping ZENG ; Jinfu LIU ; Qiang DING ; Chicheng NIU ; Kai HUANG ; Hongyu KANG
Chinese Journal of Tissue Engineering Research 2026;30(6):1476-1485
BACKGROUND:Osteoarthritis is pathologically characterized by progressive degeneration of the articular cartilage and abnormal deformation of the subchondral bone.In recent years,with the deepening of medical research,it has been found that the mitogen-activated protein kinases(MAPK)signaling pathway has a regulatory role in inflammatory cell infiltration,inflammatory factor release,and chondrocyte proliferation,which is particularly important for the treatment of osteoarthritis.OBJECTIVE:To briefly review the main research progress in the mechanism of MAPK signaling pathway regulating osteoarthritis in recent years,aiming to provide new ideas for the treatment of osteoarthritis.METHODS:CNKI,WanFang and PubMed databases were searched for relevant literature using the search terms of"mitogen-activated protein kinases,osteoarthritis,extracellular signal-regulated MAP kinases,p38 mitogen-activated protein kinases,JNK mitogen-activated protein kinase"in Chinese and English.Relevant literature published from January 2019 to November 2024 was searched,and 108 articles were finally included for summary analysis.RESULTS AND CONCLUSION:(1)Various stimuli inside and outside the cells activate the MAPK signaling pathway,regulate gene transcription and protein synthesis,and promote the release of inflammatory factors,such as tumor necrosis factor-α,interleukin-1β,and interleukin-6.The release of these inflammatory factors aggravates the progression of osteoarthritis.(2)The active ingredients of traditional Chinese medicine,mainly saponins and flavonoids,as well as Chinese herbal formulas and preparations with the main effects of activating blood circulation and removing blood stasis,tonifying the liver and kidney,can play a therapeutic role in osteoarthritis by inhibiting the MAPK signaling pathway,regulating the release of matrix metalloproteinases,balancing the homeostatic state of osteogenesis and osteoblastogenesis,attenuating the synovial inflammation,decreasing the release of inflammatory factors and inflammatory vesicles,decreasing cellular pyroptosis,promoting autophagy,and ameliorating oxidative stress.(3)Although traditional Chinese medicine has become popular in the treatment of osteoarthritis by virtue of its own advantages of multi-components,multi-targets,multi-pathways,and low side effects,the use of MAPK signaling pathway to guide the treatment of individual osteoarthritis is the difficulty of the technology,which needs to be continuously researched and explored.(4)Therefore,further development of relevant herbal inhibitors that can modulate the MAPK signaling pathway may be a potential drug strategy for the treatment of osteoarthritis in the future.
9.Relationship between Alzheimer's disease and sarcopenia and body mass index:analysis of GWAS datasets for European populations
Qiwang HE ; Bo CHEN ; Fuchao LIANG ; Zewei KANG ; Yuan ZHOU ; Anxu JI ; Xialin TANG
Chinese Journal of Tissue Engineering Research 2026;30(4):1036-1046
BACKGROUND:Alzheimer's disease has been associated with sarcopenia,but a causal relationship has not been established.Exploring the causal relationship between the two most common disability-burdening diseases in the aging population-Alzheimer's disease and sarcopenia-and their potential mediating factors holds certain implications for further alleviating the healthcare costs and socioeconomic burden for older adults in China.OBJECTIVE:To explore the potential causal relationship between Alzheimer's disease and sarcopenia in the general population using a Mendelian randomization study and to explore the role of body mass index in this context.METHODS:Two-sample Mendelian randomization analysis based on published genome-wide association studies(GWAS)were used to infer causality,and univariate Mendelian randomization and mediation analyses were used in the study design.Through the Integrative Epidemiology Unit(IEU)database,ieu-b-2 was selected as the Alzheimer's disease dataset(sample size:63 926),ieu-b-4816 as the body mass index dataset(99 998),ebi-a-GCST90000027 as the appendicular lean mass dataset(244 730),ukb-b-7478 as the left hand grip strength dataset(461 026),ukb-b-10215 as the right hand grip strength dataset(461 089)and ukb-b-4711 as the walking pace dataset(459 915).Inverse-variance weighting was used as the primary analysis method,and the results were validated by pleiotropy and heterogeneity analysis.The Steiger Directionality Test was performed to validate the reasonableness of the causal direction.RESULTS AND CONCLUSION:(1)The Mendelian randomization analyses provided evidence that Alzheimer's disease predicted the risk of appendicular lean mass[odds ratio(OR)=1.009;95%confidence interval(Cl),1.001-1.017;P=0.023),and walking pace(OR=1.010;95%Cl,1.003-1.017;P=0.008).No correlation with hand grip strength was observed.(2)Alzheimer's disease was negatively correlated with body mass index(OR=0.893;95%Cl,0.811-0.984;P=0.022);body mass index was positively correlated with appendicular lean mass(OR=1.084;95%Cl,1.031-1.141;P=0.002)and negatively correlated with walking pace(OR=0.975;95%Cl,0.969-0.980;P<0.001).(3)Mediation analyses showed that the causal relationship between Alzheimer's disease and appendicular lean mass and walking pace was partially mediated by body mass index,with the proportion of mediations being 50.25%and 32.11%,respectively.(4)The results of this study suggest that based on large-scale population studies,genetic prediction of Alzheimer's disease is a potential risk factor for sarcopenia,in which body mass index plays an important mediating role.This suggests that in clinical practice,attention should be paid to the muscle condition of patients with Alzheimer's disease,and weight management should be implemented,as maintaining a body mass index within the normal high range may have a preventive effect on the occurrence of sarcopenia in patients with Alzheimer's disease.However,further research is needed to verify the applicability of this conclusion to other ethnic groups.This study utilized an international public database for analysis,providing a reference for research on the correlation between Alzheimer's disease and sarcopenia in the Chinese population.It also highlights the significant mediating role of body mass index,offering insights for further prevention and treatment of sarcopenia among Chinese individuals.
10.Finite element analysis of implants with different crown-to-implant ratios under different bone conditions
Zirui KANG ; Yang WU ; Hailong SONG ; Qiaoyun YANG ; Lixiang ZANG ; Dongliang XU
Chinese Journal of Tissue Engineering Research 2026;30(2):319-328
BACKGROUND:Clinical studies suggest that both bone quality and excessive crown-to-implant ratio are factors that affect the success rate of implant surgery,but there is no consensus on how large the crown-to-implant ratio under each bone quality will affect the prognosis of implant repair.OBJECTIVE:To analyze the stress and strain of bone tissue around implant restorations with different crown-to-implant ratios under different bone types after stress loading using three-dimensional finite element method.Combined with the Frost bone mechanics regulation system theory,the physiological limits of bone strain were observed for each bone type within a certain range of crown to implant ratios.METHODS:Cone beam CT data were selected from a patient to establish solid bone block models with four different bone types(class Ⅰ bone:cortical bone thickness 3 mm+dense cancellous bone,class Ⅱ bone:cortical bone thickness 2 mm+relatively dense cancellous bone,class Ⅲ bone:cortical bone thickness 1 mm+relatively low-density cancellous bone,class Ⅳ bone:cortical bone thickness 1 mm+low-density cancellous bone).Implant restorations with five different crown-to-implant ratios(1,1.5,2,2.5,and 3)were created on each bone block model,for a total of 20 models.Vertical and oblique forces were applied to the dental crown to observe the von Mises stress values,strains,and displacement of the cortical and cancellous bones,as well as the degree of implant displacement.RESULTS AND CONCLUSION:(1)In the class Ⅰ bone model,when the crown-to-implant ratio reached 3 under oblique loading,the cortical bone strain exceeded the physiological limit.In the class Ⅱ bone model,under oblique loading,when the crown-to-implant ratio reached 2.5,the cortical bone strain exceeded the physiological limit.In the class Ⅲ bone model,under oblique loading,cortical bone exceeded the physiological limit when the crown-to-implant ratio reached 2.5,while cancellous bone reached the critical physiological limit at 1.In the class Ⅳ bone model,under oblique loading,when the crown-to-implant ratio reached 1.5,2,2.5,and 3,the cortical bone strain exceeded the physiological limit.In the class Ⅳ bone model,all five crown-to-implant ratios of cancellous bone exceeded physiological limits.(2)Under vertical load,the cancellous bone strain exceeded the physiological limit when the crown-root ratio reached 1,2,2.5,and 3 in the class Ⅲ bone model,and when the cancellous bone strain of the five crown-root ratios in the class Ⅳ bone model exceeded the physiological limit.(3)Under oblique or vertical load,the implant displacement of the 20 groups of models did not exceed 100 μm.(4)From the perspective of biomechanics,when patients with insufficient bone height choose implant restoration,the crown-root ratio that class Ⅰ bone can tolerate is up to 2.5 times,the crown-root ratio that class Ⅱ bone can tolerate is up to 2 times,and the crown-root ratio that class Ⅲ and class Ⅳ bones can tolerate is up to 1 times due to excessive strain of cancellous bone;but the crown-root ratio that cortical bone in class Ⅲ bone can tolerate is up to 2 times.Whether class Ⅲ bone can tolerate implant restoration with a high crown-root ratio and whether cancellous bone can tolerate higher strains needs further study.

Result Analysis
Print
Save
E-mail