1.Analysis of the regional distribution differences of common variations of the MMACHC gene in cblC methylmalonic acidemia patients
Yuxin DENG ; Lili HAO ; Si DING ; Yi DING ; Wenjuan QIU ; Huiwen ZHANG ; Lili LIANG ; Kaichuang ZHANG ; Yi YANG ; Ruifang WANG ; Xuefan GU ; Lianshu HAN
Chinese Journal of Pediatrics 2024;62(11):1076-1082
Objective:To analyze regional differences in MMACHC gene variations among patients with cblC-type methylmalonic acidemia (MMA) in China and to explore the relationship between these variations and neonatal screening, biochemical markers and prognosis.Methods:Retrospective case summary. Clinical and laboratory data, including general condition, biochemical markers and genetic analysis, were collected from 1 859 cblC MMA patients from 2005 to 2023. Patients were divided into 7 groups according to their regions: north China, northeast China, east China, central China, south China, southwest China and northwest China. They were also classified into neonatal screening and non-neonatal screening groups. Mann-Whitney U and Kruskal-Wallis tests were used to compare biochemical marker levels. In contrast, the Chi-square test was applied to compare MMACHC gene variant frequencies, neonatal screening proportion, onset age and prognosis between groups. Results:Among 1 859 cases of cblC MMA, 1 019 were male and 840 were female, with a consultation age of 1.0 (0.1, 5.0) month. A total of 1 787 cases carried compound heterozygous or homozygous variants and only 1 variant site was identified in 72 cases. The 10 most frequent variants were c.609G>A (1 238 cases), c.658_660delAAG (343 cases), c.80A>G (284 cases), c.482G>A (239 cases), c.567dupT (191 cases), c.656_658delAGA (131 cases), c.217C>T (109 cases), c.394C>T (105 cases), c.445_446delTG (51 cases) and c.1A>G (50 cases). The frequency of the c.609G>A was the lowest in northwest China (28.8% (44/154), χ2=-18.42, P<0.05). The frequency of the c.567dupT was the most common in southwest China (25.0% (20/80), χ2=71.70, P<0.001) and c.656_658delAGA had the highest frequency in northeast China (9.3% (19/205), χ2=32.08, P<0.001). Non-missense variants (91.2% (62/68), 88.5% (46/52)) and early-onset patients (90.0% (36/40), 94.4% (34/36)) were both more prevalent in southwest and south China ( χ2=14.95, 31.69, both P<0.05). The proportion of neonatal screening was the lowest in south China (22.2% (8/36), χ2=98.48, P<0.05), where the mortality rate was the highest (19.1% (4/21), χ2=38.98, P<0.001). East China exhibited the highest frequency of missense variants (21.5% (339/1 579)), the highest proportion of patients identified through neonatal screening (54.5% (465/853)), and a more significant proportion of patients with good prognosis (36.6% (227/621), χ2=14.57, 93.49, 38.98, all P<0.05). In addition, the c.482G>A variant was more frequent in patients diagnosed by neonatal screening compared to those diagnosed by other methods (8.3% (132/1 586) vs. 5.9% (122/2 060), χ2=7.97, P<0.05). Conclusions:The frequency of MMACHC gene variation varies across different regions. The c.609G>A was least frequent in northwest China, c.567dupT was most common in southwest China, and c.656_658delAGA was most prevalent in northeast China. South China had the lowest neonatal screening rate and the highest mortality. At the same time, east China exhibited the highest frequency of missense variants, the highest proportion of patients identified through neonatal screening and the best prognosis. The c.482G>A variant was more frequent in patients diagnosed by neonatal screening compared to those diagnosed by other methods.
2.Analysis of disease spectrum for abnormal 3-hydroxyisovalerylcarnitine metabolism identified through newborn screening and clinical diagnosis.
Yi YANG ; Wenjuan QIU ; Huiwen ZHANG ; Lili LIANG ; Deyun LU ; Kaichuang ZHANG ; Ting CHEN ; Feng XU ; Xuefan GU ; Lianshu HAN
Chinese Journal of Medical Genetics 2023;40(12):1466-1471
OBJECTIVE:
To explore the disease spectrum for abnormal 3-hydroxyisovalerylcarnitine (C5OH) metabolism identified through newborn screening and clinical diagnosis patients and the key points for differential diagnosis so as to raise the awareness of pediatricians for such diseases.
METHODS:
Clinical data of 85 neonates with abnormal C5OH metabolism identified from February 2004 to January 2022 at Xinhua Hospital Affiliated to Shanghai Jiao Tong University School of Medicine were collected. Their clinical manifestations and results of tandem mass spectrometry (MS/MS), gas chromatography mass spectrometry (GC-MS) and genetic testing were retrospectively analyzed.
RESULTS:
Among the 85 cases, 46 (54.1%) were identified by neonate screening, whilst 39 (45.9%) were clinically diagnosed patients. Five diseases were diagnosed, including 28 cases with multiple carboxylase deficiency (MCD, 32.9%), 29 cases with 3-methylcrotonyl-coenzymeAcarboxylasedeficiency (MCCD, 34.1%), 4 cases with 3-methylglutaconic acid (3-MGA, 4.7%), 7 cases with 3-hydroxy-3-methylglutaric acid (3-HMG, 8.2%), and 17 cases with beta-ketothiolase deficiency (BKD, 20.0%). The disorders were characterized by sudden onset, anorexia, vomiting, diarrhea, abnormal breathing, consciousness disorder, spasm and developmental delay.
CONCLUSION
Among newborns with abnormal C5OH metabolism, MCCD is the most common disorder, which was followed by BKD and MCD. For patients with abnormal C5OH metabolism, MCD is the most common, followed by BKD and 3-HMG. C5OH related diseases have great heterogeneity. Combination of blood acylcarnitine levels, urinary organic acid levels and genetic testing based on clinical characteristics can help to attain the diagnosis.
Humans
;
Infant, Newborn
;
China
;
Neonatal Screening
;
Retrospective Studies
;
Tandem Mass Spectrometry/methods*
3. The effect of extending proximal landing zone in thoracic endovascular aortic repair on the prognosis of Stanford type B aortic dissection
Xing ZHANG ; Jinbao QIN ; Weimin LI ; Minyi YIN ; Kaichuang YE ; Xinrui YANG ; Xinwu LU
Chinese Journal of Surgery 2018;56(10):760-763
With the continuous development of endovascular surgery, thoracic endovascular aortic repair (TEVAR) has gradually replaced traditional open surgery and has become the preferred treatment strategy for Stanford type B aortic dissection. However, the disadvantage of the short proximal landing zone greatly limited the indication of TEVAR surgery and affected the prognosis. In recent years, many strategies such as hybrid surgery, in vitro fenestrated and branched aortic endo-graft, chimney technique, in-situ fenestration technique, etc., have been developed, which greatly broadens the TEVAR indication and improved the prognosis.
4.Analysis of NF2 gene mutations in intraspinal Schwannomas.
Shuyi LIU ; Shi CHEN ; Kaichuang ZHANG ; Jian LIN ; Qingwu YANG ; Yongliang ZHANG ; Shuiyuan LIU ; Shengze LIU
Chinese Journal of Medical Genetics 2017;34(5):637-641
OBJECTIVETo explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene.
METHODSSamples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.
RESULTSFour de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.
CONCLUSIONThe occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.
Adult ; Aged ; Female ; Genes, Neurofibromatosis 2 ; Humans ; Male ; Middle Aged ; Mutation ; Neurilemmoma ; genetics ; Spinal Cord Neoplasms ; genetics
5.Application value of diode laser in situ fenestration in the thoracic endovascular aortic repair for the treatment of aortic arch disease
Xing ZHANG ; Jinbao QIN ; Weimin LI ; Minyi YIN ; Kaichuang YE ; Xinwu LU
Chinese Journal of Digestive Surgery 2017;16(11):1118-1122
Objective To evaluate the application value of diode laser in situ fenestration in the thoracic endovascular aortic repair (TEVAR) for the treatment of aortic arch disease.Methods The retrospective crosssectional study was conducted.The clinical data of 110 patients with aortic arch disease who underwent TEVAR using diode laser in situ fenestration in the Ninth People's Hospital of Shanghai Jiaotong University School of Medicine from January 2014 to June 2017 were collected.TEVAR using diode laser in situ fenestration was performed according to the lesion involving the three branches of aortic arch.Observation indicators:(1) surgical and intraoperative situations;(2) follow-up.All patients were followed up by outpatient examination,inpatient examination and telephone interview up to May 2017.CT angiography was performed to evaluate the patency of the stents and presence of endoleak at 3,6,and 12 months postoperatively.Measurement data with normal distribution were represented as x ±s.Results (1) Surgical and intraoperative situations:106 of 110 patients underwent successful TEVAR using diode laser in situ fenestration.Intraoperative digital subtraction angiography (DSA) showed that primary aortic dissection incisions were completely closed,with a patency of all stents and no fenestration-related endoleaks.The surgical success rate was 96.36% (106/110).Two patients died of intraoperative pericardial tamponade and 2 received chimney stent implantation after complex anatomic configuration of the aortic arch inducing to failure of the innominate artery fenestration.Of 106 patients,70 received left subclavian arterial fenestration,30 received 3 aortic branches fenestration and 6 received both left subclavian arterial and left common carotid arterial fenestrations.The operation time and dose of contrast agent in 110 patients were respectively (140±9)minutes and (185±-5)mL.Four patients had postoperative complications,1 died of severe pulmonary infection and 3 with cerebral infarction were improved by anti-platelet,brain nerve nutrition and other symptomnatic treatment.Other patients had no transient ischemic attack,stroke,brain infarction,myocardial infarction or other neurological complications.Duration of hospital stay of the 110 patients was (15 ± 7)days.(2) Follow-up:99 of 107 patients were followed up for 2-17 months,with a median time of 10 months.During the follow-up,there were patencies of all stents,and endoleaks of 4 patients occurred and were closely followed up and observed.Conclusion The diode laser in situ fenestration is safe and feasible in the TEVAR for the treatment of aortic arch disease,with satisfactory short-term outcomes.
6.Expression and significances of Merlin and mTOR in spinal schwannoma
Shengze LIU ; Kaichuang ZHANG ; Yongliang ZHANG ; Jian LIN ; Shi CHEN
Cancer Research and Clinic 2015;27(4):253-255
Objective To clarify the expression and clinicopathological significances of mTOR and Merlin proteins in spinal schwannoma.Methods Immunohistochemical SP method was used to detect the expression levels of mTOR and Merlin proteins in tumor tissues from 21 spinal schwannoma patients.The meaning of the two proteins expression changes on schwannoma was analyzed.Results In 21 cases of schwannoma patients,the mTOR was positive expression in 16 cases,negative expression in 5 cases,while in the normal neural tissue,mTOR was all negative expression.In 21 cases of schwannoma patients,the Merlin protein was negative expression in 18 cases,positive expression in 3 cases,but it was positive in all of normal neural tissue.Merlin protein expression was negatively correlated with mTOR protein expression (r =-0.785,P < 0.001).Conclusion The expression level of mTOR proteins in schwannoma is significantly higher than that in normal nerve tissue,while the expression level of Merlin protein in schwannoma tissue is significantly lower than that in normal nerve tissue.There is an internal relationship between mTOR and Merlin.

Result Analysis
Print
Save
E-mail