Objective: To characterize perioperative dynamic changes in immune-cell phenotypes and inflammatory cytokines in patients undergoing CPB (cardiopulmonary bypass) cardiac surgery, and to explore their associations with postoperative outcomes. Methods: In this prospective cohort study, 120 adult patients who underwent elective cardiac surgery under CPB at West China Hospital from May 2022 to March 2023 were enrolled. Perioperative immune-cell phenotypes and concentrations of 40 inflammation-related cytokines were measured. The primary outcomes were the sequential organ failure assessment (SOFA) score at 24 h after surgery and ΔSOFA (the peak SOFA score within 48 h after surgery minus the preoperative SOFA score). Secondary outcomes included major adverse cardiovascular events (MACE), acute kidney injury (AKI), respiratory failure, severe liver injury, and infection. Results: The mean age of enrolled patients was 57±10 years. Of these, 52% (62/120) were male and 90% (108/120) underwent valve surgery. During the rewarming to the end of CPB, neutrophil counts rapidly increased (7.39×10 /L vs preoperative 3.07×10 /L, P<0.001), with significant upregulation of CD11b (7.30×10 /L vs preoperative 3.05×10 /L, P<0.001) and CD54 (7.15×10 /L vs preoperative 2.99×10 /L, P<0.001). Lymphocyte counts increased at the end of CPB (1.75×10 /L vs preoperative 1.12×10 /L, P<0.001) but decreased significantly at 24 h after surgery (0.59×10 /L vs preoperative 1.12×10 /L, P<0.001). Plasma analysis showed that multiple pro-inflammatory cytokines increased during CPB and remained elevated up to 24 h after surgery; five chemokines and the anti-inflammatory cytokine IL-10 peaked at the end of CPB. The SOFA score increased from 1 (1, 2) preoperatively to 7 (5, 10) at 24 h after surgery, with a ΔSOFA of 6 (4, 8). Within 30 days after surgery, 48 patients (40.0%) developed AKI, 17 (14.2%) developed infection, 4 (3.3%) developed severe liver injury, 3 (2.5%) developed respiratory failure, and 3 (2.5%) experienced MACE. During the 2-year follow-up, 8 patients (6.7%) experienced MACE and 5 (4.2%) died. Conclusion: Multi-organ dysfunction is common after cardiac surgery under CPB (median ΔSOFA, 6), accompanied by perioperative activation of multiple immune-cell subsets and upregulation of pro-inflammatory, anti-inflammatory, and chemotactic mediators. This study provides data-driven evidence and research clues for further investigation of the associations between CPB-related immune perturbations and postoperative organ dysfunction and clinical outcomes.

Lung cancer remains one of the leading causes of cancer-related morbidity and mortality worldwide, and its treatment continues to face major challenges such as therapeutic resistance and tumor recurrence. Pyroptosis, a newly characterized form of programmed cell death, induces tumor cell death through gasdermin-mediated membrane pore formation and is accompanied by the release of inflammatory mediators, thereby playing complex roles in lung cancer initiation, progression, and modulation of the tumor microenvironment. Active components and herbal formulas derived from traditional Chinese medicine can modulate pyroptosis-related signaling pathways through multi-target mechanisms, showing potential advantages in inducing lung cancer cell death, inhibiting proliferation and migration, and reversing chemoresistance. This review systematically summarizes relevant studies from domestic and international sources, focusing on the molecular mechanisms of pyroptosis, its roles in lung cancer development and tumor microenvironment remodeling, and the current research progress on traditional Chinese medicine-based interventions targeting pyroptosis, with the aim of providing references for the prevention and treatment of lung cancer using traditional Chinese medicine.

INTRODUCTION: Obstructive sleep apnoea (OSA) is common in Singapore, with moderate to severe OSA affecting around 30% of residents. These consensus statements aim to provide scientifically grounded recommendations for the management of OSA, standar-dise the management of OSA in Singapore and promote multidisciplinary collaboration. METHOD: An expert panel, which was convened in 2024, identified several areas of OSA management that require guidance. The expert panel reviewed the current literature and developed consensus statements, which were later independently voted on using a 3-point Likert scale (agree, neutral or disagree). Consensus (total ratings of agree and neutral) was set a priori at ≥80% agreement. Any statement not reaching consensus was excluded. RESULTS: The final consensus included 49 statements that provide guidance on the screening, diagnosis and management of adults with OSA. Additionally, 23 statements on the screening, diagnosis and management of paediatric OSA achieved consensus. These 72 consensus statements considered not only the latest clinical evidence but also the benefits and harms, resource implications, feasibility, acceptability and equity impact of the recommendations. CONCLUSION The statements presented in this paper aim to guide clinicians based on the most updated evidence and collective expert opinion from sleep specialists in Singapore. These recommendations should augment clinical judgement rather than replace it. Management decisions should be individualised, taking into account the patient's clinical characteristics, as well as patient and caregiver concerns and preferences.
Humans ; Sleep Apnea, Obstructive/diagnosis* ; Singapore ; Consensus ; Adult

Alzheimer's disease (AD) is the commonest neurodegenerative disease that causes memory decline, cognitive dysfunction and behavior disorders in the aged people. Primary pathological hallmarks of AD include amyloid-β (Aβ), neurofibrillary tangles (NFTs), gliosis, and neuronal loss. Hyperpolarization-activated cyclic nucleotide-gated (HCN) channels have important physiological functions, especially in aspects of controlling the resting membrane potential, pacemaker activity, memory formation, sleep and arousal. This article reviews the structure, distribution, regulation of HCN channels and the role of HCN channels in the pathological mechanisms of AD, aiming to provide drug therapeutic targets for the prevention and treatment of AD.
Humans ; Alzheimer Disease/physiopathology* ; Hyperpolarization-Activated Cyclic Nucleotide-Gated Channels/physiology* ; Animals ; Amyloid beta-Peptides/metabolism*

In this study, potential quality markers(Q-markers) of Schisandrae Chinensis Fructus for treating bronchial asthma were predicted based on analytic hierarchy process(AHP), entropy weight method(EWM), fingerprint, and network pharmacology. AHPEWM was employed to quantitatively identify the Q-markers of Schisandrae Chinensis Fructus. AHP was used to weight the primary indicators(effectiveness, measurability, and specificity), while EWM was employed to analyze the secondary indicators of each primer indicator. Further, through fingerprint combined with network pharmacology, a ″component-target-pathway″ network was constructed to screen the components of Schisandrae Chinensis Fructus for treating bronchial asthma. It was finally determined that schisandrol A,schisandrin A, and schisandrin B were potential Q-markers of Schisandrae Chinensis Fructus in the treatment of bronchial asthma. This study is the first to comprehensively use AHP-EWM, fingerprint, and network pharmacology to screen the key Q-markers of Schisandrae Chinensis Fructus in the treatment of bronchial asthma. This study provides a scientific basis for improving the quality standard of Schisandrae Chinensis Fructus and lays a foundation for studying its material basis in treating bronchial asthma.
Schisandra/chemistry* ; Asthma/drug therapy* ; Drugs, Chinese Herbal/therapeutic use* ; Network Pharmacology ; Humans ; Entropy ; Lignans/analysis* ; Fruit/chemistry* ; Quality Control ; Cyclooctanes ; Polycyclic Compounds/analysis*

This study aims to investigate the anti-tumor effect and mechanism of Guiqi Yiyuan Ointment combined with cisplatin on Lewis lung carcinoma-bearing mice via the protein kinase RNA-like endoplasmic reticulum kinase(PERK)/eukaryotic translation initiation factor 2α(eIF2α)/activated transcription factor 4(ATF4)/C/EBP homologous protein(CHOP) signaling pathway. Sixty SPF-grade male C57BL/6 mice were selected and assigned into a blank group and a modeling group by the random number table method. After modeling of the Lewis lung carcinoma, the mice in the modeling group were randomized into model, cisplatin(5 mg·kg~(-1), once a week), and low-, medium-, and high-dose(1.7, 3.5, and 7.05 g·kg~(-1), respectively, once a day) Guiqi Yiyuan Ointment+cisplatin(5 mg·kg~(-1)) groups(n=10). After 14 days of continuous intervention, the spleen, thymus, and tumor samples of the mice were collected, weighed, and recorded, and the spleen index, thymus index, and tumor suppression rate were calculated. Hematoxylin-eosin(HE) staining was employed to observe the pathological changes in the tumor tissue. The morphological changes of the endoplasmic reticulum of tumor cells were observed by transmission electron microscopy. The positive expression of phosphorylated eIF2α(p-eIF2α) and ATF4 in the tumor tissue was detected by immunofluorescence. Western blot was employed to determine the protein levels of phosphorylated PERK(p-PERK), p-eIF2α, ATF4, CHOP, B-cell lymphoma-2(Bcl-2), Bcl-2-associated X protein(Bax), cyclin-dependent kinase inhibitor 1A(p21), and cyclinD1 in the tumor tissue. Real-time fluorescent quantitative PCR was employed to determine the mRNA levels of PERK, eIF2α, ATF4, CHOP, Bax, Bcl-2, p21, and cyclinD1 in the tumor tissue. Compared with the blank group, the model group showed decreases in spleen index and thymus index(P<0.05). Compared with the model group, the cisplatin group showed decreases in spleen index and thymus index(P<0.05), and the medium-and high-dose Guiqi Yiyuan Ointment+cisplatin groups presented increases in spleen index and thymus index(P<0.05). In addition, the treatment groups all showed decreased tumor mass(P<0.05), increased tumor cell lysis and nuclear rupture, widened gap between rough endoplasmic reticulum, enhanced average fluorescence intensity of p-eIF2α and ATF4(P<0.05), up-regulated protein levels of p-PERK/PERK, p-eIF2α/eIF2α, ATF4, CHOP, Bax, and p21(P<0.05), down-regulated protein and mRNA levels of Bcl-2 and cyclinD1(P<0.05), and up-regulated mRNA levels of PERK, eIF2α, ATF4, CHOP, Bax, and p21(P<0.05). Compared with the cisplatin group, the combination groups showed increases in spleen index and thymus index(P<0.05) as well as mean optical density(P<0.05), and the high-dose Guiqi Yiyuan Ointment+cisplatin group showed decreased tumor mass(P<0.05). In addition, the medium-and high-dose Guiqi Yiyuan Ointment+cisplatin groups showcased enhanced average fluorescence intensity of p-eIF2α and ATF4(P<0.05), up-regulated protein levels of p-PERK/PERK, p-eIF2α/eIF2α, ATF4, CHOP, Bax, and p21(P<0.05), down-regulated protein and mRNA levels of Bcl-2 and cyclinD1(P<0.05), and up-regulated mRNA levels of PERK, eIF2α, ATF4, CHOP, Bax, and p21(P<0.05). In conclusion, Guiqi Yiyuan Ointment combined with cisplatin can effectively inhibit the growth of Lewis lung carcinoma in mice by regulating the expression of proteins related to the PERK/eIF2α/ATF4/CHOP signaling pathway and promoting cell cycle arrest and apoptosis.
Animals ; Cisplatin/administration & dosage* ; Activating Transcription Factor 4/genetics* ; Eukaryotic Initiation Factor-2/genetics* ; eIF-2 Kinase/genetics* ; Carcinoma, Lewis Lung/pathology* ; Drugs, Chinese Herbal/administration & dosage* ; Male ; Mice ; Signal Transduction/drug effects* ; Mice, Inbred C57BL ; Transcription Factor CHOP/genetics* ; Ointments/administration & dosage* ; Humans ; Cell Proliferation/drug effects* ; Antineoplastic Agents/administration & dosage*

Constructing an efficient and easy-to-operate multigene expression system is currently a crucial part of plant genetic engineering. In this study, a fragment carrying three independent gene expression cassettes and the expression unit of the gene-silencing suppressor protein(RNA silencing suppressor 19 kDa protein, P19) simultaneously was designed and constructed. This fragment was cloned into the commonly used plant expression vector pCAMBIA300, and the plasmid pC1300-TP2-P19 was obtained. Each gene expression cassette consists of different promoters, fusion tags, and terminators. The target gene can be flexibly inserted into the corresponding site through enzymatic digestion and ligation or recombination and fused with different protein tags, which provides great convenience for subsequent detection. The enhanced green fluorescent protein(eGFP) reporter gene was individually constructed into each expression cassette to verify the feasibility of this vector system. The results of tobacco transient expression and laser-confocal microscopy showed that each expression cassette presented independent and normal expression. Meanwhile, the three key enzyme genes in the betanin synthesis pathway, BvCYP76AD, BvDODA1, and DbDOPA5GT, were constructed into the three expression cassettes. The results of tobacco transient expression phenotype, protein immunoblotting(Western blot), and chemical detection of product demonstrated that the three exogenous genes were highly expressed, and the target compound betanin was successfully produced. The above results indicated that the constructed multigene expression system for plants in this study was efficient and reliable and can achieve the co-transformation of multiple plant genes. It can provide a reliable vector platform for the analysis of plant natural product synthesis pathways, functional verification, and plant metabolic engineering.
Nicotiana/metabolism* ; Genetic Vectors/metabolism* ; Gene Expression Regulation, Plant ; Plant Proteins/metabolism* ; Plants, Genetically Modified/metabolism* ; Genetic Engineering/methods* ; Green Fluorescent Proteins/metabolism* ; Gene Expression

To improve the consistency of outcome documentation and address the potential for outcome reporting bias in clinical trials involving integrative Chinese and Western medicine (ICWM) for ulcerative colitis (UC), we aim to develop a customized core outcome set (COS) that incorporates input from various stakeholders. The study design of this COS has been informed by the Core Outcome Measures in Effectiveness Trials Initiative Handbook, with adherence to the guidelines from the Core Outcome Set-STAndards for Reporting statement and Core Outcome Set-STAndardised Protocol Items recommendations. Five groups of stakeholders will be invited to participate in the development of COS for clinical trials with ICWM for UC, including healthcare professionals, patients, COS developers, COS users, and methodologists. The process will involve five stages: (1) conducting a systematic review of outcomes reported in clinical trials and protocols to develop a list of potential outcome domains; (2) conducting semi-structured interviews to obtain important outcomes; (3) choosing the most important outcomes by conducting three-round Delphi surveys; (4) achieving a consensus in a face-to-face meeting to discuss the final COS; and (5) publication, dissemination and implementation of COS. Consequently, this specialized COS will be applicable to clinical trials involving both traditional Chinese medicine (TCM) and ICWM interventions. Please cite this article as: Zhang X, Zhang L, Wang J, Lau CT, Wang N, Zhang X, Wang P, Li J, Han F, Bian Z. A protocol for developing, disseminating and implementing a core outcome set for clinical trials of integrative Chinese and Western medicine for ulcerative colitis. J Integr Med. 2025; 23(6):654-659.
Colitis, Ulcerative/therapy* ; Humans ; Medicine, Chinese Traditional ; Clinical Trials as Topic ; Integrative Medicine ; Research Design ; Outcome Assessment, Health Care ; Delphi Technique

OBJECTIVE: To identify the key features of facial and tongue images associated with anemia in female populations, establish anemia risk-screening models, and evaluate their performance. METHODS: A total of 533 female participants (anemic and healthy) were recruited from Shuguang Hospital. Facial and tongue images were collected using the TFDA-1 tongue and face diagnosis instrument. Color and texture features from various parts of facial and tongue images were extracted using Face Diagnosis Analysis System (FDAS) and Tongue Diagnosis Analysis System version 2.0 (TDAS v2.0). Least Absolute Shrinkage and Selection Operator (LASSO) regression was used for feature selection. Ten machine learning models and one deep learning model (ResNet50V2 + Conv1D) were developed and evaluated. RESULTS: Anemic women showed lower a-values, higher L- and b-values across all age groups. Texture features analysis showed that women aged 30-39 with anemia had higher angular second moment (ASM)and lower entropy (ENT) values in facial images, while those aged 40-49 had lower contrast (CON), ENT, and MEAN values in tongue images but higher ASM. Anemic women exhibited age-related trends similar to healthy women, with decreasing L-values and increasing a-, b-, and ASM-values. LASSO identified 19 key features from 62. Among classifiers, the Artificial Neural Network (ANN) model achieved the best performance [area under the curve (AUC): 0.849, accuracy: 0.781]. The ResNet50V2 model achieved comparable results [AUC: 0.846, accuracy: 0.818]. CONCLUSION Differences in facial and tongue images suggest that color and texture features can serve as potential TCM phenotype and auxiliary diagnostic indicators for female anemia.
Humans ; Female ; Tongue/diagnostic imaging* ; Adult ; Anemia/diagnosis* ; Middle Aged ; Face/diagnostic imaging* ; Young Adult ; Machine Learning

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test