Objective: To characterize perioperative dynamic changes in immune-cell phenotypes and inflammatory cytokines in patients undergoing CPB (cardiopulmonary bypass) cardiac surgery, and to explore their associations with postoperative outcomes. Methods: In this prospective cohort study, 120 adult patients who underwent elective cardiac surgery under CPB at West China Hospital from May 2022 to March 2023 were enrolled. Perioperative immune-cell phenotypes and concentrations of 40 inflammation-related cytokines were measured. The primary outcomes were the sequential organ failure assessment (SOFA) score at 24 h after surgery and ΔSOFA (the peak SOFA score within 48 h after surgery minus the preoperative SOFA score). Secondary outcomes included major adverse cardiovascular events (MACE), acute kidney injury (AKI), respiratory failure, severe liver injury, and infection. Results: The mean age of enrolled patients was 57±10 years. Of these, 52% (62/120) were male and 90% (108/120) underwent valve surgery. During the rewarming to the end of CPB, neutrophil counts rapidly increased (7.39×10 /L vs preoperative 3.07×10 /L, P<0.001), with significant upregulation of CD11b (7.30×10 /L vs preoperative 3.05×10 /L, P<0.001) and CD54 (7.15×10 /L vs preoperative 2.99×10 /L, P<0.001). Lymphocyte counts increased at the end of CPB (1.75×10 /L vs preoperative 1.12×10 /L, P<0.001) but decreased significantly at 24 h after surgery (0.59×10 /L vs preoperative 1.12×10 /L, P<0.001). Plasma analysis showed that multiple pro-inflammatory cytokines increased during CPB and remained elevated up to 24 h after surgery; five chemokines and the anti-inflammatory cytokine IL-10 peaked at the end of CPB. The SOFA score increased from 1 (1, 2) preoperatively to 7 (5, 10) at 24 h after surgery, with a ΔSOFA of 6 (4, 8). Within 30 days after surgery, 48 patients (40.0%) developed AKI, 17 (14.2%) developed infection, 4 (3.3%) developed severe liver injury, 3 (2.5%) developed respiratory failure, and 3 (2.5%) experienced MACE. During the 2-year follow-up, 8 patients (6.7%) experienced MACE and 5 (4.2%) died. Conclusion: Multi-organ dysfunction is common after cardiac surgery under CPB (median ΔSOFA, 6), accompanied by perioperative activation of multiple immune-cell subsets and upregulation of pro-inflammatory, anti-inflammatory, and chemotactic mediators. This study provides data-driven evidence and research clues for further investigation of the associations between CPB-related immune perturbations and postoperative organ dysfunction and clinical outcomes.

This study aims to investigate the anti-tumor effect and mechanism of Guiqi Yiyuan Ointment combined with cisplatin on Lewis lung carcinoma-bearing mice via the protein kinase RNA-like endoplasmic reticulum kinase(PERK)/eukaryotic translation initiation factor 2α(eIF2α)/activated transcription factor 4(ATF4)/C/EBP homologous protein(CHOP) signaling pathway. Sixty SPF-grade male C57BL/6 mice were selected and assigned into a blank group and a modeling group by the random number table method. After modeling of the Lewis lung carcinoma, the mice in the modeling group were randomized into model, cisplatin(5 mg·kg~(-1), once a week), and low-, medium-, and high-dose(1.7, 3.5, and 7.05 g·kg~(-1), respectively, once a day) Guiqi Yiyuan Ointment+cisplatin(5 mg·kg~(-1)) groups(n=10). After 14 days of continuous intervention, the spleen, thymus, and tumor samples of the mice were collected, weighed, and recorded, and the spleen index, thymus index, and tumor suppression rate were calculated. Hematoxylin-eosin(HE) staining was employed to observe the pathological changes in the tumor tissue. The morphological changes of the endoplasmic reticulum of tumor cells were observed by transmission electron microscopy. The positive expression of phosphorylated eIF2α(p-eIF2α) and ATF4 in the tumor tissue was detected by immunofluorescence. Western blot was employed to determine the protein levels of phosphorylated PERK(p-PERK), p-eIF2α, ATF4, CHOP, B-cell lymphoma-2(Bcl-2), Bcl-2-associated X protein(Bax), cyclin-dependent kinase inhibitor 1A(p21), and cyclinD1 in the tumor tissue. Real-time fluorescent quantitative PCR was employed to determine the mRNA levels of PERK, eIF2α, ATF4, CHOP, Bax, Bcl-2, p21, and cyclinD1 in the tumor tissue. Compared with the blank group, the model group showed decreases in spleen index and thymus index(P<0.05). Compared with the model group, the cisplatin group showed decreases in spleen index and thymus index(P<0.05), and the medium-and high-dose Guiqi Yiyuan Ointment+cisplatin groups presented increases in spleen index and thymus index(P<0.05). In addition, the treatment groups all showed decreased tumor mass(P<0.05), increased tumor cell lysis and nuclear rupture, widened gap between rough endoplasmic reticulum, enhanced average fluorescence intensity of p-eIF2α and ATF4(P<0.05), up-regulated protein levels of p-PERK/PERK, p-eIF2α/eIF2α, ATF4, CHOP, Bax, and p21(P<0.05), down-regulated protein and mRNA levels of Bcl-2 and cyclinD1(P<0.05), and up-regulated mRNA levels of PERK, eIF2α, ATF4, CHOP, Bax, and p21(P<0.05). Compared with the cisplatin group, the combination groups showed increases in spleen index and thymus index(P<0.05) as well as mean optical density(P<0.05), and the high-dose Guiqi Yiyuan Ointment+cisplatin group showed decreased tumor mass(P<0.05). In addition, the medium-and high-dose Guiqi Yiyuan Ointment+cisplatin groups showcased enhanced average fluorescence intensity of p-eIF2α and ATF4(P<0.05), up-regulated protein levels of p-PERK/PERK, p-eIF2α/eIF2α, ATF4, CHOP, Bax, and p21(P<0.05), down-regulated protein and mRNA levels of Bcl-2 and cyclinD1(P<0.05), and up-regulated mRNA levels of PERK, eIF2α, ATF4, CHOP, Bax, and p21(P<0.05). In conclusion, Guiqi Yiyuan Ointment combined with cisplatin can effectively inhibit the growth of Lewis lung carcinoma in mice by regulating the expression of proteins related to the PERK/eIF2α/ATF4/CHOP signaling pathway and promoting cell cycle arrest and apoptosis.
Animals ; Cisplatin/administration & dosage* ; Activating Transcription Factor 4/genetics* ; Eukaryotic Initiation Factor-2/genetics* ; eIF-2 Kinase/genetics* ; Carcinoma, Lewis Lung/pathology* ; Drugs, Chinese Herbal/administration & dosage* ; Male ; Mice ; Signal Transduction/drug effects* ; Mice, Inbred C57BL ; Transcription Factor CHOP/genetics* ; Ointments/administration & dosage* ; Humans ; Cell Proliferation/drug effects* ; Antineoplastic Agents/administration & dosage*

Constructing an efficient and easy-to-operate multigene expression system is currently a crucial part of plant genetic engineering. In this study, a fragment carrying three independent gene expression cassettes and the expression unit of the gene-silencing suppressor protein(RNA silencing suppressor 19 kDa protein, P19) simultaneously was designed and constructed. This fragment was cloned into the commonly used plant expression vector pCAMBIA300, and the plasmid pC1300-TP2-P19 was obtained. Each gene expression cassette consists of different promoters, fusion tags, and terminators. The target gene can be flexibly inserted into the corresponding site through enzymatic digestion and ligation or recombination and fused with different protein tags, which provides great convenience for subsequent detection. The enhanced green fluorescent protein(eGFP) reporter gene was individually constructed into each expression cassette to verify the feasibility of this vector system. The results of tobacco transient expression and laser-confocal microscopy showed that each expression cassette presented independent and normal expression. Meanwhile, the three key enzyme genes in the betanin synthesis pathway, BvCYP76AD, BvDODA1, and DbDOPA5GT, were constructed into the three expression cassettes. The results of tobacco transient expression phenotype, protein immunoblotting(Western blot), and chemical detection of product demonstrated that the three exogenous genes were highly expressed, and the target compound betanin was successfully produced. The above results indicated that the constructed multigene expression system for plants in this study was efficient and reliable and can achieve the co-transformation of multiple plant genes. It can provide a reliable vector platform for the analysis of plant natural product synthesis pathways, functional verification, and plant metabolic engineering.
Nicotiana/metabolism* ; Genetic Vectors/metabolism* ; Gene Expression Regulation, Plant ; Plant Proteins/metabolism* ; Plants, Genetically Modified/metabolism* ; Genetic Engineering/methods* ; Green Fluorescent Proteins/metabolism* ; Gene Expression

OBJECTIVE To compare the clinical efficacy and safety of remimazolam and propofol in general anesthesia induction and maintenance for elderly patients undergoing thoracoscopic lobectomy. METHODS A total of 86 elderly lung cancer patients who underwent thoracoscopic lobectomy at Chongqing University Three Gorges Hospital from February to July 2024 were selected and divided into the propofol group and the remimazolam group according to the randomized numerical table method， with 43 cases in each group. During anesthesia induction， patients in the propofol group and the remimazolam group were intravenously administered 2 mg/kg of Propofol medium- and long-chain fat emulsion injection or 0.25 mg/kg of Remimazolam tosilate for injection， respectively； during anesthesia maintenance， the two groups received intravenous infusion of 6-10 mg/（kg·h） of Propofol medium- and long- chain fat emulsion injection or 1-3 mg/（kg·h） of Remimazolam tosilate for injection， respectively. The anesthesia effects， anesthesia-related indicators， intraoperative opioid and muscle relaxant dosages， Ramsay sedation score， numerical rating scale （NRS） score， and hemodynamic parameters were compared between the two groups， and the occurrence of adverse drug reactions was recorded. RESULTS A total of 41 patients in the propofol group and 43 patients in the remimazolam group completed the trial. The proportion of patients with grade Ⅰ anesthesia effect in the remimazolam group was significantly higher than that in the propofol group， while the proportion of patients with grade Ⅱ anesthesia effect was significantly lower than that in the propofol group （P＜0.05）. In this group， the disappearance time of eyelash reflex， the time taken for the bispectral index to drop to 60， and the Ramsay sedation scores （2 and 6 hours after operation） were all significantly prolonged or increased， while the recovery time， NRS scores （2 and 6 hours after operation）， and the incidence of intraoperative hypotension were all significantly shortened or reduced； moreover， the improvements of the above sedation/NRS scores exhibited a time-dependent pattern within 2 to 24 hours after operation （P＜0.05）. Compared with before anesthesia induction （T0）， the heart rate [except at 2 min after medication （T1）， 60 min after anesthesia （T4）， and at the end of surgery （T5） in the remimazolam group] and mean arterial pressure [except at T1 in the remimazolam group] of patients in both groups significantly decreased at T1， 5 min after medication （T2）， at the start of surgery （T3）， T4， and T5 （P＜0.05）. Meanwhile， regional cerebral oxygen saturation significantly increased in both groups. Furthermore， the heart rate and mean arterial pressure of patients in the remimazolam group were significantly higher than those in the propofol group at T1， T2 and T4 （P＜0.05）. No statistically significant differences were observed between the two groups in terms of postanesthesia care unit stay time， dosage of opioids and muscle relaxants， regional cerebral oxygen saturation， or peripheral oxygen saturation at various time points （P＞0.05）. CONCLUSIONS Compared to propofol， remimazolam demonstrates superior anesthesia effects when used for the induction and maintenance of general anesthesia in elderly patients undergoing thoracoscopic lobectomy. It not only provides more stable intraoperative hemodynamics and shortens the postoperative recovery time but also effectively reduces the incidence of intraoperative hypotension.

Eukaryotic translation initiation factor 5A (eIF5A) is the only known protein in eukaryotes that contains a hydroxyputrescine lysine modification. Only the modified form of eIF5A is biologically active and is widely involved in protein translation, mRNA degradation, autophagy, and other intracellular processes. Epithelial-mesenchymal transition (EMT) is a process in which epithelial cells transform into mesenchymal phenotype cells through a highly regulated program. It plays a key role in embryonic development, tissue regeneration, and wound healing. Based on its biological functions, EMT can be classified into three types: I, II, and III. Type III EMT is the core mechanism underlying malignant tumor cell invasion and metastasis. This EMT mechanism involves the canonical pathway induced by transforming growth factor-β (TGF-β) and is regulated by various growth factors (TRAF6, EGF, IGF, HGF, VEGF), transcription factors (Twist, Slug, NF-κB, E12/E47, SIP1, ZEB1, etc.), and signaling pathways such as Wnt/β-catenin and PEAK1. eIF5A can influence tumor cell proliferation, invasion, and metastasis by regulating EMT-related signaling pathways. The known signaling pathways through which eIF5A regulates EMT include the canonical Smad signaling pathway and non-canonical pathways such as Rho/Rac1, Twist, STAT3, and MAT1. Additionally, certain miRNA family members, such as miR-30b, miR-599, and miR-203, can bind to the 3'-UTR of eIF5A2, inhibiting its expression and subsequently suppressing the EMT process in cancer cells, including gastric cancer and colorectal cancer. GC7, an inhibitor targeting the key enzyme DHPS involved in eIF5A modification, has been shown to reverse the EMT mechanism in oral squamous cell carcinoma, lung cancer, and breast cancer by regulating cytokine-mediated signaling pathways, including HIF-1α, STAT3/c-MYC, and Twist. However, to date, no inhibitors directly targeting eIF5A have been developed. In recent years, the mechanism of eIF5A activation catalyzed by DHPS and DOHH has become increasingly clear. As the only protein involved in lysine deoxyhydroxymethylation, DHPS may play a more critical role than eIF5A in the overall signal transduction process. Through in-depth analysis of the DHPS protein structure and its active site, researchers have shifted their approach to DHPS inhibitor development from substrate analog inhibitors (such as GC7, CNI-1493, DHSI-15, etc.) to allosteric inhibitors (11g, 26d, 8m, GL-1, etc.). GC7 is not suitable for clinical trials due to its lack of specificity and low bioavailability, and the therapeutic potential of novel allosteric inhibitors has yet to be clarified. Therefore, there is a significant gap in the development of covalent drugs targeting DHPS for cancer treatment in clinical settings. This paper reviews the research progress on eIF5A in regulating EMT, focusing on the molecular mechanisms by which eIF5A influences tumor cell invasion and migration. It also discusses the characteristics and current limitations of inhibitors targeting the hypusine pathway, aiming to provide insights for studying tumor metastasis mechanisms and drug discovery.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To explore the influencing factors for very preterm birth at a gestational age of <32 weeks in the Xinjiang Uygur Autonomous Region. METHODS: Clinical data of women with preterm deliveries and their newborns admitted to five hospitals in Xinjiang from January 2023 to December 2024 were retrospectively collected. The subjects were divided by gestational age into very preterm (<32 weeks of gestation) and moderate/late preterm (32-36⁺⁶ weeks of gestation) groups. Risk factors associated with very preterm birth were analyzed. RESULTS: A total of 4 105 pregnant women with preterm deliveries were included, with 793 cases (19.32%) in the very preterm group and 3 312 cases (80.68%) in the moderate/late preterm group. The factors significantly associated with very preterm birth were as following: hypertensive disorders of pregnancy (OR=1.785, 95%CI: 1.492-2.135, P<0.05), excessive gestational weight gain (GWG, OR=2.002, 95%CI: 1.672-2.397, P<0.05), insufficient GWG (OR=1.746, 95%CI: 1.326-2.300, P<0.05), chorioamnionitis (OR=2.163, 95%CI: 1.694-2.763, P<0.05), premature rupture of membranes ≥18 hours (OR=2.158, 95%CI: 1.599-2.912, P<0.05), placental abruption (OR=2.228, 95%CI: 1.646-3.014, P<0.05), and ≤7 prenatal visits (OR=3.419, 95%CI: 2.882-4.055, P<0.05). CONCLUSIONS In the Xinjiang Uygur Autonomous Region, hypertensive disorders of pregnancy, excessive or insufficient GWG, chorioamnionitis, premature rupture of membranes ≥18 hours, placental abruption, and ≤7 prenatal visits are risk factors for very preterm birth. Strengthening high-risk pregnancy management is necessary for reducing the incidence of very preterm birth.
Humans ; Female ; Retrospective Studies ; Pregnancy ; Premature Birth/etiology* ; Gestational Age ; Adult ; Risk Factors ; Infant, Newborn ; Gestational Weight Gain

An 11-year-old boy presented with erythematous plaques over the bilateral mandibular and mental regions for 2 years, accompanied by cough and dyspnea for more than 2 months. Chest computed tomography angiography revealed marked stenosis of the right pulmonary artery, irregular aortic caliber, and aortic wall thickening. Histopathological examination of the skin lesion, including immunohistochemistry and special stains, confirmed a chronic suppurative inflammation. Whole-exome sequencing was negative. A final diagnosis of granuloma faciale and Takayasu arteritis was established. Combination therapy with systemic tocilizumab, prednisone, and methotrexate, along with topical 0.1% tacrolimus ointment, resulted in a favorable clinical response. This report summarizes the clinical features of a pediatric case of granuloma faciale and Takayasu arteritis and reviews the etiology, diagnostic approach, and current treatment strategies for the disorders, aiming to enhance clinicians' understanding of these conditions.
Humans ; Male ; Child ; Takayasu Arteritis/diagnosis* ; Facial Dermatoses/diagnosis*

OBJECTIVE: To investigate the characteristics of gut microbiota changes in patients with acute myeloid leukemia (AML) undergoing induction chemotherapy and to explore the relationship between infectious complications and gut microbiota. METHODS: Fecal samples were collected from 37 newly diagnosed AML patients at four time points: before induction chemotherapy, during chemotherapy, during the neutropenic phase, and during the recovery phase. Metagenomic sequencing was used to analyze the dynamic changes in gut microbiota. Correlation analyses were conducted to assess the relationship between changes in gut microbiota and the occurrence of infectious complications. RESULTS: During chemotherapy, the gut microbiota α-diversity (Shannon index) of AML patients exhibited significant fluctuations. Specifically, the diversity decreased significantly during induction chemotherapy, further declined during the neutropenic phase (P < 0.05, compared to baseline), and gradually recovered during the recovery phase, though not fully returning to baseline levels.The abundances of beneficial bacteria, such as Firmicutes and Bacteroidetes, gradually decreased during chemotherapy, whereas the abundances of opportunistic pathogens, including Enterococcus, Klebsiella, and Escherichia coli, progressively increased.Analysis of the dynamic changes in gut microbiota of seven patients with bloodstream infections revealed that the bloodstream infection pathogens could be detected in the gut microbiota of the corresponding patients, with their abundance gradually increasing during the course of infection. This finding suggests that bloodstream infections may be associated with opportunistic pathogens originating from the gut microbiota.Compared to non-infected patients, the baseline samples of infected patients showed a significantly lower relative abundance of Bacteroidetes (P < 0.05). Regression analysis indicated that Bacteroidetes abundance is an independent predictive factor for infectious complications (P < 0.05, OR =13.143). CONCLUSION During induction chemotherapy in AML patients, gut microbiota α-diversity fluctuates significantly, and the abundance of opportunistic pathogens increase, which may be associated with bloodstream infections. Patients with lower baseline Bacteroidetes abundance are more prone to infections, and its abundance can serve as an independent predictor of infectious complications.
Humans ; Gastrointestinal Microbiome ; Leukemia, Myeloid, Acute/microbiology* ; Induction Chemotherapy ; Feces/microbiology* ; Male ; Female ; Middle Aged

OBJECTIVE: To explore the clinical characteristics and prognosis of children with SIL-TAL1-positive T-cell acute lymphoblastic leukemia ( SIL-TAL1⁺ T-ALL). METHODS: The clinical data of 110 children with newly diagnosed T-ALL admitted to the pediatric department of our hospital from January 2010 to December 2018 were reviewed to compare the clinical characteristics, treatment response and prognosis between SIL-TAL1⁺ group and SIL-TAL1^-group. RESULTS: Among the 110 children with T-ALL, 25 cases (22.7%) were in the SIL-TAL1⁺ group and 85 cases (77.3%) in the SIL-TAL1^- group. The white blood cell (WBC) count in the SIL-TAL1⁺ group was significantly higher than that in the SIL-TAL1^- group (P < 0.05), while the other clinical characteristics and treatment response were not significantly different between the two groups. The 5-year overall survival (OS) rates of SIL-TAL1⁺ group and SIL-TAL1^- group were 80.0% and 75.5%, and 5-year disease-free survival (DFS) rates were 76.0% and 72.9%, respectively. There were no significant differences in OS rate and DFS rate between the two groups ( P >0.05). In children aged < 10 years, the 5-year OS rate of SIL-TAL1⁺ group and SIL-TAL1^- group was 100% and 75.1%, respectively, and the difference between the two groups was statistically significant (P < 0.05). CONCLUSION Although the WBC level is significantly higher in children with SIL-TAL1⁺ T-ALL than that in those with SIL-TAL1^- T-ALL, the treatment efficacy is similar between the two groups. In children aged < 10 years, the longterm survival rate is superior in the SIL-TAL1⁺ group.
Humans ; Precursor T-Cell Lymphoblastic Leukemia-Lymphoma/diagnosis* ; Prognosis ; Child ; Male ; Female ; Survival Rate ; T-Cell Acute Lymphocytic Leukemia Protein 1 ; Child, Preschool ; Oncogene Proteins, Fusion ; Leukocyte Count