Objective To optimize the process conditions and analyze the components of alkaloids from Zanthoxylum bungeanum Maxim（Z. bungeanum）using macroporous resin. Methods Combining single factor tests and orthogonal tests, the content of hydroxy-α-sanshool（HAS）and hydroxy-β-sanshool（HBS）were considered as indexes to determine the best process parameters. Ultra-performance liquid chromatography-quadrupole tandem time-of-flight mass spectrometry（UPLC-Q-TOF-MS^E）was used to identify the structures of alkaloids. Results The optimal conditions were Mitsubishi HP-20 macroporous resin, the loading solution concentration was 0.2 g crude drug/ml, the ratio of crude drug to resin volume was 1 g∶2.5 ml, the diameter/height ratio of resin column was 1∶7, the dynamic adsorption flow rate was 4 times of bed volume（BV）per hour, and the adsorption time was 1 h. Impurities were removed by using 2 BV of 20% ethanol, 5 BV of 80% ethanol was used to elution, and the content of HAS and HBS was 4.71% and 1.02%, respectively. A total of 20 alkaloids were identified from Z. bungeanum. Conclusion This method was stable and feasible, obtaining high purity and various kinds of alkaloids, which could be used for the enrichment and purification of alkaloids from Z. bungeanum.

ObjectiveTo investigate the antitumor effect and mechanism of Guiqi Yiyuan ointment on Lewis lung cancer mice based on the extracellular regulatory protein kinase （ERK） signaling pathway. MethodsA Lewis lung cancer mouse model was established. Except for the blank group， the model mice were randomly divided into the model group， Guiqi Yiyuan ointment low， medium， and high dose groups， and the extracellular ERK1/2 inhibitor group， with 10 mice per group. The Guiqi Yiyuan ointment was administered by gavage at doses of 1.75， 3.5， 7.0 g·kg^-1·d^-1 for the low， medium， and high dose groups， respectively. The ERK1/2 inhibitor group was given the ERK1/2 inhibitor LY3214996 （100 mg·kg^-1·d^-1） by gavage. The treatment was administered for 14 consecutive days， after which samples were collected. Tumor histopathological changes were observed using hematoxylin-eosin （HE） staining. Transmission electron microscopy was used to observe ultrastructural changes in tumor cells. Immunofluorescence was performed to measure the phosphorylation of ERK1/2 （p-ERK1/2） and the expression of programmed cell death ligand-1 （PD-L1） in tumor tissues. Western blot and real-time quantitative polymerase chain reaction （Real-time PCR） were used to detect the expression of p-ERK1/2， PD-L1， the autophagy marker Beclin-1， the autophagic protein p62， and the microtubule-associated protein light chains LC3Ⅰ and LC3Ⅱ at both the protein and gene levels. ResultsCompared with the model group， the average tumor weight was significantly reduced in the low and medium dose groups of Guiqi Yiyuan ointment （P<0.05）， and markedly reduced in the high dose and inhibitor groups （P<0.01）. Tumor cells in all treatment groups became progressively irregular， with ruptured nuclei and expanded areas of cell disintegration and necrosis. The number of organellar ablations in tumor tissues increased， and the number of autophagic vesicles also increased in all groups. The mean fluorescence intensity of p-ERK1/2 and PD-L1 was reduced in the low and medium dose groups of Guiqi Yiyuan ointment （P<0.05）， and significantly reduced in the high dose and inhibitor groups （P<0.01）. The mRNA expression of ERK1/2， PD-L1， Beclin-1， and p62 was reduced in the medium dose group （P<0.05）， while LC3Ⅰ/Ⅱ mRNA expression was elevated （P<0.05）. In the high dose and inhibitor groups， mRNA expression of ERK1/2， PD-L1， Beclin-1， and p62 was significantly reduced （P<0.01）， while LC3Ⅰ/Ⅱ mRNA expression was significantly increased （P<0.01）. Protein expression of p-ERK1/2， PD-L1， Beclin-1， and p62 was reduced in the medium dose group （P<0.05）， and LC3Ⅰ/Ⅱ protein expression was elevated （P<0.05）. In the high dose and inhibitor groups， protein expression of p-ERK1/2， PD-L1， Beclin-1， and p62 was significantly reduced （P<0.01）， while LC3Ⅰ/Ⅱ protein expression was significantly elevated （P<0.01）. ConclusionGuiqi Yiyuan ointment may inhibit the activation of the ERK signaling pathway， downregulate the expression of p-ERK1/2， promote autophagic flux in tumor cells， and regulate the expression of PD-L1， thereby exerting an inhibitory effect on tumor growth in Lewis lung cancer mice.

OBJECTIVE To re-evaluate the use of systematic evaluation/meta-analysis of anti-VEGF drugs in the treatment of diabetic macular oedema （DME）， aiming to provide evidence-based support for the clinical application of this medication. METHODS A comprehensive search was conducted across a range of databases， including CNKI， Wanfang data， VIP， CBM， PubMed， Web of Science， Embase， and Cochrane Library. The objective was to identify systematic evaluation/meta-analysis of anti- VEGF drugs for DME， with search time from the inception of the databases to March 2024. The report quality， methodological quality， and evidence quality were assessed by using PRISMA2020 statement， AMSTAR2 scale and GRADE tool. A comprehensive analysis of systematic evaluation/meta-analysis results was also conducted. RESULTS A total of 22 articles were included. According to the PRISMA2020 statement evaluation， 13 studies provided relatively complete information （≥21 points）， while 9 studies had information deficiencies （18-＜21 points）. The AMSTAR 2 scale evaluation revealed that 21 studies had very low methodological quality， and one study had low methodological quality. The GRADE tool evaluation showed that out of 89 outcome indicators， 28（ 31.46%） were classified as high-quality evidence， 34（ 38.20%） as moderate-quality evidence， 24（ 26.97%） as low- quality evidence， and 3 （3.37%） as very low-quality evidence. The comprehensive quality analysis results demonstrated that， compared with laser photocoagulation， anti-VEGF drugs significantly enhanced the improvement in best-corrected visual acuity （BCVA）， as well as significant change in retinal thickness at 1 and 6 months， and 1 and 2 years post-treatment， and also in BCVA and retinal thickness at 1， 3， and 6 months post-treatment （P＜0.05）. Compared with placebo， patients treated with anti-VEGF drugs showed significant improvement in BCVA after 1 year of treatment （P＜0.05）. However， when compared with corticosteroid drugs， patients treated with anti-VEGF drugs exhibited a significant increase in retinal thickness after 6 months of treatment （P＜0.05）. Compared with corticosteroid drugs， the incidence of adverse events related to the eyes， cataract formation and intraocular pressure were significantly decreased in patients treated with anti-VEGF drugs （P＜0.05）. Compared with laser photocoagulation， the incidence of ocular adverse events was significantly decreased in patients treated with anti-VEGF drugs， while the incidence of fatal adverse events was significantly increased （P＜0.05）. CONCLUSIONS Anti-VEGF therapy for DME may possess certain advantages in terms of efficacy and safety， but it is associated with a higher risk of fatal adverse events； the evidence included in systematic reviews/meta-analyses is of moderate to high quality.

The writing of pharmacist-managed clinics documents （hereinafter referred to as “outpatient medication record”） is a necessary part of pharmacist-managed clinics service. Outpatient medication record is an important carrier to reflect the quality of pharmacist-managed clinics service. The Chinese Hospital Association Pharmaceutical Specialized Committee was entrusted by the Pharmaceutical Administration Department of the National Health Commission to lead the formulation of the Guidelines for the Pharmacist-managed Clinics Service and Document Writing and Usage （Reference） （hereinafter referred to as Guidelines） according to the compilation method of group standards and the technical route of “documentation combing→framework establishment→draft writing→opinion collection→Guidelines formation”. The Guidelines standardizes the basic requirements of pharmacist-managed clinics record management and the basic content of record， and provides a general template and two specialized templates including pregnant and lactating pharmacist-managed clinics record template and cough and asthma pharmacist-managed clinics record template， which provides a reference for medical institutions to write pharmacist-managed clinics record. This paper introduces the formulation process of Guidelines and analyzes the key contents of Guidelines， which is helpful for the application practice of Guidelines and further improves the quality of pharmacist-managed clinics work.

Prostate cancer(PCa) is a common malignant tumor among elderly men, with high incidence and mortality rates worldwide, posing a serious threat to human health. Traditional treatments face limitations, highlighting the urgent need for novel therapeutic strategies. Recent studies on the regulatory mechanisms of micro ribonucleic acid(microRNA, miRNA) in tumor development has identified miRNA as new targets for PCa diagnosis and treatment. Traditional Chinese medicine(TCM), with its multi-mechanism, multi-target, and multi-pathway regulatory properties, shows promising potential in miRNA-based PCa therapy. This review summarized recent findings on miRNA' roles in PCa and research progress of TCM intervention and found that a variety of miRNA played important regulatory roles in cell differentiation, proliferation, apoptosis, invasion, metastasis, immune microenvironment, and drug resistance, and their potential as biomarkers for PCa diagnosis, prognosis, and therapy, indicating the potential to be a biomarker for the diagnosis, prognosis evaluation, and treatment of PCa. The review concluded that the active components of TCM(terpenoids, flavonoids, alkaloids, and others) and compounds(Yishen Tonglong Decoction, Shenhu Decoction, Zhoushi Qiling Decoction, Fuzheng Yiliu Decoction, and Qilan Formula) could regulate the expression of their downstream target genes by acting on specific miRNA and affect the above biological behaviors of PCa cells, thus playing a role in the treatment of PCa. This review aims to provide a theoretical basis for miRNA as potential biomarkers and therapeutic targets for PCa and suggest new avenues for further development of targeted therapy strategies against miRNA.
Humans ; MicroRNAs/metabolism* ; Prostatic Neoplasms/metabolism* ; Male ; Drugs, Chinese Herbal/therapeutic use* ; Medicine, Chinese Traditional ; Animals ; Gene Expression Regulation, Neoplastic/drug effects*

This study developed a core outcome set(COS) for traditional Chinese medicine(TCM) interventions in diabetic peripheral neuropathy(DPN), standardizing evaluation metrics for TCM efficacy and providing a new framework for DPN treatment and management. A systematic search was conducted across databases, including CNKI, Wanfang, and PubMed, targeting clinical trial literature published between January 1, 2013, and January 1, 2023. The search focused on extracting outcome indicators and measurement tools used in TCM treatments for DPN. Retrospective data collection was performed from January 2018 to June 2023, involving 200 DPN patients hospitalized at the Department of Endocrinology of the First Affiliated Hospital of Anhui University of Chinese Medicine. Additionally, semi-structured interviews were conducted with inpatients, outpatients, their families, and nursing staff to further refine and enhance the list of outcome indicators. After two rounds of Delphi questionnaire survey and consensus meeting, a consensus was reached. The study initially retrieved 3 421 publications, of which 170 met the inclusion criteria after review. These publications, combined with retrospective analysis and semi-structured interviews, supplemented the list of indicators. After two rounds of Delphi surveys, experts agreed on 24 indicators and 6 measurement tools. The final COS determined by expert consensus meeting included 5 domains and 13 outcome indicators: neurological function signs, quality of life, TCM syndrome score, nerve conduction velocity, current perception threshold test, fasting blood glucose, 2 h postprandial blood glucose, glycated hemoglobin, complete blood count, urinalysis, liver function test, kidney function test, and electrocardiogram.
Humans ; Diabetic Neuropathies/drug therapy* ; Medicine, Chinese Traditional/methods* ; Drugs, Chinese Herbal/therapeutic use* ; Retrospective Studies ; Treatment Outcome ; Male ; Female

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To investigate the clinical characteristics and prognosis of primary pulmonary lymphoma (PPL). METHODS: The clinical data of 17 patients with PPL admitted to Gansu Provincial Hospital from January 2013 to June 2023 were collected, and their clinical characteristics and prognosis were retrospectively analyzed and summarized. RESULTS: The median age of the 17 patients was 56 (29-73) years old. There were 8 males and 9 females. According to Ann Arbor staging system, there were 9 patients with stage I-II and 8 patients with stage III-IV. There were 14 patients with IPI score of 0-2 and 3 patients with IPI score of 3-4. All 17 patients had symptoms at the initial diagnosis, most of the first symptoms were cough, and 6 patients had B symptoms.Among the 17 patients, there were 8 cases of diffuse large B-cell lymphoma (DLBCL), 5 cases of mucosa-associated lymphoid tissue (MALT) lymphoma, 1 case of gray zone lymphoma (GZL), and 3 cases of Hodgkin's lymphoma (HL). 15 patients received chemotherapy, of which 3 cases received autologous hematopoietic stem cell transplantation(ASCT) and 3 cases received radiotherapy; 2 patients did not receive treatment. The median number of chemotherapy courses was 6(2-8). The short-term efficacy was evaluated, 12 patients achieved complete remission (CR) and 3 patients achieved partial remission (PR). The age, pathological subtype, sex, Ann Arbor stage, β₂-microglobulin(β₂-MG) level, lactate dehydrogenase(LDH) level were not correlated with CR rate (P >0.05), while IPI score was correlated with recent CR rate (P < 0.05 ). The median follow-up time was 31(2-102) months. One of the 12 CR patients died of COVID-19, and the rest survived. Among the 3 patients who did not reach CR, 1 died after disease progression, while the other 2 survived. One of the 2 untreated patients died one year after diagnosis. Both the median progression-free survival (PFS) time and overall survival (OS) time of the 17 patients were both 31 (2-102) months. CONCLUSION The incidence of PPL is low, and the disease has no specific clinical manifestations, which is easily missed and misdiagnosed. The pathological subtypes are mainly MALT lymphoma and DLBCL, and the treatment is mainly combined chemotherapy. The IPI score is related to the treatment efficacy.
Humans ; Middle Aged ; Male ; Female ; Adult ; Prognosis ; Aged ; Lung Neoplasms/therapy* ; Retrospective Studies ; Neoplasm Staging ; Lymphoma/therapy* ; Lymphoma, Large B-Cell, Diffuse

OBJECTIVE: To explore the clinical significance of circulating tumor DNA (ctDNA) in response evaluation and relapse monitoring for patients with primary mediastinal large B-cell lymphoma (PMBCL). METHODS: The clinical characteristics, efficacy and survival of 38 PMBCL patients in our hospital from January 2010 to April 2020 were retrospectively analyzed. The ctDNA monitoring was conducted by targeted next-generation sequencing (NGS). RESULTS: Among the 38 patients, 26 cases were female, and 32 cases were diagnosed with Ann Arbor stage I-II. The 5-year overall survival (OS) rate and progression-free survival (PFS) rate were 74.7% and 61.7%, respectively. Males and those with high aaIPI scores (3 points) had a relatively poor prognosis. The NGS results of 23 patients showed that STAT6 (65.2%), SOCS1 (56.5%), and TNFAIP3 (56.5%) were the most common mutated genes. Patients with stable disease (SD)/progressive disease (PD) exhibited enrichment in cell cycle, FoxO, and TNF signaling pathways. A total of 29 patients underwent end-of-treatment PET/CT (EOT PET/CT), and 16 of them received ctDNA monitoring with 12 negative. Among 6 patients with EOT PET/CT positive (Deauville 4), 4 underwent ctDNA monitoring, and 3 of them were negative, being still in continuous remission without any subsequent anti-tumor therapy. CONCLUSION CtDNA may be combined with PET/CT to assess efficacy, monitor relapse, and guide treatment of PMBCL.
Humans ; Circulating Tumor DNA/blood* ; Female ; Mediastinal Neoplasms ; Male ; Retrospective Studies ; High-Throughput Nucleotide Sequencing ; Prognosis ; Lymphoma, Large B-Cell, Diffuse/genetics* ; Middle Aged ; Adult ; Aged ; Neoplasm Recurrence, Local ; Mutation

Objective： Varicocele (VC) induces male infertility by mediating changes in the testicular microenvironment, in which testicular hypoxia and high-pressure are important pathological conditions. This study aims to compare the mouse spermatogenesis (GC-2spd) cells and Sertoli (TM4) cells of mouse testis after hypoxic modeling and hypoxic and high-pressure combined modeling, and to explore the feasibility of establishing a hypoxic and high-pressure combined cell model. Methods： On the basis of cell hypoxia induced by CoCl2, the complex model of testicular cell hypoxia and high pressure was constructed by changing the osmotic pressure of GC-2 and TM4 cell medium with a high concentration of NaCl solution. After selecting the intervention concentration of CoCl2 by MTT test and detecting the expression level of HIF-1α for the determination of the optimal osmotic pressure conditions of the cell model, the cells were divided into normal group, hypoxia model group and composite model group. And the levels of OS, programmed cell death, inflammatory factors, and the expression levels of pyroptosis-related proteins were compared between the normal group and the groups with different modeling methods. Results： The optimal intervention concentration of CoCl2 in GC-2 and TM4 cells was 150 and 250μmol/L, respectively, and the expression of HIF-1α was the highest in both cells under osmotic pressure of 500 mOsmol/kg (P<0.05). Compared with the normal group, the SOD levels of GC-2 and TM4 cells decreased (all P<0.05), CAT level decreased (all P<0.05), and MDA level increased (all P<0.01), and the OS level of GC-2 and TM4 cells was more obvious than that of the hypoxia model group (all P<0.05). Compared with the normal group, apoptosis occurred in GC-2 and TM4 cells after composite modeling (all P<0.05). Compared with the normal group, the mRNA expressions of IL-1β, IL-18, TNF-α and COX-2 in GC-2 and TM4 cells significantly increased (P<0.01) and higher than those in hypoxia model group (P<0.05) and induced pyroptosis (P<0.01). The expression level of GSDMD increased (P<0.05). Conclusion： The cell model with hypoxia and high pressure combined modeling can not only induce oxidative stress and apoptosis of cells better than that with hypoxia alone, but also further cause inflammatory response damage and pyroptosis, which simulates the changes of testis microenvironment mediated by hypoxia and high pressure combined conditions in VC. This cell model can be used for studying the pathogenesis of VC-associated male infertility, evaluating drug efficacy, and exploring pharmacological mechanisms.
Male ; Animals ; Varicocele/pathology* ; Mice ; Testis/metabolism* ; Hypoxia-Inducible Factor 1, alpha Subunit/metabolism* ; Cell Hypoxia ; Cobalt ; Sertoli Cells/metabolism* ; Osmotic Pressure ; Spermatogenesis ; Cellular Microenvironment ; Infertility, Male ; Disease Models, Animal