Sleep is an instinctive behavior alternating awakening state, sleep entails many active processes occurring at the cellular, circuit and organismal levels. The function of sleep is to restore cellular energy, enhance immunity, promote growth and development, consolidate learning and memory to ensure normal life activities. However, with the increasing of social pressure involved in work and life, the incidence of sleep disorders (SD) is increasing year by year. In the short term, sleep disorders lead to impaired memory and attention; in the longer term, it produces neurological dysfunction or even death. There are many ways to directly or indirectly contribute to sleep disorder and keep the hormones, including pharmacological alternative treatments, light therapy and stimulus control therapy. Exercise is also an effective and healthy therapeutic strategy for improving sleep. The intensities, time periods, and different types of exercise have different health benefits for sleep, which can be found through indicators such as sleep quality, sleep efficiency and total sleep time. So it is more and more important to analyze the mechanism and find effective regulation targets during sleep disorder through exercise. Dopamine (DA) is an important neurotransmitter in the nervous system, which not only participates in action initiation, movement regulation and emotion regulation, but also plays a key role in the steady-state remodeling of sleep-awakening state transition. Appreciable evidence shows that sleep disorder on humans and rodents evokes anomalies in the dopaminergic signaling, which are also implicated in the development of psychiatric illnesses such as schizophrenia or substance abuse. Experiments have shown that DA in different neural pathways plays different regulatory roles in sleep behavior, we found that increasing evidence from rodent studies revealed a role for ventral tegmental area DA neurons in regulating sleep-wake patterns. DA signal transduction and neurotransmitter release patterns have complex interactions with behavioral regulation. In addition, experiments have shown that exercise causes changes in DA homeostasis in the brain, which may regulate sleep through different mechanisms, including cAMP response element binding protein signal transduction, changes in the circadian rhythm of biological clock genes, and interactions with endogenous substances such as adenosine, which affect neuronal structure and play a neuroprotective role. This review aims to introduce the regulatory effects of exercise on sleep disorder, especially the regulatory mechanism of DA in this process. The analysis of intracerebral DA signals also requires support from neurophysiological and chemical techniques. Our laboratory has established and developed an in vivo brain neurochemical analysis platform, which provides support for future research on the regulation of sleep-wake cycles by movement. We hope it can provide theoretical reference for the formulation of exercise prescription for clinical sleep disorder and give some advice to the combined intervention of drugs and exercise.

In view of the few studies on the influence of Armillaria spp. infection on the content of the chemical components in different parts of Polyporus umbellatus sclerotia, this study determined the biomass of P. umbellatus sclerotia and the contents of ergosterol, polyporusterone A, polyporusterone B and polysaccharide in the separated cavity wall of the sclerotia and the uninfected part of the sclerotia in different harvesting years under the conditions of A. gallica and A. mellea infection respectively. According to the difference of content and dynamic changes of the polysaccharide and the steroid substances, the superior Armillaria sp. was screened to obtain the best harvest years of P. umbellatus. Using HPLC and UV-VIS spectrophotometry methods, the contents of ergosterol, polyporusterone A, polyporusterone B and polysaccharide in P. umbellatus sclerotia infected by the two Armillaria spp. in different years were determined. In addition, the differentially expressed genes related to P. umbellatus polysaccharide synthesis were screened according to the transcriptomic data of different parts of P. umbellatus after A. mellea infection. With the increase of years, the biomass of sclerotia infected by different Armillaria spp. had significant differences, and there were significant differences in the four components of sclerotia. The four components of the separated cavity wall of the sclerotia were significantly higher than those of the uninfected part. The best harvest time was the third year after cultivation. Transcriptomic analysis showed that the infection of Armillaria spp. could significantly promote polysaccharide synthesis, which provided a basis for polysaccharide content determination at the molecular level. The study clarified the influence of different Armillaria spp. infection on the accumulation of chemical components of P. umbellatus sclerotia, laying a foundation for exploring the symbiosis mechanism and provided a scientific clue for screening superior Armillaria sp. and guiding the artificial cultivation of P. umbellatus sclerotia.

OBJECTIVE: To evaluate the dynamic changes of glucocorticoid (GC) dose and the feasibility of GC discontinuation in rheumatoid arthritis (RA) patients under the background of Chinese medicine (CM). METHODS: This multicenter retrospective cohort study included 1,196 RA patients enrolled in the China Rheumatoid Arthritis Registry of Patients with Chinese Medicine (CERTAIN) from September 1, 2019 to December 4, 2023, who initiated GC therapy. Participants were divided into the Western medicine (WM) and integrative medicine (IM, combination of CM and WM) groups based on medication regimen. Follow-up was performed at least every 3 months to assess dynamic changes in GC dose. Changes in GC dose were analyzed by generalized estimator equation, the probability of GC discontinuation was assessed using Kaplan-Meier curve, and predictors of GC discontinuation were analyzed by Cox regression. Patients with <12 months of follow-up were excluded for the sensitivity analysis. RESULTS: Among 1,196 patients (85.4% female; median age 56.4 years), 880 (73.6%) received IM. Over a median 12-month follow-up, 34.3% (410 cases) discontinued GC, with significantly higher rates in the IM group (40.8% vs. 16.1% in WM; P<0.05). GC dose declined progressively, with IM patients demonstrating faster reductions (median 3.75 mg vs. 5.00 mg in WM at 12 months; P<0.05). Multivariate Cox analysis identified age <60 years [P<0.001, hazard ratios (HR)=2.142, 95% confidence interval (CI): 1.523-3.012], IM therapy (P=0.001, HR=2.175, 95% CI: 1.369-3.456), baseline GC dose ⩽7.5 mg (P=0.003, HR=1.637, 95% CI: 1.177-2.275), and absence of non-steroidal anti-inflammatory drugs use (P=0.001, HR=2.546, 95% CI: 1.432-4.527) as significant predictors of GC discontinuation. Sensitivity analysis (545 cases) confirmed these findings. CONCLUSIONS RA patients receiving CM face difficulties in following guideline-recommended GC discontinuation protocols. IM can promote GC discontinuation and is a promising strategy to reduce GC dependency in RA management. (Trial registration: ClinicalTrials.gov, No. NCT05219214).
Adult ; Aged ; Female ; Humans ; Male ; Middle Aged ; Arthritis, Rheumatoid/drug therapy* ; Glucocorticoids/therapeutic use* ; Medicine, Chinese Traditional ; Retrospective Studies

Gene regulation relies on the precise binding of transcription factors (TFs) at regulatory elements, but simultaneously detecting hundreds of TFs on chromatin is challenging. We developed cFOOT-seq, a cytosine deaminase-based TF footprinting assay, for high-resolution, quantitative genome-wide assessment of TF binding in both open and closed chromatin regions, even with small cell numbers. By utilizing the dsDNA deaminase SsdAtox, cFOOT-seq converts accessible cytosines to uracil while preserving genomic integrity, making it compatible with techniques like ATAC-seq for sensitive and cost-effective detection of TF occupancy at the single-molecule and single-cell level. Our approach enables the delineation of TF footprints, quantification of occupancy, and examination of chromatin influences on TF binding. Notably, cFOOT-seq, combined with FootTrack analysis, enables de novo prediction of TF binding sites and tracking of TF occupancy dynamics. We demonstrate its application in capturing cell type-specific TFs, analyzing TF dynamics during reprogramming, and revealing TF dependencies on chromatin remodelers. Overall, cFOOT-seq represents a robust approach for investigating the genome-wide dynamics of TF occupancy and elucidating the cis-regulatory architecture underlying gene regulation.
Transcription Factors/genetics* ; Humans ; Chromatin/genetics* ; Animals ; Binding Sites ; Mice ; DNA Footprinting/methods*

Neuroscience is a significant frontier discipline within the natural sciences and has become an important interdisciplinary frontier scientific field. Brain is one of the most complex organs in the human body, and its structural and functional analysis is considered the “ultimate frontier” of human self-awareness and exploration of nature. Driven by the strategic layout of “China Brain Project”, Chinese scientists have conducted systematic research focusing on “understanding the brain, simulating the brain, and protecting the brain”. They have made breakthrough progress in areas such as the principles of brain cognition, mechanisms and interventions for brain diseases, brain-like computation, and applications of brain-machine intelligence technology, aiming to enhance brain health through biomedical technology and improve the quality of human life. Due to limited understanding and comprehension of neuroscience, there are still many important unresolved issues in the field of neuroscience, resulting in a lack of effective measures to prevent and protect brain health. Therefore, in addition to actively developing new generation drugs, exploring non pharmacological treatment strategies with better health benefits and higher safety is particularly important. Epidemiological data shows that, exercise is not only an indispensable part of daily life but also an important non-pharmacological approach for protecting brain health and preventing neurodegenerative diseases, forming an emerging research field known as motor neuroscience. Basic research in motor neuroscience primarily focuses on analyzing the dynamic coding mechanisms of neural circuits involved in motor control, breakthroughs in motor neuroscience research depend on the construction of dynamic monitoring systems across temporal and spatial scales. Therefore, high spatiotemporal resolution detection of movement processes and movement-induced changes in brain structure and neural activity signals is an important technical foundation for conducting motor neuroscience research and has developed a set of tools based on traditional neuroscience methods combined with novel motor behavior decoding technologies, providing an innovative technical platform for motor neuroscience research. The protective effect of exercise in neurodegenerative diseases provides broad application prospects for its clinical translation. Applied research in motor neuroscience centers on deciphering the regulatory networks of neuroprotective molecules mediated by exercise. From the perspectives of exercise promoting neurogenesis and regeneration, enhancing synaptic plasticity, modulating neuronal functional activity, and remodeling the molecular homeostasis of the neuronal microenvironment, it aims to improve cognitive function and reduce the incidence of Parkinson’s disease and Alzheimer’s disease. This has also advanced research into the molecular regulatory networks mediating exercise-induced neuroprotection and facilitated the clinical application and promotion of exercise rehabilitation strategies. Multidimensional analysis of exercise-regulated neural plasticity is the theoretical basis for elucidating the brain-protective mechanisms mediated by exercise and developing intervention strategies for neurological diseases. Thus,real-time analysis of different neural signals during active exercise is needed to study the health effects of exercise throughout the entire life cycle and enhance lifelong sports awareness. Therefore, this article will systematically summarize the innovative technological developments in motor neuroscience research, review the mechanisms of neural plasticity that exercise utilizes to protect the brain, and explore the role of exercise in the prevention and treatment of major neurodegenerative diseases. This aims to provide new ideas for future theoretical innovations and clinical applications in the field of exercise-induced brain protection.

Objective To construct and validate a predictive model for gastric precancerous le-sions based on urea breath test,serum pepsinogen(PG)and gastrin-17(G-17).Methods Partici-pants who underwent endoscopic screening for upper gastrointestinal tumors were retrospectively en-rolled as study subjects.Using random function,all participants were divided into training cohort of 2,788 cases(comprising 1,290 cases in precancerous lesion group and 1,498 cases in control group)and validation cohort of 1,194 cases(comprising 581 cases in precancerous lesion group and 613 cases in control group)at a ratio of 7 to 3.A simple model was established based on urea breath test,PG and G-17.Clinical data between the precancerous lesion group and the control group in the training cohort were compared.A predictive model for gastric precancerous lesions was constructed u-sing multifactorial Logistic regression analysis,and a scoring model for gastric precancerous lesions(the complete model)was developed based on this predictive model.The complete model,the simple model,the new ABC method,and the Li's score were all included in the validation cohort to compare the predictive performance of the four models.Results Multifactorial Logistic regression analysis indicated that male,smoking,positive Helicobacter pylori(Hp)infection,PG Ⅱ ≥10.19 μg/L,the ratio of PG Ⅰ to PG Ⅱ(PGR)≤11.87,and G-17 ≥3.82 pmol/L were independent risk factors for gastric precancerous lesions(P＜0.05).A predictive model for gastric precancerous lesions was constructed based on these risk factors,and the complete model was established based on the predic-tive model.The total score ranged from 0 to 12(with 6 to 12 indicating a high-risk population for gastric precancerous lesions and 0 to 5 indicating a low-risk population).When the complete model,the simple model,the new ABC method,and the Li's score were included in the validation cohort for comparison,the predictive values of the complete model and the simple model were similar.Both models demonstrated higher sensitivity,specificity,positive predictive value,negative predictive value,and accuracy compared to the new ABC method and the Li's score.Furthermore,the diag-nostic value of the simple model in the high-sensitivity region was slightly superior to that of the com-plete model.Conclusion The simple model constructed based on the urea breath test,PG and G-17 exhibits favorable predictive efficacy,calibration,and clinical utility,and is of positive signifi-cance for the early identification of patients with gastric precancerous lesions.

OBJECTIVE: To investigate the accuracy and safety of pedicle screw placement using 3D-printed auxiliary guides in scoliosis correction surgery for adolescents. METHODS: A retrospective analysis was conducted on the clinical data of 51 patients who underwent posterior scoliosis correction surgery from January 2020 to March 2023. Among them, there were 35 cases of adolescent idiopathic scoliosis and 16 cases of congenital scoliosis. The patients were divided into two groups based on the auxiliary tool used:the 3D-printed auxiliary guide screw placement group (3D printing group) and the free-hand screw placement group (free-hand group, without auxiliary tools). The 3D printing group included 32 patients (12 males and 20 females) with an average age of (12.59±2.60) years;the free-hand group included 19 patients (7 males and 12 females) with an average age of (14.58±3.53) years. The two groups were compared in terms of screw placement accuracy and safety, spinal correction rate, intraoperative blood loss, number of intraoperative fluoroscopies, operation time, hospital stay, and preoperative and last follow-up scores of the Scoliosis Research Society-22 (SRS-22) questionnaire. RESULTS: A total of 707 pedicle screws were placed in the two groups, with 441 screws in the 3D printing group and 266 screws in the free-hand group. All patients in both groups successfully completed the surgery. There was a statistically significant difference in operation time between the two groups (P<0.05). The screw placement accuracy rate of the 3D printing group was 95.46% (421/441), among which the Grade A placement rate was 89.34% (394/441);the screw placement accuracy rate of the free-hand group was 86.47% (230/266), with a Grade A placement rate of 73.31% (195/266). There were statistically significant differences in the accuracy of Grade A, B, and C screw placements between the two groups (P<0.05), while no statistically significant differences were observed in intraoperative blood loss, number of fluoroscopies, correction rate, or hospital stay (P>0.05). In the SRS-22 questionnaire scores, the scores of functional status and activity ability, self-image, mental status, and pain of patients in each group at the last follow-up were significantly improved compared with those before surgery (P<0.05), but there were no statistically significant differences in all scores between the two groups (P>0.05). CONCLUSION In scoliosis correction surgery, compared with traditional free-hand screw placement, the use of 3D-printed auxiliary guides for screw placement significantly improves the accuracy and safety of screw placement and shortens the operation time.
Humans ; Male ; Scoliosis/surgery* ; Female ; Adolescent ; Printing, Three-Dimensional ; Retrospective Studies ; Pedicle Screws ; Child

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Neuroscience,a cutting-edge field in interdisciplinary research,consistently draws considerable research interest,of which quantitatively probing the neurochemical dynamics is essential for brain science research.In vivoelectrochemical analysis,featuring with high sensitivity,high spatiotemporal resolution,free from transfection,and designable electrode/solution interfaces,provides important tools for in vivo neurochemicals sensing.Fast scan cyclic voltammetry combined with microelectrodes can not only enable precise detection of dopamine but also is compatible with existing neurosurgical equipment.This offers new opportunities for the clinical application of in vivo electrochemical analysis and paves new avenues for the diagnosis and treatment of neurological diseases.This review summarized recent progress of in vivo electrochemical techniques for brain neurochemistry and addressed key clinical challenges and their potential solutions.