Objective: To characterize perioperative dynamic changes in immune-cell phenotypes and inflammatory cytokines in patients undergoing CPB (cardiopulmonary bypass) cardiac surgery, and to explore their associations with postoperative outcomes. Methods: In this prospective cohort study, 120 adult patients who underwent elective cardiac surgery under CPB at West China Hospital from May 2022 to March 2023 were enrolled. Perioperative immune-cell phenotypes and concentrations of 40 inflammation-related cytokines were measured. The primary outcomes were the sequential organ failure assessment (SOFA) score at 24 h after surgery and ΔSOFA (the peak SOFA score within 48 h after surgery minus the preoperative SOFA score). Secondary outcomes included major adverse cardiovascular events (MACE), acute kidney injury (AKI), respiratory failure, severe liver injury, and infection. Results: The mean age of enrolled patients was 57±10 years. Of these, 52% (62/120) were male and 90% (108/120) underwent valve surgery. During the rewarming to the end of CPB, neutrophil counts rapidly increased (7.39×10 /L vs preoperative 3.07×10 /L, P<0.001), with significant upregulation of CD11b (7.30×10 /L vs preoperative 3.05×10 /L, P<0.001) and CD54 (7.15×10 /L vs preoperative 2.99×10 /L, P<0.001). Lymphocyte counts increased at the end of CPB (1.75×10 /L vs preoperative 1.12×10 /L, P<0.001) but decreased significantly at 24 h after surgery (0.59×10 /L vs preoperative 1.12×10 /L, P<0.001). Plasma analysis showed that multiple pro-inflammatory cytokines increased during CPB and remained elevated up to 24 h after surgery; five chemokines and the anti-inflammatory cytokine IL-10 peaked at the end of CPB. The SOFA score increased from 1 (1, 2) preoperatively to 7 (5, 10) at 24 h after surgery, with a ΔSOFA of 6 (4, 8). Within 30 days after surgery, 48 patients (40.0%) developed AKI, 17 (14.2%) developed infection, 4 (3.3%) developed severe liver injury, 3 (2.5%) developed respiratory failure, and 3 (2.5%) experienced MACE. During the 2-year follow-up, 8 patients (6.7%) experienced MACE and 5 (4.2%) died. Conclusion: Multi-organ dysfunction is common after cardiac surgery under CPB (median ΔSOFA, 6), accompanied by perioperative activation of multiple immune-cell subsets and upregulation of pro-inflammatory, anti-inflammatory, and chemotactic mediators. This study provides data-driven evidence and research clues for further investigation of the associations between CPB-related immune perturbations and postoperative organ dysfunction and clinical outcomes.

Objective: To investigate the prevalence of undernutrition and its associated factors among left behind and non left behind primary and secondary school students in the Nutrition Improvement Program for Rural Compulsory Education Students (NIPRCES) areas of central and western China, so as to provide evidence for improving the nutritional status of children and adolescents. Methods: A survey was conducted among 123 782 students selected by random cluster sampling method in grades 3-9 from NIPRCES in central (Hebei, Shanxi, Heilongjiang, Jilin, Anhui, Jiangxi, Henan, Hunan, Hubei, and Hainan) and western (Gansu, Guangxi, Inner Mongolia, Ningxia, Tibet, Shaanxi, Guizhou, Sichuan, Xinjiang, the Xinjiang Production and Construction Corps, Yunnan, Qinghai, and Chongqing) China in 2023. Anthropometric measurements and questionnaires were used to assess nutritional and dietary status. The prevalence of undernutrition was compared between left behind and non left behind students by Chi square test, and associated factors were analyzed by three level Logistic mixed effects model. Results: The prevalence of undernutrition was 8.5% (4 326) in left behind students and 8.1% (5 905) in non left behind students. Three level Logistic mixed effect model analysis showed that whether left behind or non left behind, the undernutrition rates of primary and secondary students in western regions were higher than those of students in central regions [ OR (95% CI )=1.72(1.57-1.87),2.25(2.07- 2.43 )]; the undernutrition risk was lower for those whose fathers had a cultural level of high school or above [ OR (95% CI )=0.69(0.62-0.77),0.90(0.82-0.98)] or junior high school [ OR (95% CI )=0.72(0.66-0.79),0.92(0.85-0.99)] compared to those with primary school or below; picky eating or selective eating increased the risk of undernutrition [ OR (95% CI )=2.36(2.07-2.68),2.28(2.04-2.55)], and primary and secondary school students without nutritional content in health education classes had higher rates of undernutrition [ OR (95% CI )=1.12(1.03-1.23),1.09(1.01-1.17)](all P <0.05). Conclusion The prevalence of undernutrition is slightly higher in left behind primary and secondary students than in non left behind primary and secondary students in central and western NIPRCES areas, with variations across different characteristics.

Objective: To analyze the trends of the frequency of meat, egg, and milk consumption among rural primary and junior high school students in central and western China covered by the Nutrition Improvement Program for Rural Compulsory Education Students (NIPRCES) from 2015 to 2023, so as to provide basis for formulating more targeted nutrition intervention policies and health education strategies. Methods: Using data from six rounds of monitoring and evaluation (2015-2021 and 2023), the study included 323 870 students from grade 3 to 9 across 22 provinces (autonomous regions and municipalities) in central and western China. The consumption frequencies of meat, egg, and milk over the past week were collected via questionnaires. The Cochran-Armitage trend test was used to analyze temporal trends, and multivariable Logistic regression models were employed to analyze factors associated with the frequency of meat, egg and milk consumption and to test for interaction effects between the year and gender, region, and grade level. Results: From 2015 to 2023, the proportion of students consuming meat, egg, and milk ≥1 time/day increased from 23.20 %, 10.71%, and 0.74% to 35.53%, 22.09%, and 26.63%, respectively. Trend tests indicated a significant upward trend for the daily intake of all three food categories for meat, egg and milk over the years ( Z =67.18, 64.90, 93.14, all P <0.01). Multivariable Logistic regression analysis showed that the daily meat intake was lower in the central region than in the western region ( OR=0.77, 95%CI =0.76-0.78), whereas the daily intake of eggs ( OR=1.19, 95%CI =1.17-1.22) and milk ( OR= 1.27 , 95%CI =1.24-1.29) was higher in the central region (all P <0.05). Compared with grade 3-4 students, junior high school students had lower daily intake of meat, eggs, and milk≥1 time/day ( OR =0.95, 0.77, 0.77, all P <0.05), with a declining trend as grade increased. Girls also had lower daily intake of meat, eggs, and milk ≥1 time/day than boys ( OR =0.95，0.93，0.91, all P < 0.05). Significant interactions were observed between year and region, as well as between year and grade (all P <0.05). Conclusion From 2015 to 2023, the NIPRCES improved the intake level of among rural students, but the situation of relatively insufficient intake of egg and milk among females, junior high school students and those in the western region still exists.

Objective To investigate the association between physical activity levels and blood lipids among college freshmen, and to provide scientific evidence for the health management of college freshmen. Methods An electronic questionnaire survey on physical activity was conducted on freshmen of a university, and fasting blood biochemical indicators were detected. The International Physical Activity Questionnaire (IPAQ) short form was used to evaluate the physical activity levels of the participants. Dyslipidemia was defined as an abnormality in any one of the following serum lipid parameters: total cholesterol, triglycerides, low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), or non-high-density lipoprotein cholesterol. Binary logistic regression and stratified analyses were employed to explore the relationship between physical activity and blood lipids. Results A total of 3 401 participants were included, with an average age of 18.45 ± 0.92 years, and 60.5% were female. The prevalence of dyslipidemia was 17.7%, with a higher rate among males (22.1%) than females (14.8%). After adjusting for confounding factors related to blood lipids, high-intensity physical activity was negatively associated with the risk of elevated LDL-C among males (OR = 0.36, 95% CI: 0.13–0.99, P = 0.049). Conclusion Among freshmen at a medical college in Hubei Province, high-intensity physical activity is negatively associated with the risk of elevated LDL-C in males, but this association needs to be further confirmed by larger prospective cohort studies.

ObjectiveTo explore the effects of Jingui Shenqiwan （JSW） and Liuwei Dihuangwan （LDW） on the reproductive ability and brain function of normal mice and compare the actions of the two medications. MethodsSeven groups of female and male mice were divided at a ratio of 2∶1. Except for the control group， the other six groups were as follows： a group of both males and females receiving JSW （3.0 g·kg^-1）， a group of both males and females receiving LDW （4.5 g·kg^-1）， a group of males receiving water and females receiving JSW， a group of males receiving water while females receiving LDW， a group of females receiving water while males receiving JSW， and a group of females receiving water while males receiving LDW. Each group was administered the drug for 14 days and then caged together at a 2∶1 （female∶male） ratio to detect the number of pregnant mice and calculate the pregnancy rate. Pregnant mice continued receiving the drug until they naturally gave birth， which was followed by the observation of newborn mice， calculation of their average number， and the measurement of the offspring's preference for sugar water and neonatal recognition index. At the end of the experiment， the weights of the thymus and spleen were measured to calculate the organ coefficients， and mRNA or protein expression was analyzed in the brain and testes or ovaries. A 1% sucrose solution was used to examine the euphoria of their brain reward systems， while novel object recognition test （NOR） was applied to assess their memory capabilities. mRNA expression was detected using real-time quantitative polymerase chain reaction （Real-time PCR） assay， and protein expression was analyzed with Western blot. ResultsCompared with the control group， oral administration of JSW to both male and female mice for 14 days significantly increased the pregnancy rate of female mice on day 2 after being caged together （P<0.05）， while LDW showed a trend but no statistical significance. Additionally， compared with the control group， JSW could upregulate the gene expression of gonadotropin-releasing hormone （GnRH） in the thalamus， as well as reproductive stem cell factor （SCF） and tyrosine kinase receptor （c-Kit） in the testes and reproductive stem cell marker mouse vasa homologue （MVH） in the ovaries， upregulate the expression of proteins influencing neuronal functional activity， such as brain-derived neurotrophic factor （BDNF）， in hippocampal neurons （P<0.05）， and enhance sucrose preference in male mice （P<0.05）. Compared with the control group， JSW significantly increased sucrose preference and novel object recognition index in offspring mice （P<0.05）， which was related to the upregulation of hippocampal dopamine D1 receptor （D1R） and N-methyl-D-aspartate receptor （Nmdar） gene expression. Compared with the control group， both JSW and LDW could upregulate the protein expression of glucocorticoid receptor （GR）， BDNF， and tyrosine kinase receptor B （TrkB） in the hippocampus of offspring mice （P<0.05）. ConclusionJSW significantly enhances the reproductive ability of normal mice， which is not only related to the release of gonadotropin but also associated with its regulation of brain function. Additionally， JSW has a certain regulatory effect on the brain function of the offspring mice.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To evaluate the effectiveness of single-balloon and double-balloon enteroscopy in diagnosing pediatric small bowel diseases and assess the diagnostic efficacy of computed tomography enterography (CTE) for small bowel diseases using enteroscopy as the reference standard. METHODS: Clinical data from 576 children who underwent enteroscopy at Hunan Children's Hospital between January 2017 and December 2023 were retrospectively collected. The children were categorized based on enteroscopy type into the single-balloon enteroscopy (SBE) group (n=457) and double-balloon enteroscopy (DBE) group (n=119), and the clinical data were compared between the two groups. The sensitivity and specificity of CTE for diagnosing small bowel diseases were evaluated using enteroscopy results as the standard. RESULTS: Among the 576 children, small bowel lesions were detected by enteroscopy in 274 children (47.6%).There was no significant difference in lesion detection rates or complication rates between the SBE and DBE groups (P>0.05), but the DBE group had deeper insertion, longer procedure time, and higher complete small bowel examination rate (P<0.05). The complication rate during enteroscopy was 4.3% (25/576), with 18 cases (3.1%) of mild complications and 7 cases (1.2%) of severe complications, which improved with symptomatic treatment, surgical, or endoscopic intervention. Among the 412 children who underwent CTE, the sensitivity and specificity for diagnosing small bowel diseases were 44.4% and 71.3%, respectively. CONCLUSIONS SBE and DBE have similar diagnostic efficacy for pediatric small bowel diseases, but DBE is preferred for suspected deep small bowel lesions and comprehensive small bowel examination. Enteroscopy in children demonstrates relatively good overall safety. CTE demonstrates relatively low sensitivity but comparatively high specificity for diagnosing small bowel diseases.
Retrospective Studies ; Treatment Outcome ; Double-Balloon Enteroscopy/statistics & numerical data* ; Single-Balloon Enteroscopy/statistics & numerical data* ; Humans ; Male ; Female ; Child ; Operative Time ; Tomography, X-Ray Computed/statistics & numerical data* ; Sensitivity and Specificity ; Intestine, Small/surgery* ; Intestinal Diseases/surgery*

OBJECTIVE: To investigate the safety and efficacy of avatrombopag（AVA） combined with rhIL-11 in treating thrombocytopenia induced by chemotherapy in acute myeloid leukemia. METHODS: The clinical information of 8 patients in the real world who received avatrombopag combined with rhIL-11 in cancer treatment-induced thrombocytopenia(CTIT) after AML chemotherapy were retrospectively analyzed, and at the same time, 8 patients who received rhIL-11 only in CTIT after AML chemotherapy served as the control group, A preliminary observation was to summarize and compare the therapeutic efficacy and adverse effects between the two groups. RESULTS: D3 and D7 platelet counts were not significantly different between the observation group and the control group after treatment. The platelet counts in the observation group was significantly higher than those of the control group on the 10th day after treatment (P < 0.01). The adverse reactions, such as weakness, abdominal pain, fatigue, nausea and edema after treatment were mild in the observation group and the control group. Except for one patient in the observation group who had a history of cerebral infarction before the onset of the disease and was routinely taking antiplatelet drugs, no thrombosis events occurred in the patients in the observation and control groups during the period of administration of the drug, and the total incidence rate of adverse reactions was not significantly different between the two groups. CONCLUSION The combination of AVA and rhIL-11 can enhance platelet recovery in CTIT of AML patients after chemotherapy. Compared with the rhIL-11 alone group, the platelet recovery time in AVA+rhIL-11 group was significantly shorter, the platelet count on the 10th day after drug administration was significantly higher. No statistically significant difference in the total incidence rate of adverse reactions was observed between rhIL-11 alone group and AVA+rhIL-11 group.
Humans ; Leukemia, Myeloid, Acute/drug therapy* ; Thrombocytopenia/chemically induced* ; Interleukin-11/therapeutic use* ; Retrospective Studies ; Adult ; Thiophenes/therapeutic use* ; Platelet Count ; Female ; Male ; Middle Aged ; Thiazoles

OBJECTIVE: To investigate possible associations between physical function assessment scales, such as Short Physical Performance Battery (SPPB) and Berg Balance Scale (BBS), with all-cause mortality in acute decompensated heart failure (ADHF) patients. METHODS: A total of 108 ADHF patients were analyzed from October 2020 to October 2022, and followed up to May 2023. The association between baseline clinical characteristics and all-cause mortality was analyzed by univariate Cox regression analysis, while for SPPB and BBS, univariate Cox regression analysis was followed by receiver operating characteristic curves, in which the area under the curve represented their predictive accuracy for all-cause mortality. Incremental predictive values for both physical function assessments were measured by calculating net reclassification index and integrated discrimination improvement scores. Optimal cut-off value for BBS was then identified using restricted cubic spline plots, and survival differences below and above that cut-off were compared using Kaplan-Meier survival curves and the log-rank test. The clinical utility of BBS was measured using decision curve analysis. RESULTS: For baseline characteristics, age, female, blood urea nitrogen, as well as statins, angiotensin-converting enzyme inhibitors, angiotensin II receptor blockers, or angiotensin receptor-neprilysin inhibitors, were predictive for all-cause mortality for ADHF patients. With respect to SPPB and BBS, higher scores were associated with lower all-cause mortality rates for both assessments; similar area under the curves were measured for both (0.774 for SPPB and 0.776 for BBS). Furthermore, BBS ≤ 36.5 was associated with significantly higher mortality, which was still applicable even adjusting for confounding factors; BBS was also found to have great clinical utility under decision curve analysis. CONCLUSIONS BBS or SPPB could be used as tools to assess physical function in ageing ADHF patients, as well as prognosticate on all-cause mortality. Moreover, prioritizing the improvement of balance capabilities of ADHF patients in cardiac rehabilitation regimens could aid in lowering mortality risk.

eIF3a is a N ⁶-methyladenosine (m⁶A) reader that regulates mRNA translation by recognizing m⁶A modifications of these mRNAs. It has been suggested that eIF3a may play an important role in regulating translation initiation via m⁶A during infection when canonical cap-dependent initiation is inhibited. However, the death of animal model studies impedes our understanding of the functional significance of eIF3a in immunity and regulation in vivo. In this study, we investigated the in vivo function of eIF3a using eIF3a knockout and knockdown mouse models and found that eIF3a deficiency resulted in splenic tissue structural disruption and multi-organ damage, which contributed to severe sepsis induced by Lipopolysaccharide (LPS). Ectopic eIF3a overexpression in the eIF3a knockdown mice rescued mice from LPS-induced severe sepsis. We further showed that eIF3a maintains a functional and healthy immune system by regulating B cell function and quantity through m⁶A modification of mRNAs. These findings unveil a novel mechanism underlying sepsis, implicating the pivotal role of B cells in this complex disease process regulated by eIF3a. Furthermore, eIF3a may be used to develop a potential strategy for treating sepsis.