1.Two cases of developmental and epileptic encephalopathy related to the EEF1A2 gene and a literature review
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Neurology 2025;58(4):404-413
Objective:To investigate the clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene. Methods:The clinical data and whole exome sequencing results of 2 patients who were diagnosed as developmental and epileptic encephalopathy related to the EEF1A2 gene in the Children′s Hospital, Capital Institute of Pediatrics in June 2016 and August 2018 were retrospectively analyzed. Relevant literatures were retrieved using " EEF1A2" and "epileptic encephalopathy" or "epilepsy" as key words in Online Mendelian Inheritance in Man, PubMed, CNKI and Wanfang databases (literatures searching from establishment of these databases to June 2024). The clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene were summarized based on literature reports and the data of these 2 patients. Results:Patient 1 was a 9 months old male infant. He presented with global developmental delay. He developed myoclonic seizures at 4 months old. Valproic acid, clonazepam, topiramate and vagus nerve stimulation were all ineffective. Both of his hands had transverse palmar crease. The de novo c.364G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Patient 2 was a 2 years and 2 months old boy. He presented with global developmental delay. Myoclonic seizures occurred when he was 2 years and 3 months old, and various anti-epileptic drugs were ineffective. He had left eye esotropia and low muscle tone in the extremities. He died at the age of 4. The de novo c.208G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Eight literatures on developmental and epileptic encephalopathy related to the EEF1A2 gene (all in English) were retrieved, reporting 28 cases (totally 30 patients, including 2 cases in this study). The main clinical manifestations were psychomotor developmental delay (30/30, 100.0%), facial dysmorphism (15/30, 50.0%), refractory epilepsy (14/26, 53.8%), myoclonic seizures (19/26, 73.1%), and movement disorders (8/16). A total of 15 mutation sites in the EEF1A2 gene were reported, all of which were missense mutations. Conclusions:Developmental and epileptic encephalopathy related to the EEF1A2 gene is primarily characterized by delayed psychomotor development, distinctive facial features, drug-resistant epilepsy, myoclonic seizures, and movement disorders. Variants in the EEF1A2 gene are predominantly missense mutations, and identifying these variants plays a crucial role in accurate diagnosis of the disease.
2.Analysis of clinical characteristics and etiologies of hospitalized patients with spike-and-wave activation in sleep
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Applied Clinical Pediatrics 2025;40(6):426-433
Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.
3.Analysis of clinical characteristics and etiologies of hospitalized patients with spike-and-wave activation in sleep
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Applied Clinical Pediatrics 2025;40(6):426-433
Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.
4.Two cases of developmental and epileptic encephalopathy related to the EEF1A2 gene and a literature review
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Neurology 2025;58(4):404-413
Objective:To investigate the clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene. Methods:The clinical data and whole exome sequencing results of 2 patients who were diagnosed as developmental and epileptic encephalopathy related to the EEF1A2 gene in the Children′s Hospital, Capital Institute of Pediatrics in June 2016 and August 2018 were retrospectively analyzed. Relevant literatures were retrieved using " EEF1A2" and "epileptic encephalopathy" or "epilepsy" as key words in Online Mendelian Inheritance in Man, PubMed, CNKI and Wanfang databases (literatures searching from establishment of these databases to June 2024). The clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene were summarized based on literature reports and the data of these 2 patients. Results:Patient 1 was a 9 months old male infant. He presented with global developmental delay. He developed myoclonic seizures at 4 months old. Valproic acid, clonazepam, topiramate and vagus nerve stimulation were all ineffective. Both of his hands had transverse palmar crease. The de novo c.364G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Patient 2 was a 2 years and 2 months old boy. He presented with global developmental delay. Myoclonic seizures occurred when he was 2 years and 3 months old, and various anti-epileptic drugs were ineffective. He had left eye esotropia and low muscle tone in the extremities. He died at the age of 4. The de novo c.208G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Eight literatures on developmental and epileptic encephalopathy related to the EEF1A2 gene (all in English) were retrieved, reporting 28 cases (totally 30 patients, including 2 cases in this study). The main clinical manifestations were psychomotor developmental delay (30/30, 100.0%), facial dysmorphism (15/30, 50.0%), refractory epilepsy (14/26, 53.8%), myoclonic seizures (19/26, 73.1%), and movement disorders (8/16). A total of 15 mutation sites in the EEF1A2 gene were reported, all of which were missense mutations. Conclusions:Developmental and epileptic encephalopathy related to the EEF1A2 gene is primarily characterized by delayed psychomotor development, distinctive facial features, drug-resistant epilepsy, myoclonic seizures, and movement disorders. Variants in the EEF1A2 gene are predominantly missense mutations, and identifying these variants plays a crucial role in accurate diagnosis of the disease.
5.Molecular epidemiological analysis of tracing and analysis of Yersinia pestis strains isolated from two human plague outbreaks with unknown sources in Gansu Province
GUO Limin ; HE Aiwei ; XI Jinxiao ; WU bin ; WANG Dingsheng ; XU Daqin ; ZHANG Xiaoyan
China Tropical Medicine 2023;23(10):1077-
Abstract: Objective To conduct a molecular epidemiological tracing and analysis of Yersinia pestis strains isolated from two human plague outbreaks with unknown sources in Gansu Province, China. The results of this analysis would provide a basis for isolating and controlling the sources of Yersinia pestis. Methods The strains of Yersinia pestis isolated from two human plague outbreaks occurring on December 12, 2017, and September 27, 2019 were genotyped by the different region (DFR) and the clustered regularly interspaced short palindromic repeats (CRISPR). The repeat numbers of the variable number tandem repeat (VNTR) loci in the tested strains of Yersinia pestis were calculated by the multiple variable number tandem repeats analysis (MLVA), and the location of the phylogenetic tree of the tested strains was determined with the method of minimum spanning tree (MST) by the software BioNumerics 6.6. Results The strain of 20171212 lacked DFR01, DFR02, DFR03, DFR04, DFR13, DFR23, and the DFR type was identified as type 8. The space sequence of YPa was a1'-a2-a3-a4-a5-a6-a7-a35, the space sequence of YPb was b1-b2-b3-b4, the space sequence of YPc was c1-c2-c3, the gene cluster of CRISPR was Ca35', the genotype of CRISPR was 26'. MLVA clustering analysis showed that the strain clustered within in the cluster of Yuerhong pasture in Subei County and formed an independent branch. On the other hand, the strain of 20190927 lacked DFR01, DFR13 and DFR23, with the DFR type identified as type 1b. The space sequence of YPa was a1-a2-a3-a4-a5-a6-a7, the space sequence of YPb was b1-b2-b3-b4, the space sequence of YPc was c1-c2-c3, the gene cluster of CRSIPR was Ca7, the genotype of CRSIPR was 22 MLVA clustering analysis showed that the strain was located close to the cluster of Dangjinshan in Akesai County, and relatively distant from the cluster of Yuerhong pasture in Subei County. Conclusions The genotypes of strain 20171212 by DFR and CRISPR were consistent with the main genotypes of Y. pestis from Himalayana Marmota foci in Subei County, which confirmed that the human plague cases were naturally occurring locally. However, the strain gathered the cluster of Yuerhong pasture in Subei County, which indicated that the source of infection was not in Yanchiwan Town, but in the surrounding area of the Yuerhong pasture. The genotypes of strain 20190927 by DFR and CRISPR were in accordance with the main genotype of Y. pestis from Himalayana Marmota foci in Akesai County and were closer to the cluster of Dangjinshan in Aksai County than to
6.Genotyping of Yersinia pestis in Gansu Province by single nucleotide polymorphism
Aiwei HE ; Limin GUO ; Jinxiao XI ; Shiming WANG ; Kejun MIAO ; Bin WU ; Daqin XU ; Pinggui WANG
Chinese Journal of Endemiology 2022;41(11):883-889
Objective:To study the genotyping and regional distribution characteristics of Yersinia pestis by single nucleotide polymorphism (SNP) in Gansu Province. Methods:A total of 52 strains of Yersinia pestis isolated from Himalaya Marmot plague foci and Spermophilus alaschanicus plague foci in Gansu Province from 1962 to 2017 were selected for culture and extraction of DNA. The genomic DNA of Yersinia pestis was sequenced by the second generation of Illumina PE150 to identify the SNP sites. The species characteristics of Yersinia pestis in Gansu Province was determined by the Kimura-2-parameter model of neighbor joining of Mega 10.0 software based on the SNP sites. The molecular evolutionary tree of the groups was determined by Hasegawa-Kishino-Yano model of maximum likelihood method according to the SNP sites. Results:A total of 103 SNP sites were identified in 52 strains of Yersinia pestis in Gansu Province, including 28 intergenic loci, 43 non-synonymous mutations, 31 synonymous mutations and 1 nonsense mutation. The 52 strains of Yersinia pestis were divided into 2 biotypes and 3 groups, which were ancient type (1.IN2, 3.ANT) and medieval type (2.MED). Among them, 35 strains belonged to 1.IN2 group, 13 strains belonged to 3.ANT group, and 4 strains belonged to 2.MED group. The 1.IN2 group was further divided into 5 subgroups: the groups of Yuerhong Town and Dangchengwan Town in Subei County, the groups of Mati Town and Dahe Town in Sunan County, and the group of Xiahe County. The 3.ANT group was further divided into 2 subgroups: the groups of Hongliuwan Town in Aksay County and Machang in Dangchengwan Town of Subei County. Conclusion:The SNP method can be used to genotype Yersinia pestis from different plague foci in Gansu Province, which has certain regional characteristics.
7.Analysis of the plague epidemic characteristics in the natural foci of the Qilian Mountains-A-erh-chin Mountains Himalayan marmot plague in Gansu Province from 2011 to 2018
Daqin XU ; Jinxiao XI ; Dingsheng WANG ; Pinggui WANG ; Shiming WANG ; Kejun MIAO ; Bin WU ; Limin GUO ; Taoxia MU
Chinese Journal of Endemiology 2021;40(2):137-141
Objective:To understand the plague epidemic characteristics in the natural foci of the Qilian Mountains-A-erh-chin Mountains Himalayan marmot plague in Gansu Province, and to provide scientific basis for innovative prevention and control of the plague in combination with local conditions. Methods:A retrospective study was used to collect the monitoring data of the natural foci of plague in Gansu Province from 2011 to 2018 (from the epidemic surveillance files of the Center for Disease Control and Prevention of Gansu Province and direct network reporting information). Descriptive epidemiological method was used to analyze the plague epidemic characteristics of natural foci of the Qilian Mountains-A-erh-chin Mountains Himalayan marmot plague in Gansu Province from 2011 to 2018, including the distribution of host animals, pathogenic and serological testing of the plague bacteria, and the epidemic characteristics of human plague. Results:From 2011 to 2018, the total average marmot density in the natural foci of the Qilian Mountains-A-erh-chin Mountains Himalayan marmot plague in Gansu Province was 0.21/hm 2, of which Tianzhu County had the highest average marmot density of 0.58/hm 2, and Jiayuguan City had the lowest average marmot density of 0.01/hm 2. A total of 381 strains of Yersinia pestis were isolated in the foci, of which 4 were isolated from human corpses, 298 were host animals, and 79 were infectious vectors. Among them, the top 3 counties (cities) of isolated strains were Aksai County (38.85%, 148 strains), Subei County (31.50%, 120 strains) and Yumen City (16.27%, 62 strains). A total of 6 860 marmot serum, 1 769 dog serum were tested, the F1 antibody positive rates were 2.70% (185/6 860), 8.42% (149/1 769); and the F1 antigen positive rate of 814 animal materials was 4.30% (35/814), respectively. There were 4 times of human plague, 4 cases occurred and 4 cases died; 3 times occurred in Subei County and 1 time in Yumen City. The onset months were July, September, November and December. Active contact with infected animals such as shepherd dogs was the main route of infection, and migrant herders were the key occupation population. Conclusions:The animal epidemic situation in the natural foci of the Qilian Mountains-A-erh-chin Mountains Himalayan marmot plague in Gansu Province is active, and the plague presents different epidemic states in different regions. The prevention and control measures should be taken according to local conditions and guided by classification to strictly prevent the occurrence and transmission of the plague.
8.Caspase recruitment domain-containing protein 9 gene deficiency associated invasive candidiasis: a case report and literature review
Jinxiao CHEN ; Ping ZHENG ; Shuo FENG ; Di WU ; Mingxing WU ; Qian CHEN ; Bingke ZHANG ; Xue ZHANG
Chinese Journal of Neurology 2021;54(4):355-361
Objective:To summarize the clinical characteristics, diagnosis and treatment of caspase recruitment domain-containing protein 9 (CARD9) gene deficiency associated invasive candidiasis, and report a novel mutation in CARD9 gene.Methods:The clinical characteristics, laboratory tests, treatment and the outcome of follow-up in a boy with invasive candidiasis were described. The boy′s main clinical manifestations were central nervous system infection and retroperitoneal mass. Whole-exome sequencing was performed and Sanger sequencing was verified to identify the CARD9 gene mutations in the patient and his parents. A literature search for “CARD9”and “invasive candidiasis”was conducted in PubMed, Wanfang and CNKI databases from their establishment to May 2020.Results:A 10-year-old boy suffered onset symptom of chronic diarrhea, which lasted for two months. The symptom was followed by progressive neurological symptoms such as headache, vomiting, seizures and disorder of consciousness. His unusual medical history was absent. Candida albicans were cultured several times in cerebrospinal fluid and blood, and yeast-like fungi were found in the stool high power field of vision. Cerebral magnetic resonance imaging indicated obstructive hydrocephalus and abdominal CT scan showed retroperitoneal mass and thickening of the intestinal wall. The whole-exome sequencing analyses of blood samples from the boy and his parents were performed. The results showed that there was a homozygous mutation of c.952-12_956delinsAG in the CARD9 gene, which was an unreported pathogenic mutation. This was confirmed by Sanger sequencing. There was no significant relief from intravenous combined antifungal medications. After lateral ventricular drainage surgery and injection of amphotericin B into the lateral ventricle, improvement of clinical symptoms and cerebral spinal fluid abnormalities was observed after nine weeks, and the retroperitoneal mass shrank. At follow-up after four-month oral combined antifungal medications, the child had no complaint except fatigue. However, cerebral spinal fluid analysis showed increased protein level and decreased glucose. Persistent hydrocephalus and periventricular white matter abnormal signals were revealed on the brain magnetic resonance imaging and the smaller retroperitoneal mass than before on the abdominal CT scan. In addition to this case, totally 21 cases with CARD9 gene deficiency associated invasive candidiasis have been reported worldwide, most of which featured central nervous system infections.Conclusions:CARD9 gene deficiency is an autosomal recessive primary immunodeficiency that confers human susceptibility to fungal disease. The associated invasive candidiasis often affects the central nervous system and makes the patient severely ill. Adequate systemic antifungal therapies should be given, and patients with hydrocephalus need surgical treatment. A novel mutation is reported that expands the variant diversity of CARD9 gene. For patients with unexplained invasive candidiasis, including those without a history of previous recurrent infection, genetic testing is recommended for primary immunodeficiency including CARD9 gene deficiency.
9.Non-linear effects of meteorological factors on plague epidemics in the plague foci of Subei and Sunan counties of Gansu Province
Dingsheng WANG ; Pengfei GE ; Jinxiao XI ; Yongqiang SU ; Daqin XU ; Yongzhi GAI ; Bin WU
Chinese Journal of Endemiology 2020;39(1):27-32
Objective:To analyse the effects of meteorological factors on plague epidemic in Himalayana marmot plague natural foci in Subei and Sunan counties of Gansu Province. Methods:The surveillance data of plague from 1973 to 2016 in Himalayan marmot foci of Subei and Sunan counties (from Gansu Provincial Center for Disease Control and Prevention) and the meteorological factors (rainfall, temperature, relative humidity) of current, preceding first, second and third years (the first, second and third years before the reference year, from China Meteorological Data Sharing Service System) were collected. In order to build generalized additive model (GAM), the positive rate of plague was used as dependent variable while meteorological factors of the current, preceding first, second and third years were used as independent variables. The influence of meteorological factors on plague was quantitatively analyzed by using R2.3.2 software. Results:In 2006 - 2016, compared with 1974 - 1983, the average temperature in Subei rose by 0.99 ℃, the average relative humidity rose by 3.55%RH, and the average rainfall rose by 12.16 mm; in Sunan County, the average temperature rose by 1.00 ℃, the average relative humidity rose by 2.01%RH, and the average rainfall rose by 14.60 mm. From 1973 to 2016, 11 cases of human plague with 7 cases of dead (12 cases of attack) occurred in the investigated district. The average rainfall of the preceding third year of Subei rose every 1.00 mm within a certain range, the animal plague occurred rose by 0.40%. The average relative humidity of preceding second year of Subei rose every 1.00%RH within a certain range, animal plague occurred rose by 11.66%. The average rainfall of the preceding first year of Sunan rose every 1.00 mm within a certain range, the animal plague occurred rose by 1.32%. The average relative humidity of preceding third year of Sunan rose every 1.00%RH within a certain range, animal plague occurred rose by 11.96%. The average temperature of the preceding second year of Subei, Sunan rose every 1.00 ℃ within a certain range, animal plague rose 73.17%, 70.18%, respectively.Conclusions:The occurrence and prevalence of plague in Himalayana marmot are closely related to meteorological factors, and the temperature within a certain range (but not continuously) not only promotes the epidemic of plague, but also has a lag effect. In addition, the effects of different types of climate in the same foci on the prevalence of animal plague vary.
10.Effect of intercellular adhesion molecule-1-targeted miR-133a-5p on lipopolysaccharide-induced alveolar epithelial A549 cell injury
Yudong LIU ; Jinxiao HE ; Huajie WU ; Zhaoling SHI ; Hao WANG ; Xinwei YANG
Chinese Journal of Applied Clinical Pediatrics 2020;35(16):1239-1243
Objective:To investigate the effect of intercellular adhesion molecule-1 (ICAM1) targeted miR-133a-5p on lipopolysaccharide (LPS)-induced alveolar epithelial A549 cell injury.Methods:Dual lucife-rase reporter assay was used to verify the ICAM1 targeted effect of miR-133a-5p.A549 cells were induced by LPS in vitro and divided into the control group, LPS group, LPS+ negative control(miR-NC) group, LPS+ miR-133a-5p group, LPS+ small interfering RNA(si)-NC group, and LPS+ si-ICAM1 group.The expression levels of miR-133a-5p and ICAM1 mRNA were detected by real-time fluorescent quantitative PCR.Apoptosis was detected by flow cytometry.The expression levels of ICAM1, Bcl-2, Bax and cleaved caspase-3 protein that could activate cysteine were detected by Western blot.The expression levels of interleukin-6 (IL-6) and tumor necrosis factor α(TNF-α) were detected by enzyme linked immunosorbent assay kit. Results:Compared with the control group, the LPS group had a decreased expression level of miR-133a-5p (0.39±0.04 vs.1.00±0.09) in A549 cells, increased expression of ICAM1 (0.86±0.08 vs.0.39±0.03), an increased apoptotic rate [(27.65±2.47)% vs.(8.13±0.89)%], and increased secretion of IL-6 [(624.59 ± 51.42) ng/L vs.(194.25±18.43) ng/L] and TNF-α [(548.35±51.42) ng/L vs.(174.26±19.43) ng/L]. The differences were significant (all P<0.05). Compared with the LPS+ miR-NC group, the apoptosis rate of A549 cells [(13.46±1.38)% vs.(28.71±2.54)%] in LPS+ miR-133a-5p group were significantly decreased, and the secretion of IL-6 [(296.43±23.51) ng/L vs.(635.86±55.41) ng/L] and TNF-α [(321.14±30.56) ng/L vs.(563.24±49.52) ng/L] was significantly decreased (all P<0.05). Compared with LPS+ si-NC group, the apoptosis rate of A549 cells [(13.65±1.64)% vs.(23.51±2.33)%] in LPS+ si-ICAM1 group was significantly decreased, and the secretion of IL-6 [(324.15±29.41) ng/L vs.(625.39±52.59) ng/L] and TNF-α [(334.65±20.46) ng/L vs.(534.97±51.42) ng/L] were significantly decreased (all P<0.05). Conclusions:miR-133a-5p can alleviate LPS-induced alveolar epithelial cell injury, and the mechanism may be related to down-regulation of ICAM1 expression.

Result Analysis
Print
Save
E-mail