AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.

It is very limited that the benefit of perioperative chemotherapy in early non-small cell lung cancer (NSCLC), and the 5-year survival rate is only 5% higher than surgery. Antibodies that block programmed cell death protein 1/programmed death-ligand 1 significantly improve the survival of advanced NSCLC. The value of immunotherapy in early NSCLC is also being explored. This paper firstly summarized and analyzed the progress of immunotherapy in the perioperative period of NSCLC. Secondly, the safety and feasibility of surgical resection after neoadjuvant immunotherapy were discussed. Finally, the clinical value of different therapeutic efficacy prediction indicators was summarized, in order to clarify the current status of immunotherapy in the perioperative period, so as to improve the clinical benefits of early NSCLC patients.

With the continuous deepening of the concept of precision diagnosis and treatment for lung cancer, how to achieve higher efficiency and accuracy in the screening, diagnosis, and treatment pathways in clinical practice has become an important issue that urgently needs to be overcome. The current clinical difficulty lies in the fact that despite continuous advancements in imaging and molecular diagnostic technologies, there are still limitations in manual efficiency and subjective experience when it comes to massive data analysis and multi-scale feature extraction. Artificial intelligence (AI), especially algorithm systems based on deep learning, is an innovative technology capable of deeply empowering medical big data. This method utilizes algorithms such as convolutional neural networks, combined with radiomics, pathomics, and multi-modal data fusion analysis, demonstrating immense potential in early precise detection and benign-malignant differentiation of pulmonary nodules, digital pathological subtype recognition and non-invasive prediction of driver genes, precise 3D surgical planning and automatic delineation of radiotherapy target volumes, as well as dynamic risk warning during follow-up. This innovative technology provides a brand-new solution for realizing intelligent and individualized lung cancer diagnosis and treatment models. This consensus, based on the latest evidence from evidence-based medicine and combined with the development trends in the AI field and real-world clinical needs, was ultimately formed by gathering the consensus opinions of multidisciplinary experts in radiology, pathology, thoracic surgery, and other fields. The main content covers the application specifications of AI in the three core scenarios of lung cancer screening, diagnosis, and treatment, the technical standards for data collection and algorithm validation, as well as the ethical and regulatory challenges faced at the current stage. It aims to clarify the applicable boundaries of AI as a clinical auxiliary decision support tool, providing scientific guidance and standardized exploration directions for peers currently engaged in or planning to carry out AI-assisted clinical diagnosis, treatment, and translation of lung cancer.

Objective To analyze the application of NCompass nitinol stone retrieval basket in ureteroscopic holmium laser lithotripsy, and to evaluate its roles in reducing stone retropulsion and improving stone-free rate(SFR)and stone acquisition rate.Methods A retrospective analysis was conducted on the data of patients with upper ureteral stones＞1 cm who underwent ureteroscopic holmium laser lithotripsy at China-Japan Friendship Hospital during Jan.2018 and Dec.2023, including 96 cases were in the NCompass group, and 68 cases in the non-basket group.The operation time, stone retropulsion rate, usage rate of flexible ureteroscopy, SFR and stone acquisition rate were compared between the two groups.Results There were no significant differences in the operation time [(29.2±8.4)min vs.(30.9±7.2)min, P=0.170] and stone retropulsion rate(15.6% vs. 27.9%, P=0.055)between the NCompass group and non-basket group.The NCompass group had significantly lower usage rate of flexible ureteroscopy than the non-basket group(24.0% vs. 47.1%, P=0.002), higher SFR 2 days(80.2% vs. 45.6%, P＜0.001)and 1 month(93.8% vs. 83.8%, P=0.040)after operation, as well as the stone acquisition rates 2 days(100% vs. 44.1%, P＜0.001)and 1 month(100% vs. 58.8%, P＜0.001)after operation. Conclusion The NCompass nitinol stone retrieval basket plays dual roles in ureteroscopic holmium laser lithotripsy, which can effectively intercept stones and extract stone fragments, thus significantly improving the SFR and stone acquisition rate, and reducing stone retropulsion and the use of flexible ureteroscopy.

To formulate an expert consensus on the principles of preoperative hair removal and provide scientific guidance for standardized removal of hair before surgical procedures so as to reduce the incidence of surgical site infections.METHODS Led by the Hospital Management Institute of National Health Commission of the People's Republic of China,this consensus was reached with the joint efforts from the expects of relevant fields such as surgeries,interventional therapies,nursing,and infection prevention and control.The consensus facilitates the classification and evaluation of literatures by following the evidence grade formulated by Oxford Evidence-based Medicine Center and focuses on the association of preoperative hair removal with surgical site infection,it reaches the evidence grade of expert consensus and recommendation intensity by integrating with discussions on meetings and clinical experience of the expects from relevant fields.RESULTS A total of 6 items of consensus were reached by summarizing the latest evidence on the aspects including the indications for preoperative hair removal,tools,range,timing and places.CONCLUSION The consensus,to some extent,make supplements to and complete the exiting regulations and standards.It provides guidance for the medical institutions to carry out the preoperative hair removal.

Objective:To investigate the relationship between macrophage activation related factors and clini-cal symptoms of schizophrenia(SCZ).Methods:Outpatient or inpatient SCZ patients(n=166)and normal con-trols(n=71)meeting the diagnostic criteria of DSM 4th edition were selected as subjects.The psychopathological symptoms were assessed by the Positive and Negative Syndrome Scale(PANSS),and the concentrations of α-Na-Galases,MAF and IL-18 were determined by enzyme-linked immunosorbent assay(ELISA).The correlation be-tween biological indicators and clinical symptoms was analyzed and the mediation effect was tested.Results:The concentrations of α-NaGalases(P＜0.001)and MAF(P＜0.01)in SCZ group were lower than those in normal control group.In SCZ group,IL-18 was negatively correlated with α-NaGalases concentration(r=-0.24,P＜0.01).α-NaGalases was positively correlated with MAF concentration(r=0.67,P＜0.001),and the total score of PANSS positive symptom scale was positively correlated with IL-18(r=0.21,P＜0.05)and MAF concentration(r=0.22,P＜0.01).The mediating effect of α-NaGalases and MAF was statistically significant,and the relative mediating effect accounted for 25.47％.Conclusion:The increase of IL-18 level may indicate the occurrence of positive symptoms of schizophrenia,and α-NaGalases and MAF may negatively regulate the inflammatory damage effect of IL-18 on SCZ,thereby reducing the positive symptoms.

To formulate an expert consensus on the principles of preoperative hair removal and provide scientific guidance for standardized removal of hair before surgical procedures so as to reduce the incidence of surgical site infections.METHODS Led by the Hospital Management Institute of National Health Commission of the People's Republic of China,this consensus was reached with the joint efforts from the expects of relevant fields such as surgeries,interventional therapies,nursing,and infection prevention and control.The consensus facilitates the classification and evaluation of literatures by following the evidence grade formulated by Oxford Evidence-based Medicine Center and focuses on the association of preoperative hair removal with surgical site infection,it reaches the evidence grade of expert consensus and recommendation intensity by integrating with discussions on meetings and clinical experience of the expects from relevant fields.RESULTS A total of 6 items of consensus were reached by summarizing the latest evidence on the aspects including the indications for preoperative hair removal,tools,range,timing and places.CONCLUSION The consensus,to some extent,make supplements to and complete the exiting regulations and standards.It provides guidance for the medical institutions to carry out the preoperative hair removal.

Objective:To investigate the relationship between macrophage activation related factors and clini-cal symptoms of schizophrenia(SCZ).Methods:Outpatient or inpatient SCZ patients(n=166)and normal con-trols(n=71)meeting the diagnostic criteria of DSM 4th edition were selected as subjects.The psychopathological symptoms were assessed by the Positive and Negative Syndrome Scale(PANSS),and the concentrations of α-Na-Galases,MAF and IL-18 were determined by enzyme-linked immunosorbent assay(ELISA).The correlation be-tween biological indicators and clinical symptoms was analyzed and the mediation effect was tested.Results:The concentrations of α-NaGalases(P＜0.001)and MAF(P＜0.01)in SCZ group were lower than those in normal control group.In SCZ group,IL-18 was negatively correlated with α-NaGalases concentration(r=-0.24,P＜0.01).α-NaGalases was positively correlated with MAF concentration(r=0.67,P＜0.001),and the total score of PANSS positive symptom scale was positively correlated with IL-18(r=0.21,P＜0.05)and MAF concentration(r=0.22,P＜0.01).The mediating effect of α-NaGalases and MAF was statistically significant,and the relative mediating effect accounted for 25.47％.Conclusion:The increase of IL-18 level may indicate the occurrence of positive symptoms of schizophrenia,and α-NaGalases and MAF may negatively regulate the inflammatory damage effect of IL-18 on SCZ,thereby reducing the positive symptoms.

Objective: To explore the key factors affecting the selection and effectiveness of bladder management modalities in patients with spinal cord injury，so as to provide reference for the optimization of individualized bladder management strategies. Methods: The clinical and follow-up data of 78 patients with spinal cord injury treated in our hospital during Jan.1,2013 and Dec.31,2022 were retrospectively analyzed.The distribution of bladder management modalities among different grades of injuries was analyzed. Bowker symmetry test was used to evaluate the difference between bladder management modalities at discharge and at the end of follow-up. Multiple linear regression was used to explore the influencing factors of bladder management effects. Plotting Kaplan-Meier survival curves were adopted to calculate the median time of changes in bladder management. Results: At discharge，there were 9 cases of self-catheterization，19 cases of intermittent catheterization，22 cases of reflexive voiding，26 cases of long-term catheterization，and 2 cases using urinary collector.At the end of follow-up，there were 15 cases of self-catheterization，8 cases of intermittent catheterization，34 cases of reflexive voiding，14 cases of long-term catheterization，and 7 cases using urinary collector.There was a significant difference between the modalities of bladder management at discharge and at the end of follow-up (χ =21.43，P=0.018).Multiple linear regression showed a significant decrease of 8.60 in the total neurogenic bladder symptom score (NBSS) for grade D injuries compared with grade A injuries (P=0.026). The median time to bladder management change was 7.93 months (95%CI:5.44-9.44), with approximately 50% of patients experiencing a change in bladder management within 8 months after discharge. Conclusion: The modalities of bladder management changed significantly after discharge.The grade of injury was a key factor affecting the effectiveness of bladder management.Higher grade was associated with worse effectiveness of bladder management.