Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.

It is very limited that the benefit of perioperative chemotherapy in early non-small cell lung cancer (NSCLC), and the 5-year survival rate is only 5% higher than surgery. Antibodies that block programmed cell death protein 1/programmed death-ligand 1 significantly improve the survival of advanced NSCLC. The value of immunotherapy in early NSCLC is also being explored. This paper firstly summarized and analyzed the progress of immunotherapy in the perioperative period of NSCLC. Secondly, the safety and feasibility of surgical resection after neoadjuvant immunotherapy were discussed. Finally, the clinical value of different therapeutic efficacy prediction indicators was summarized, in order to clarify the current status of immunotherapy in the perioperative period, so as to improve the clinical benefits of early NSCLC patients.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Surgical treatment is one of the key approaches for non-small cell lung cancer (NSCLC). Regular postoperative follow-up is crucial for early detection and timely management of tumor recurrence, metastasis, or second primary tumors. A scientifically sound and reasonable follow-up strategy not only extends patient survival but also significantly improves quality of life, thereby enhancing overall prognosis. This consensus aims to build upon the previous version by incorporating the latest clinical research advancements and refining postoperative follow-up protocols for early-stage NSCLC patients based on different treatment modalities. It provides a scientific and practical reference for clinicians involved in the postoperative follow-up management of NSCLC. By optimizing follow-up strategies, this consensus seeks to promote the standardization and normalization of lung cancer diagnosis and treatment in China, helping more patients receive high-quality care and long-term management. Additionally, the release of this consensus is expected to provide insights for related research and clinical practice both domestically and internationally, driving continuous development and innovation in the field of postoperative management for NSCLC.

Numerous c-mesenchymal-epithelial transition(c-MET)inhibitors have been reported as potential anticancer agents.However,most fail to enter clinical trials owing to poor efficacy or drug resistance.To date,the scaffold-based chemical space of small-molecule c-MET inhibitors has not been analyzed.In this study,we constructed the largest c-MET dataset,which included 2,278 molecules with different struc-tures,by inhibiting the half maximal inhibitory concentration(IC50)of kinase activity.No significant differences in drug-like properties were observed between active molecules(1,228)and inactive mol-ecules(1,050),including chemical space coverage,physicochemical properties,and absorption,distri-bution,metabolism,excretion,and toxicity(ADMET)profiles.The higher chemical diversity of the active molecules was downscaled using t-distributed stochastic neighbor embedding(t-SNE)high-dimensional data.Further clustering and chemical space networks(CSNs)analyses revealed commonly used scaffolds for c-MET inhibitors,such as M5,M7,and M8.Activity cliffs and structural alerts were used to reveal"dead ends"and"safe bets"for c-MET,as well as dominant structural fragments consisting of pyr-idazinones,triazoles,and pyrazines.Finally,the decision tree model precisely indicated the key structural features required to constitute active c-MET inhibitor molecules,including at least three aromatic het-erocycles,five aromatic nitrogen atoms,and eight nitrogen-oxygen atoms.Overall,our analyses revealed potential structure-activity relationship(SAR)patterns for c-MET inhibitors,which can inform the screening of new compounds and guide future optimization efforts.

AIM To explore the effects of Dahuang Lingxian Recipe on Th1/Th2 cell immune imbalance in a rat model of cholestatic liver fibrosis(CLF).METHODS 20 SD rats were randomly divided into the normal group,the model group,the ursodeoxycholic acid group(0.063 g/kg)and the Dahuang Lingxian Recipe group(4.8 g/kg),with 5 rats in each group.Except for those of the normal group,the rats of all other groups had open surgery of common bile duct ligation,followed by the gavage of corresponding drug two days later,and the procurement of the samples after gavage in the third week.The rats had their degree of liver fibrosis observed by HE and Masson stainings;their levels of serum total bile acid(TBA),alkaline phosphatase(AKP),γ-glutamyltransferase(γ-GT),alanine aminotransferase(ALT),aspartate aminotransferase(AST)and total bilirubin(TBil)measured by the kit;their hepatic percentage of TGF-β1,p-Smad2 and p-Smad3 positive cells detected by immunofluorescence and immunohistochemical staining;their.hepatic expressions of TGF-β1,Smad4,NF-κB p65,Collagen Ⅰ and Collagen Ⅲ protein and mRNA detected by Western blot and RT-qPCR;their levels of helper T cell 1(Th1)and helper T cell 2(Th2)in peripheral blood detected by flow cytometry,and their ratio of Th1/Th2 calculated as well.RESULTS Compared with the model group,the groups intervened with either ursodeoxycholic acid or Dahuang Lingxian Recipe displayed well-ordered liver cells,hepatic lobules and hepatic cords;a small amount of fatty degeneration;significantly reduced connective hyperplasia of hepatic fibers;significantly narrowed fibrous cords;a small amount of blue fibrous septa;greatly improved pathological injuries including inflammatory infiltration of central vein and portal area;decreased levels of serum TBA,TBil,AKP,γ-GT,ALT and AST(P＜0.05);decreased hepatic expressions of TGF-β1,p-Smad2 and p-Smad3(P＜0.05);decreased hepatic expressions of TGF-β1,Smad4,NF-κB p65,Collagen Ⅰ and Collagen Ⅲ protein and mRNA(P＜0.05);and increased counts of Th1 cells in peripheral blood,decreased counts of Th2 cells,resultsing increased Th1/Th2 ratio(P＜0.05).And an even better effect was observed in the Dahuang Lingxian Recipe group.CONCLUSION Dahuang Lingxian Recipe can reduce or reverse CLF by inhibiting hepatic stellate cell activation through maintaining Th1/Th2 cell immune balance via the NF-κB/TGF-β1 signaling pathway.

Objective:To investigate the relationship between macrophage activation related factors and clini-cal symptoms of schizophrenia(SCZ).Methods:Outpatient or inpatient SCZ patients(n=166)and normal con-trols(n=71)meeting the diagnostic criteria of DSM 4th edition were selected as subjects.The psychopathological symptoms were assessed by the Positive and Negative Syndrome Scale(PANSS),and the concentrations of α-Na-Galases,MAF and IL-18 were determined by enzyme-linked immunosorbent assay(ELISA).The correlation be-tween biological indicators and clinical symptoms was analyzed and the mediation effect was tested.Results:The concentrations of α-NaGalases(P＜0.001)and MAF(P＜0.01)in SCZ group were lower than those in normal control group.In SCZ group,IL-18 was negatively correlated with α-NaGalases concentration(r=-0.24,P＜0.01).α-NaGalases was positively correlated with MAF concentration(r=0.67,P＜0.001),and the total score of PANSS positive symptom scale was positively correlated with IL-18(r=0.21,P＜0.05)and MAF concentration(r=0.22,P＜0.01).The mediating effect of α-NaGalases and MAF was statistically significant,and the relative mediating effect accounted for 25.47％.Conclusion:The increase of IL-18 level may indicate the occurrence of positive symptoms of schizophrenia,and α-NaGalases and MAF may negatively regulate the inflammatory damage effect of IL-18 on SCZ,thereby reducing the positive symptoms.

To formulate an expert consensus on the principles of preoperative hair removal and provide scientific guidance for standardized removal of hair before surgical procedures so as to reduce the incidence of surgical site infections.METHODS Led by the Hospital Management Institute of National Health Commission of the People's Republic of China,this consensus was reached with the joint efforts from the expects of relevant fields such as surgeries,interventional therapies,nursing,and infection prevention and control.The consensus facilitates the classification and evaluation of literatures by following the evidence grade formulated by Oxford Evidence-based Medicine Center and focuses on the association of preoperative hair removal with surgical site infection,it reaches the evidence grade of expert consensus and recommendation intensity by integrating with discussions on meetings and clinical experience of the expects from relevant fields.RESULTS A total of 6 items of consensus were reached by summarizing the latest evidence on the aspects including the indications for preoperative hair removal,tools,range,timing and places.CONCLUSION The consensus,to some extent,make supplements to and complete the exiting regulations and standards.It provides guidance for the medical institutions to carry out the preoperative hair removal.

With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.

Objective:To investigate the relationship between macrophage activation related factors and clini-cal symptoms of schizophrenia(SCZ).Methods:Outpatient or inpatient SCZ patients(n=166)and normal con-trols(n=71)meeting the diagnostic criteria of DSM 4th edition were selected as subjects.The psychopathological symptoms were assessed by the Positive and Negative Syndrome Scale(PANSS),and the concentrations of α-Na-Galases,MAF and IL-18 were determined by enzyme-linked immunosorbent assay(ELISA).The correlation be-tween biological indicators and clinical symptoms was analyzed and the mediation effect was tested.Results:The concentrations of α-NaGalases(P＜0.001)and MAF(P＜0.01)in SCZ group were lower than those in normal control group.In SCZ group,IL-18 was negatively correlated with α-NaGalases concentration(r=-0.24,P＜0.01).α-NaGalases was positively correlated with MAF concentration(r=0.67,P＜0.001),and the total score of PANSS positive symptom scale was positively correlated with IL-18(r=0.21,P＜0.05)and MAF concentration(r=0.22,P＜0.01).The mediating effect of α-NaGalases and MAF was statistically significant,and the relative mediating effect accounted for 25.47％.Conclusion:The increase of IL-18 level may indicate the occurrence of positive symptoms of schizophrenia,and α-NaGalases and MAF may negatively regulate the inflammatory damage effect of IL-18 on SCZ,thereby reducing the positive symptoms.