AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.

It is very limited that the benefit of perioperative chemotherapy in early non-small cell lung cancer (NSCLC), and the 5-year survival rate is only 5% higher than surgery. Antibodies that block programmed cell death protein 1/programmed death-ligand 1 significantly improve the survival of advanced NSCLC. The value of immunotherapy in early NSCLC is also being explored. This paper firstly summarized and analyzed the progress of immunotherapy in the perioperative period of NSCLC. Secondly, the safety and feasibility of surgical resection after neoadjuvant immunotherapy were discussed. Finally, the clinical value of different therapeutic efficacy prediction indicators was summarized, in order to clarify the current status of immunotherapy in the perioperative period, so as to improve the clinical benefits of early NSCLC patients.

With the continuous deepening of the concept of precision diagnosis and treatment for lung cancer, how to achieve higher efficiency and accuracy in the screening, diagnosis, and treatment pathways in clinical practice has become an important issue that urgently needs to be overcome. The current clinical difficulty lies in the fact that despite continuous advancements in imaging and molecular diagnostic technologies, there are still limitations in manual efficiency and subjective experience when it comes to massive data analysis and multi-scale feature extraction. Artificial intelligence (AI), especially algorithm systems based on deep learning, is an innovative technology capable of deeply empowering medical big data. This method utilizes algorithms such as convolutional neural networks, combined with radiomics, pathomics, and multi-modal data fusion analysis, demonstrating immense potential in early precise detection and benign-malignant differentiation of pulmonary nodules, digital pathological subtype recognition and non-invasive prediction of driver genes, precise 3D surgical planning and automatic delineation of radiotherapy target volumes, as well as dynamic risk warning during follow-up. This innovative technology provides a brand-new solution for realizing intelligent and individualized lung cancer diagnosis and treatment models. This consensus, based on the latest evidence from evidence-based medicine and combined with the development trends in the AI field and real-world clinical needs, was ultimately formed by gathering the consensus opinions of multidisciplinary experts in radiology, pathology, thoracic surgery, and other fields. The main content covers the application specifications of AI in the three core scenarios of lung cancer screening, diagnosis, and treatment, the technical standards for data collection and algorithm validation, as well as the ethical and regulatory challenges faced at the current stage. It aims to clarify the applicable boundaries of AI as a clinical auxiliary decision support tool, providing scientific guidance and standardized exploration directions for peers currently engaged in or planning to carry out AI-assisted clinical diagnosis, treatment, and translation of lung cancer.

Objective To analyze the application of NCompass nitinol stone retrieval basket in ureteroscopic holmium laser lithotripsy, and to evaluate its roles in reducing stone retropulsion and improving stone-free rate(SFR)and stone acquisition rate.Methods A retrospective analysis was conducted on the data of patients with upper ureteral stones＞1 cm who underwent ureteroscopic holmium laser lithotripsy at China-Japan Friendship Hospital during Jan.2018 and Dec.2023, including 96 cases were in the NCompass group, and 68 cases in the non-basket group.The operation time, stone retropulsion rate, usage rate of flexible ureteroscopy, SFR and stone acquisition rate were compared between the two groups.Results There were no significant differences in the operation time [(29.2±8.4)min vs.(30.9±7.2)min, P=0.170] and stone retropulsion rate(15.6% vs. 27.9%, P=0.055)between the NCompass group and non-basket group.The NCompass group had significantly lower usage rate of flexible ureteroscopy than the non-basket group(24.0% vs. 47.1%, P=0.002), higher SFR 2 days(80.2% vs. 45.6%, P＜0.001)and 1 month(93.8% vs. 83.8%, P=0.040)after operation, as well as the stone acquisition rates 2 days(100% vs. 44.1%, P＜0.001)and 1 month(100% vs. 58.8%, P＜0.001)after operation. Conclusion The NCompass nitinol stone retrieval basket plays dual roles in ureteroscopic holmium laser lithotripsy, which can effectively intercept stones and extract stone fragments, thus significantly improving the SFR and stone acquisition rate, and reducing stone retropulsion and the use of flexible ureteroscopy.

BACKGROUND: Atrial fibrillation (AF) is a common cardiac arrhythmia in the elderly. This study aimed to evaluate urban-rural disparities in its prevalence and management in elderly Chinese. METHODS: Consecutive participants aged ≥ 65 years attending outpatient clinics were enrolled for AF screening using handheld single-lead electrocardiogram (ECG) from April 2017 to December 2022. Each ECG rhythm strip was reviewed from the research team. AF or uninterpretable single-lead ECGs were referred for 12-lead ECG. Primary study outcome comparison was between rural and urban areas for the prevalence of AF. The Student's t-test was used to compare mean values of clinical characteristics between rural and urban participants, while the Pearson's chi-square test was used to compare between-group proportions. Multivariate stepwise logistic regression analysis was performed to estimate the association between AF and various patient characteristics. RESULTS: The 29,166 study participants included 13,253 men (45.4%) and had a mean age of 72.2 years. The 7073 rural participants differed significantly (P ≤ 0.02) from the 22,093 urban participants in several major characteristics, such as older age, greater body mass index, and so on. The overall prevalence of AF was 4.6% (n = 1347). AF was more prevalent in 7073 rural participants than 22,093 urban participants (5.6% vs. 4.3%, P < 0.01), before and after adjustment for age, body mass index, blood pressure, pulse rate, cigarette smoking, alcohol consumption and prior medical history. Multivariate logistic regression analysis identified overweight/obesity (OR = 1.35, 95% CI: 1.17-1.54) in urban areas and cigarette smoking (OR = 1.62, 95% CI: 1.20-2.17) and alcohol consumption (OR = 1.42, 95% CI: 1.04-1.93) in rural areas as specific risk factors for prevalent AF. In patients with known AF in urban areas (n = 781) and rural areas (n = 338), 60.6% and 45.9%, respectively, received AF treatment (P < 0.01), and only 22.4% and 17.2%, respectively, received anticoagulation therapy (P = 0.05). CONCLUSIONS In China, there are urban-rural disparities in AF in the elderly, with a higher prevalence and worse management in rural areas than urban areas. Our study findings provide insight for health policymakers to consider urban-rural disparity in the prevention and treatment of AF.

In protein engineering, while computational models are increasingly used to predict mutation effects, their evaluations primarily rely on high-throughput deep mutational scanning (DMS) experiments that use surrogate readouts, which may not adequately capture the complex biochemical properties of interest. Many proteins and their functions cannot be assessed through high-throughput methods due to technical limitations or the nature of the desired properties, and this is particularly true for the real industrial application scenario. Therefore, the desired testing datasets, will be small-size (∼10-100) experimental data for each protein, and involve as many proteins as possible and as many properties as possible, which is, however, lacking. Here, we present VenusMutHub, a comprehensive benchmark study using 905 small-scale experimental datasets curated from published literature and public databases, spanning 527 proteins across diverse functional properties including stability, activity, binding affinity, and selectivity. These datasets feature direct biochemical measurements rather than surrogate readouts, providing a more rigorous assessment of model performance in predicting mutations that affect specific molecular functions. We evaluate 23 computational models across various methodological paradigms, such as sequence-based, structure-informed and evolutionary approaches. This benchmark provides practical guidance for selecting appropriate prediction methods in protein engineering applications where accurate prediction of specific functional properties is crucial.

AIM To explore the effects of Dahuang Lingxian Recipe on Th1/Th2 cell immune imbalance in a rat model of cholestatic liver fibrosis(CLF).METHODS 20 SD rats were randomly divided into the normal group,the model group,the ursodeoxycholic acid group(0.063 g/kg)and the Dahuang Lingxian Recipe group(4.8 g/kg),with 5 rats in each group.Except for those of the normal group,the rats of all other groups had open surgery of common bile duct ligation,followed by the gavage of corresponding drug two days later,and the procurement of the samples after gavage in the third week.The rats had their degree of liver fibrosis observed by HE and Masson stainings;their levels of serum total bile acid(TBA),alkaline phosphatase(AKP),γ-glutamyltransferase(γ-GT),alanine aminotransferase(ALT),aspartate aminotransferase(AST)and total bilirubin(TBil)measured by the kit;their hepatic percentage of TGF-β1,p-Smad2 and p-Smad3 positive cells detected by immunofluorescence and immunohistochemical staining;their.hepatic expressions of TGF-β1,Smad4,NF-κB p65,Collagen Ⅰ and Collagen Ⅲ protein and mRNA detected by Western blot and RT-qPCR;their levels of helper T cell 1(Th1)and helper T cell 2(Th2)in peripheral blood detected by flow cytometry,and their ratio of Th1/Th2 calculated as well.RESULTS Compared with the model group,the groups intervened with either ursodeoxycholic acid or Dahuang Lingxian Recipe displayed well-ordered liver cells,hepatic lobules and hepatic cords;a small amount of fatty degeneration;significantly reduced connective hyperplasia of hepatic fibers;significantly narrowed fibrous cords;a small amount of blue fibrous septa;greatly improved pathological injuries including inflammatory infiltration of central vein and portal area;decreased levels of serum TBA,TBil,AKP,γ-GT,ALT and AST(P＜0.05);decreased hepatic expressions of TGF-β1,p-Smad2 and p-Smad3(P＜0.05);decreased hepatic expressions of TGF-β1,Smad4,NF-κB p65,Collagen Ⅰ and Collagen Ⅲ protein and mRNA(P＜0.05);and increased counts of Th1 cells in peripheral blood,decreased counts of Th2 cells,resultsing increased Th1/Th2 ratio(P＜0.05).And an even better effect was observed in the Dahuang Lingxian Recipe group.CONCLUSION Dahuang Lingxian Recipe can reduce or reverse CLF by inhibiting hepatic stellate cell activation through maintaining Th1/Th2 cell immune balance via the NF-κB/TGF-β1 signaling pathway.

Objective:To obtain a prevalent respiratory syncytial virus (RSV) clinical isolate in Beijing and analyze the genotype and biological characteristics of the strain.Methods:A nasopharyngeal secretion specimen was collected from a child with RSV infection in Beijing in 2023 and used for viral isolation. Viral nucleic acid was amplified using qRT-PCR. The isolated virus was identified by transmission electron microscopy, indirect immunofluorescence assay, and plaque formation assay. A phylogenetic analysis was conducted based on the whole-genome sequencing results. Virus titers were determined, and replication characteristics were analyzed. The efficacy of the isolated strain for in vitro screening of antiviral drugs was validated. Results:A clinical RSV isolate, named hRSV/C-Tan/BJ 202301, was successfully isolated, which could form syncytia in Hep-2 cells. Spherical, filamentous, and irregular virus particles were observed by electron microscopy. Immunofluorescence detection showed green fluorescence in Hep-2 cells, and plaque assay showed round plaques, which were similar to the Long strain in morphology. Genomic sequence analysis showed that it belonged to ON1 genotype. It exhibited similar cell growth kinetics characteristics with the Long strain and could be used for antiviral drug screening in vitro. Conclusions:In this study, one RSV strain is successfully isolated and identified. The biological characteristics and the phylogenetic relationship of this strain reflect the characteristics of the circulating strains in Beijing, which provides experimental material for RSV vaccine development and antiviral drug screening in China.

Objective: To explore the key factors affecting the selection and effectiveness of bladder management modalities in patients with spinal cord injury，so as to provide reference for the optimization of individualized bladder management strategies. Methods: The clinical and follow-up data of 78 patients with spinal cord injury treated in our hospital during Jan.1,2013 and Dec.31,2022 were retrospectively analyzed.The distribution of bladder management modalities among different grades of injuries was analyzed. Bowker symmetry test was used to evaluate the difference between bladder management modalities at discharge and at the end of follow-up. Multiple linear regression was used to explore the influencing factors of bladder management effects. Plotting Kaplan-Meier survival curves were adopted to calculate the median time of changes in bladder management. Results: At discharge，there were 9 cases of self-catheterization，19 cases of intermittent catheterization，22 cases of reflexive voiding，26 cases of long-term catheterization，and 2 cases using urinary collector.At the end of follow-up，there were 15 cases of self-catheterization，8 cases of intermittent catheterization，34 cases of reflexive voiding，14 cases of long-term catheterization，and 7 cases using urinary collector.There was a significant difference between the modalities of bladder management at discharge and at the end of follow-up (χ =21.43，P=0.018).Multiple linear regression showed a significant decrease of 8.60 in the total neurogenic bladder symptom score (NBSS) for grade D injuries compared with grade A injuries (P=0.026). The median time to bladder management change was 7.93 months (95%CI:5.44-9.44), with approximately 50% of patients experiencing a change in bladder management within 8 months after discharge. Conclusion: The modalities of bladder management changed significantly after discharge.The grade of injury was a key factor affecting the effectiveness of bladder management.Higher grade was associated with worse effectiveness of bladder management.