1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Chinese expert consensus on postoperative follow-up for non-small cell lung cancer (version 2025)
Lunxu LIU ; Shugeng GAO ; Jianxing HE ; Jian HU ; Di GE ; Hecheng LI ; Mingqiang KANG ; Fengwei TAN ; Fan YANG ; Qiang PU ; Kaican CAI
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(03):281-290
Surgical treatment is one of the key approaches for non-small cell lung cancer (NSCLC). Regular postoperative follow-up is crucial for early detection and timely management of tumor recurrence, metastasis, or second primary tumors. A scientifically sound and reasonable follow-up strategy not only extends patient survival but also significantly improves quality of life, thereby enhancing overall prognosis. This consensus aims to build upon the previous version by incorporating the latest clinical research advancements and refining postoperative follow-up protocols for early-stage NSCLC patients based on different treatment modalities. It provides a scientific and practical reference for clinicians involved in the postoperative follow-up management of NSCLC. By optimizing follow-up strategies, this consensus seeks to promote the standardization and normalization of lung cancer diagnosis and treatment in China, helping more patients receive high-quality care and long-term management. Additionally, the release of this consensus is expected to provide insights for related research and clinical practice both domestically and internationally, driving continuous development and innovation in the field of postoperative management for NSCLC.
3.Principles, technical specifications, and clinical application of lung watershed topography map 2.0: A thoracic surgery expert consensus (2024 version)
Wenzhao ZHONG ; Fan YANG ; Jian HU ; Fengwei TAN ; Xuening YANG ; Qiang PU ; Wei JIANG ; Deping ZHAO ; Hecheng LI ; Xiaolong YAN ; Lijie TAN ; Junqiang FAN ; Guibin QIAO ; Qiang NIE ; Mingqiang KANG ; Weibing WU ; Hao ZHANG ; Zhigang LI ; Zihao CHEN ; Shugeng GAO ; Yilong WU
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(02):141-152
With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.
4.Influencing factors of bladder management practices in patients with spinal cord injury
Zhirong LUO ; Xuyan GUO ; Qi XUE ; Xiao TAN ; Yunhua JI ; Fuxun ZHANG ; Yong JIAO ; Bo ZHANG
Journal of Modern Urology 2025;30(4):284-289
Objective: To explore the key factors affecting the selection and effectiveness of bladder management modalities in patients with spinal cord injury,so as to provide reference for the optimization of individualized bladder management strategies. Methods: The clinical and follow-up data of 78 patients with spinal cord injury treated in our hospital during Jan.1,2013 and Dec.31,2022 were retrospectively analyzed.The distribution of bladder management modalities among different grades of injuries was analyzed. Bowker symmetry test was used to evaluate the difference between bladder management modalities at discharge and at the end of follow-up. Multiple linear regression was used to explore the influencing factors of bladder management effects. Plotting Kaplan-Meier survival curves were adopted to calculate the median time of changes in bladder management. Results: At discharge,there were 9 cases of self-catheterization,19 cases of intermittent catheterization,22 cases of reflexive voiding,26 cases of long-term catheterization,and 2 cases using urinary collector.At the end of follow-up,there were 15 cases of self-catheterization,8 cases of intermittent catheterization,34 cases of reflexive voiding,14 cases of long-term catheterization,and 7 cases using urinary collector.There was a significant difference between the modalities of bladder management at discharge and at the end of follow-up (χ
=21.43,P=0.018).Multiple linear regression showed a significant decrease of 8.60 in the total neurogenic bladder symptom score (NBSS) for grade D injuries compared with grade A injuries (P=0.026). The median time to bladder management change was 7.93 months (95%CI:5.44-9.44), with approximately 50% of patients experiencing a change in bladder management within 8 months after discharge. Conclusion: The modalities of bladder management changed significantly after discharge.The grade of injury was a key factor affecting the effectiveness of bladder management.Higher grade was associated with worse effectiveness of bladder management.
5.Analysis of the causal relationship between gut microbiota and bladder cancer with Mendelian randomization
Xuyan GUO ; Zhirong LUO ; Qi XUE ; Yunhua JI ; Xiao TAN ; Yong JIAO
Journal of Modern Urology 2025;30(5):400-407
Objective: Previous observational studies have confirmed the correlation between gut microbiota and bladder cancer,but the causal relationship is still unclear.This study aimed to explore the causal relationship between them with Mendelian randomization. Methods: Genetic variation summary data of 211 gut microbiota and bladder cancer genome-wide association studies (GWAS) were obtained from the MiBioGen Consortium and Finngen database.Single nucleotide polymorphisms (SNPs) closely related to these studies were screened as instrumental variables.The causal relationship between gut microbiota and bladder cancer were analyzed with inverse variance weighting (IVW),MR-Egger,weighted median,maximum likelihood,robust adjustment feature score and MR-PRESSO,with IVW as the primary analysis method.Additionally,sensitivity analysis was used to test the heterogeneity (Cochran Q) and horizontal pleiotropy (MR-Egger intercept term and global test from MR-PRESSO estimator) to ensure the robustness of the results. Results: The IVW results indicated that Lachnospiraceae UCG004 (OR:1.42),Desulfovibrionales (Order) (OR:1.48),Eubacterium ruminantium group (OR:1.33),Olsenella (OR:1.24),Ruminococcaceae UCG002 (OR:1.39),Ruminococcaceae UCG005 (OR:1.42) and Ruminococcaceae UCG013 (OR:1.64) significantly increased the risk of bladder cancer.Conversely,Bacteroidetes (Phylum) (OR:0.61),Eubacterium brachy group (OR:0.80),Ruminococcaceae UCG004 (OR:0.73),Rikenellaceae (Family) (OR:0.67),Lachnospiraceae ND3007 group (OR:0.47), Adlercreutzia (OR:0.73) and an unknow genus (OR:0.75) were associated with a reduced risk of bladder cancer.Sensitivity analyses did not reveal any heterogeneity or horizontal pleiotropy. Conclusion: This study reveals the causal role of 14 gut microbiota in the pathogenesis of bladder cancer,among which Lachnospiraceae UCG004,Desulfovibrionales (Order),Eubacterium ruminantium group,Olsenella,Ruminococcaceae UCG002,Ruminococcaceae UCG005 and Ruminococcaceae UCG013 are risk factors for bladder cancer,while Bacteroidetes (Phylum),Eubacterium brachy group,Ruminococcaceae UCG004,Rikenellaceae (Family),Lachnospiraceae ND3007 group,Adlercreutzia and an unknown genus are the protective factors.
7.Safety of teriflunomide in Chinese adult patients with relapsing multiple sclerosis: A phase IV, 24-week multicenter study.
Chao QUAN ; Hongyu ZHOU ; Huan YANG ; Zheng JIAO ; Meini ZHANG ; Baorong ZHANG ; Guojun TAN ; Bitao BU ; Tao JIN ; Chunyang LI ; Qun XUE ; Huiqing DONG ; Fudong SHI ; Xinyue QIN ; Xinghu ZHANG ; Feng GAO ; Hua ZHANG ; Jiawei WANG ; Xueqiang HU ; Yueting CHEN ; Jue LIU ; Wei QIU
Chinese Medical Journal 2025;138(4):452-458
BACKGROUND:
Disease-modifying therapies have been approved for the treatment of relapsing multiple sclerosis (RMS). The present study aims to examine the safety of teriflunomide in Chinese patients with RMS.
METHODS:
This non-randomized, multi-center, 24-week, prospective study enrolled RMS patients with variant (c.421C>A) or wild type ABCG2 who received once-daily oral teriflunomide 14 mg. The primary endpoint was the relationship between ABCG2 polymorphisms and teriflunomide exposure over 24 weeks. Safety was assessed over the 24-week treatment with teriflunomide.
RESULTS:
Eighty-two patients were assigned to variant ( n = 42) and wild type groups ( n = 40), respectively. Geometric mean and geometric standard deviation (SD) of pre-dose concentration (variant, 54.9 [38.0] μg/mL; wild type, 49.1 [32.0] μg/mL) and area under plasma concentration-time curve over a dosing interval (AUC tau ) (variant, 1731.3 [769.0] μg∙h/mL; wild type, 1564.5 [1053.0] μg∙h/mL) values at steady state were approximately similar between the two groups. Safety profile was similar and well tolerated across variant and wild type groups in terms of rates of treatment emergent adverse events (TEAE), treatment-related TEAE, grade ≥3 TEAE, and serious adverse events (AEs). No new specific safety concerns or deaths were reported in the study.
CONCLUSION:
ABCG2 polymorphisms did not affect the steady-state exposure of teriflunomide, suggesting a similar efficacy and safety profile between variant and wild type RMS patients.
REGISTRATION
NCT04410965, https://clinicaltrials.gov .
Humans
;
Crotonates/adverse effects*
;
Toluidines/adverse effects*
;
Nitriles
;
Hydroxybutyrates
;
Female
;
Male
;
Adult
;
ATP Binding Cassette Transporter, Subfamily G, Member 2/genetics*
;
Middle Aged
;
Multiple Sclerosis, Relapsing-Remitting/genetics*
;
Prospective Studies
;
Young Adult
;
Neoplasm Proteins/genetics*
;
East Asian People
9.Novel CD19 Fast-CAR-T cells vs. CD19 conventional CAR-T cells for the treatment of relapsed/refractory CD19-positive B-cell acute lymphoblastic leukemia.
Xu TAN ; Jishi WANG ; Shangjun CHEN ; Li LIU ; Yuhua LI ; Sanfang TU ; Hai YI ; Jian ZHOU ; Sanbin WANG ; Ligen LIU ; Jian GE ; Yongxian HU ; Xiaoqi WANG ; Lu WANG ; Guo CHEN ; Han YAO ; Cheng ZHANG ; Xi ZHANG
Chinese Medical Journal 2025;138(19):2491-2497
BACKGROUND:
Treatment with chimeric antigen receptor-T (CAR-T) cells has shown promising effectiveness in patients with relapsed/refractory B-cell acute lymphoblastic leukemia (R/R B-ALL), although the process of preparing for this therapy usually takes a long time. We have recently created CD19 Fast-CAR-T (F-CAR-T) cells, which can be produced within a single day. The objective of this study was to evaluate and contrast the effectiveness and safety of CD19 F-CAR-T cells with those of CD19 conventional CAR-T cells in the management of R/R B-ALL.
METHODS:
A multicenter, retrospective analysis of the clinical data of 44 patients with R/R B-ALL was conducted. Overall, 23 patients were administered with innovative CD19 F-CAR-T cells (F-CAR-T group), whereas 21 patients were given CD19 conventional CAR-T cells (C-CAR-T group). We compared the rates of complete remission (CR), minimal residual disease (MRD)-negative CR, leukemia-free survival (LFS), overall survival (OS), and the incidence of cytokine release syndrome (CRS) and immune effector cell-associated neurotoxicity syndrome (ICANS) between the two groups.
RESULTS:
Compared with the C-CAR-T group, the F-CAR-T group had significantly higher CR and MRD-negative rates (95.7% and 91.3%, respectively; 71.4% and 66.7%, respectively; P = 0.036 and P = 0.044). No significant differences were observed in the 1-year or 2-year LFS or OS rates between the two groups: the 1-year and 2-year LFS for the F-CAR-T group vs.C-CAR-T group were 47.8% and 43.5% vs. 38.1% and 23.8% (P = 0.384 and P = 0.216), while the 1-year and 2-year OS rates were 65.2% and 56.5% vs. 52.4% and 47.6% (P = 0.395 and P = 0.540). Additionally, among CR patients who underwent allogeneic hematopoietic stem cell transplantation (allo-HSCT) following CAR-T-cell therapy, there were no significant differences in the 1-year or 2-year LFS or OS rates: 57.1% and 50.0% vs. 47.8% and 34.8% (P = 0.506 and P = 0.356), 64.3% and 57.1% vs. 65.2% and 56.5% (P = 0.985 and P = 0.883), respectively. The incidence of CRS was greater in the F-CAR-T group (91.3%) than in the C-CAR-T group (66.7%) (P = 0.044). The incidence of ICANS was also greater in the F-CAR-T group (30.4%) than in the C-CAR-T group (9.5%) (P = 0.085), but no treatment-related deaths occurred in the two groups.
CONCLUSION
Compared with C-CAR-T-cell therapy, F-CAR-T-cell therapy has a superior remission rate but also leads to a tolerably increased incidence of CRS/ICANS. Further research is needed to explore the function of allo-HSCT as an intermediary therapy after CAR-T-cell therapy.
10.Exploring urban versus rural disparities in atrial fibrillation: prevalence and management trends among elderly Chinese in a screening study.
Wei ZHANG ; Yi CHEN ; Lei-Xiao HU ; Jia-Hui XIA ; Xiao-Fei YE ; Wen-Yuan-Yue WANG ; Xin-Yu WANG ; Quan-Yong XIANG ; Qin TAN ; Xiao-Long WANG ; Xiao-Min YANG ; De-Chao ZHAO ; Xin CHEN ; Yan LI ; Ji-Guang WANG ; FOR THE IMPRESSION INVESTIGATORS AND COORDINATORS
Journal of Geriatric Cardiology 2025;22(2):246-254
BACKGROUND:
Atrial fibrillation (AF) is a common cardiac arrhythmia in the elderly. This study aimed to evaluate urban-rural disparities in its prevalence and management in elderly Chinese.
METHODS:
Consecutive participants aged ≥ 65 years attending outpatient clinics were enrolled for AF screening using handheld single-lead electrocardiogram (ECG) from April 2017 to December 2022. Each ECG rhythm strip was reviewed from the research team. AF or uninterpretable single-lead ECGs were referred for 12-lead ECG. Primary study outcome comparison was between rural and urban areas for the prevalence of AF. The Student's t-test was used to compare mean values of clinical characteristics between rural and urban participants, while the Pearson's chi-square test was used to compare between-group proportions. Multivariate stepwise logistic regression analysis was performed to estimate the association between AF and various patient characteristics.
RESULTS:
The 29,166 study participants included 13,253 men (45.4%) and had a mean age of 72.2 years. The 7073 rural participants differed significantly (P ≤ 0.02) from the 22,093 urban participants in several major characteristics, such as older age, greater body mass index, and so on. The overall prevalence of AF was 4.6% (n = 1347). AF was more prevalent in 7073 rural participants than 22,093 urban participants (5.6% vs. 4.3%, P < 0.01), before and after adjustment for age, body mass index, blood pressure, pulse rate, cigarette smoking, alcohol consumption and prior medical history. Multivariate logistic regression analysis identified overweight/obesity (OR = 1.35, 95% CI: 1.17-1.54) in urban areas and cigarette smoking (OR = 1.62, 95% CI: 1.20-2.17) and alcohol consumption (OR = 1.42, 95% CI: 1.04-1.93) in rural areas as specific risk factors for prevalent AF. In patients with known AF in urban areas (n = 781) and rural areas (n = 338), 60.6% and 45.9%, respectively, received AF treatment (P < 0.01), and only 22.4% and 17.2%, respectively, received anticoagulation therapy (P = 0.05).
CONCLUSIONS
In China, there are urban-rural disparities in AF in the elderly, with a higher prevalence and worse management in rural areas than urban areas. Our study findings provide insight for health policymakers to consider urban-rural disparity in the prevention and treatment of AF.

Result Analysis
Print
Save
E-mail