AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.

It is very limited that the benefit of perioperative chemotherapy in early non-small cell lung cancer (NSCLC), and the 5-year survival rate is only 5% higher than surgery. Antibodies that block programmed cell death protein 1/programmed death-ligand 1 significantly improve the survival of advanced NSCLC. The value of immunotherapy in early NSCLC is also being explored. This paper firstly summarized and analyzed the progress of immunotherapy in the perioperative period of NSCLC. Secondly, the safety and feasibility of surgical resection after neoadjuvant immunotherapy were discussed. Finally, the clinical value of different therapeutic efficacy prediction indicators was summarized, in order to clarify the current status of immunotherapy in the perioperative period, so as to improve the clinical benefits of early NSCLC patients.

With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.

Surgical treatment is one of the key approaches for non-small cell lung cancer (NSCLC). Regular postoperative follow-up is crucial for early detection and timely management of tumor recurrence, metastasis, or second primary tumors. A scientifically sound and reasonable follow-up strategy not only extends patient survival but also significantly improves quality of life, thereby enhancing overall prognosis. This consensus aims to build upon the previous version by incorporating the latest clinical research advancements and refining postoperative follow-up protocols for early-stage NSCLC patients based on different treatment modalities. It provides a scientific and practical reference for clinicians involved in the postoperative follow-up management of NSCLC. By optimizing follow-up strategies, this consensus seeks to promote the standardization and normalization of lung cancer diagnosis and treatment in China, helping more patients receive high-quality care and long-term management. Additionally, the release of this consensus is expected to provide insights for related research and clinical practice both domestically and internationally, driving continuous development and innovation in the field of postoperative management for NSCLC.

Objective: To explore the key factors affecting the selection and effectiveness of bladder management modalities in patients with spinal cord injury，so as to provide reference for the optimization of individualized bladder management strategies. Methods: The clinical and follow-up data of 78 patients with spinal cord injury treated in our hospital during Jan.1,2013 and Dec.31,2022 were retrospectively analyzed.The distribution of bladder management modalities among different grades of injuries was analyzed. Bowker symmetry test was used to evaluate the difference between bladder management modalities at discharge and at the end of follow-up. Multiple linear regression was used to explore the influencing factors of bladder management effects. Plotting Kaplan-Meier survival curves were adopted to calculate the median time of changes in bladder management. Results: At discharge，there were 9 cases of self-catheterization，19 cases of intermittent catheterization，22 cases of reflexive voiding，26 cases of long-term catheterization，and 2 cases using urinary collector.At the end of follow-up，there were 15 cases of self-catheterization，8 cases of intermittent catheterization，34 cases of reflexive voiding，14 cases of long-term catheterization，and 7 cases using urinary collector.There was a significant difference between the modalities of bladder management at discharge and at the end of follow-up (χ =21.43，P=0.018).Multiple linear regression showed a significant decrease of 8.60 in the total neurogenic bladder symptom score (NBSS) for grade D injuries compared with grade A injuries (P=0.026). The median time to bladder management change was 7.93 months (95%CI:5.44-9.44), with approximately 50% of patients experiencing a change in bladder management within 8 months after discharge. Conclusion: The modalities of bladder management changed significantly after discharge.The grade of injury was a key factor affecting the effectiveness of bladder management.Higher grade was associated with worse effectiveness of bladder management.

Objective: Previous observational studies have confirmed the correlation between gut microbiota and bladder cancer，but the causal relationship is still unclear.This study aimed to explore the causal relationship between them with Mendelian randomization. Methods: Genetic variation summary data of 211 gut microbiota and bladder cancer genome-wide association studies (GWAS) were obtained from the MiBioGen Consortium and Finngen database.Single nucleotide polymorphisms (SNPs) closely related to these studies were screened as instrumental variables.The causal relationship between gut microbiota and bladder cancer were analyzed with inverse variance weighting (IVW)，MR-Egger，weighted median，maximum likelihood，robust adjustment feature score and MR-PRESSO，with IVW as the primary analysis method.Additionally，sensitivity analysis was used to test the heterogeneity (Cochran Q) and horizontal pleiotropy (MR-Egger intercept term and global test from MR-PRESSO estimator) to ensure the robustness of the results. Results: The IVW results indicated that Lachnospiraceae UCG004 (OR：1.42)，Desulfovibrionales (Order) (OR：1.48)，Eubacterium ruminantium group (OR：1.33)，Olsenella (OR：1.24)，Ruminococcaceae UCG002 (OR：1.39)，Ruminococcaceae UCG005 (OR：1.42) and Ruminococcaceae UCG013 (OR：1.64) significantly increased the risk of bladder cancer.Conversely，Bacteroidetes (Phylum) (OR：0.61)，Eubacterium brachy group (OR：0.80)，Ruminococcaceae UCG004 (OR：0.73)，Rikenellaceae (Family) (OR：0.67)，Lachnospiraceae ND3007 group (OR：0.47), Adlercreutzia (OR：0.73) and an unknow genus (OR：0.75) were associated with a reduced risk of bladder cancer.Sensitivity analyses did not reveal any heterogeneity or horizontal pleiotropy. Conclusion: This study reveals the causal role of 14 gut microbiota in the pathogenesis of bladder cancer，among which Lachnospiraceae UCG004，Desulfovibrionales (Order)，Eubacterium ruminantium group，Olsenella，Ruminococcaceae UCG002，Ruminococcaceae UCG005 and Ruminococcaceae UCG013 are risk factors for bladder cancer，while Bacteroidetes (Phylum)，Eubacterium brachy group，Ruminococcaceae UCG004，Rikenellaceae (Family)，Lachnospiraceae ND3007 group，Adlercreutzia and an unknown genus are the protective factors.

BACKGROUND: Disease-modifying therapies have been approved for the treatment of relapsing multiple sclerosis (RMS). The present study aims to examine the safety of teriflunomide in Chinese patients with RMS. METHODS: This non-randomized, multi-center, 24-week, prospective study enrolled RMS patients with variant (c.421C>A) or wild type ABCG2 who received once-daily oral teriflunomide 14 mg. The primary endpoint was the relationship between ABCG2 polymorphisms and teriflunomide exposure over 24 weeks. Safety was assessed over the 24-week treatment with teriflunomide. RESULTS: Eighty-two patients were assigned to variant ( n  = 42) and wild type groups ( n  = 40), respectively. Geometric mean and geometric standard deviation (SD) of pre-dose concentration (variant, 54.9 [38.0] μg/mL; wild type, 49.1 [32.0] μg/mL) and area under plasma concentration-time curve over a dosing interval (AUC tau ) (variant, 1731.3 [769.0] μg∙h/mL; wild type, 1564.5 [1053.0] μg∙h/mL) values at steady state were approximately similar between the two groups. Safety profile was similar and well tolerated across variant and wild type groups in terms of rates of treatment emergent adverse events (TEAE), treatment-related TEAE, grade ≥3 TEAE, and serious adverse events (AEs). No new specific safety concerns or deaths were reported in the study. CONCLUSION: ABCG2 polymorphisms did not affect the steady-state exposure of teriflunomide, suggesting a similar efficacy and safety profile between variant and wild type RMS patients. REGISTRATION NCT04410965, https://clinicaltrials.gov .
Humans ; Crotonates/adverse effects* ; Toluidines/adverse effects* ; Nitriles ; Hydroxybutyrates ; Female ; Male ; Adult ; ATP Binding Cassette Transporter, Subfamily G, Member 2/genetics* ; Middle Aged ; Multiple Sclerosis, Relapsing-Remitting/genetics* ; Prospective Studies ; Young Adult ; Neoplasm Proteins/genetics* ; East Asian People