AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.

It is very limited that the benefit of perioperative chemotherapy in early non-small cell lung cancer (NSCLC), and the 5-year survival rate is only 5% higher than surgery. Antibodies that block programmed cell death protein 1/programmed death-ligand 1 significantly improve the survival of advanced NSCLC. The value of immunotherapy in early NSCLC is also being explored. This paper firstly summarized and analyzed the progress of immunotherapy in the perioperative period of NSCLC. Secondly, the safety and feasibility of surgical resection after neoadjuvant immunotherapy were discussed. Finally, the clinical value of different therapeutic efficacy prediction indicators was summarized, in order to clarify the current status of immunotherapy in the perioperative period, so as to improve the clinical benefits of early NSCLC patients.

With the continuous deepening of the concept of precision diagnosis and treatment for lung cancer, how to achieve higher efficiency and accuracy in the screening, diagnosis, and treatment pathways in clinical practice has become an important issue that urgently needs to be overcome. The current clinical difficulty lies in the fact that despite continuous advancements in imaging and molecular diagnostic technologies, there are still limitations in manual efficiency and subjective experience when it comes to massive data analysis and multi-scale feature extraction. Artificial intelligence (AI), especially algorithm systems based on deep learning, is an innovative technology capable of deeply empowering medical big data. This method utilizes algorithms such as convolutional neural networks, combined with radiomics, pathomics, and multi-modal data fusion analysis, demonstrating immense potential in early precise detection and benign-malignant differentiation of pulmonary nodules, digital pathological subtype recognition and non-invasive prediction of driver genes, precise 3D surgical planning and automatic delineation of radiotherapy target volumes, as well as dynamic risk warning during follow-up. This innovative technology provides a brand-new solution for realizing intelligent and individualized lung cancer diagnosis and treatment models. This consensus, based on the latest evidence from evidence-based medicine and combined with the development trends in the AI field and real-world clinical needs, was ultimately formed by gathering the consensus opinions of multidisciplinary experts in radiology, pathology, thoracic surgery, and other fields. The main content covers the application specifications of AI in the three core scenarios of lung cancer screening, diagnosis, and treatment, the technical standards for data collection and algorithm validation, as well as the ethical and regulatory challenges faced at the current stage. It aims to clarify the applicable boundaries of AI as a clinical auxiliary decision support tool, providing scientific guidance and standardized exploration directions for peers currently engaged in or planning to carry out AI-assisted clinical diagnosis, treatment, and translation of lung cancer.

Objective To analyze the application of NCompass nitinol stone retrieval basket in ureteroscopic holmium laser lithotripsy, and to evaluate its roles in reducing stone retropulsion and improving stone-free rate(SFR)and stone acquisition rate.Methods A retrospective analysis was conducted on the data of patients with upper ureteral stones＞1 cm who underwent ureteroscopic holmium laser lithotripsy at China-Japan Friendship Hospital during Jan.2018 and Dec.2023, including 96 cases were in the NCompass group, and 68 cases in the non-basket group.The operation time, stone retropulsion rate, usage rate of flexible ureteroscopy, SFR and stone acquisition rate were compared between the two groups.Results There were no significant differences in the operation time [(29.2±8.4)min vs.(30.9±7.2)min, P=0.170] and stone retropulsion rate(15.6% vs. 27.9%, P=0.055)between the NCompass group and non-basket group.The NCompass group had significantly lower usage rate of flexible ureteroscopy than the non-basket group(24.0% vs. 47.1%, P=0.002), higher SFR 2 days(80.2% vs. 45.6%, P＜0.001)and 1 month(93.8% vs. 83.8%, P=0.040)after operation, as well as the stone acquisition rates 2 days(100% vs. 44.1%, P＜0.001)and 1 month(100% vs. 58.8%, P＜0.001)after operation. Conclusion The NCompass nitinol stone retrieval basket plays dual roles in ureteroscopic holmium laser lithotripsy, which can effectively intercept stones and extract stone fragments, thus significantly improving the SFR and stone acquisition rate, and reducing stone retropulsion and the use of flexible ureteroscopy.

Objective Jejunal interposition is an important option for restoring gastrointestinal continuity in patients with complex esophageal cancer in whom the stomach is unavailable for reconstruction due to previous gastrectomy, tumor involvement, failed gastric conduit, or other constraints. Although the jejunum offers a caliber similar to the esophagus, a rich blood supply, and preserved peristaltic function, anatomical variations in mesenteric length and vascular arcades render long-segment and high-level reconstruction susceptible to excessive tension, mesenteric torsion, venous congestion, and inadequate distal perfusion. This consensus aims to provide standardized recommendations for the application of jejunal interposition in this specific patient population. Methods This consensus was developed in accordance with the WHO Handbook for Guideline Development and Chinese national guideline development standards, with reference to the Appraisal of Guidelines for Research & Evaluation Ⅱ(AGREE Ⅱ), Reporting Items for Practice Guidelines in Healthcare (RIGHT), and Scientific, Transparent and Applicable Rankings (STAR) checklists. The project was registered on the international practice guidelines registry platform (PREPARE-2026CN1384). The working group systematically searched Chinese and English evidence addressing 12 clinical questions. Evidence was graded using the Oxford Centre for Evidence-Based Medicine (OCEBM) 2009 system, with structured appraisal of risk of bias, inconsistency, indirectness, and imprecision. Recommendations were formulated through two rounds of Delphi surveys and a face-to-face consensus meeting, with an agreement threshold of ≥75%. Results The consensus generated 12 recommendations covering indications, selection between jejunum and colon, preoperative assessment, surgical approach and reconstruction route, pedicled jejunal interposition (PJI), supercharged pedicled jejunal interposition (SPJ), indocyanine green (ICG) perfusion assessment, perioperative nutrition, management of anastomotic leakage, long-term follow-up, and special treatment scenarios. Given that the available direct evidence is predominantly derived from single-center retrospective cohorts and case series, recommendations extrapolated from general esophagectomy or other gastrointestinal surgical evidence are deliberately phrased with caution. Conclusion Jejunal interposition is a safe and effective approach for digestive tract reconstruction in patients with complex esophageal cancer in whom the stomach is unavailable. This consensus emphasizes that clinical decision-making should be individualized based on the patient's prior treatment history, reconstruction height, vascular anatomy, technical availability, and institutional experience in the Chinese context.

The recombinant human thyroid-stimulating hormone (rhTSH) can be used for differentiated thyroid cancer (DTC) preparation before ¹³¹I therapy, and follow-up. Since its approval by the American Food and Drug Administration (FDA) in 1998, rhTSH has been clinically used in European countries, the United States, and other countries for nearly 30 years. In April 2024, China’s first independently developed rhTSH agent was approved. Based on clinical experience and evidence from domestic and international studies, an expert consensus on the application of rhTSH has been developed following thorough consultations among experts. The consensus offers evidence-based recommendations to guide the appropriate use of rhTSH in clinical practice.

With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.

In protein engineering, while computational models are increasingly used to predict mutation effects, their evaluations primarily rely on high-throughput deep mutational scanning (DMS) experiments that use surrogate readouts, which may not adequately capture the complex biochemical properties of interest. Many proteins and their functions cannot be assessed through high-throughput methods due to technical limitations or the nature of the desired properties, and this is particularly true for the real industrial application scenario. Therefore, the desired testing datasets, will be small-size (∼10-100) experimental data for each protein, and involve as many proteins as possible and as many properties as possible, which is, however, lacking. Here, we present VenusMutHub, a comprehensive benchmark study using 905 small-scale experimental datasets curated from published literature and public databases, spanning 527 proteins across diverse functional properties including stability, activity, binding affinity, and selectivity. These datasets feature direct biochemical measurements rather than surrogate readouts, providing a more rigorous assessment of model performance in predicting mutations that affect specific molecular functions. We evaluate 23 computational models across various methodological paradigms, such as sequence-based, structure-informed and evolutionary approaches. This benchmark provides practical guidance for selecting appropriate prediction methods in protein engineering applications where accurate prediction of specific functional properties is crucial.

Pulpitis is a common infective oral disease in clinical situations. The regulatory mechanisms of immune defense in pulpitis are still being investigated. Osteomodulin (OMD) is a small leucine-rich proteoglycan family member distributed in bones and teeth. It is a bioactive protein that promotes osteogenesis and suppresses the apoptosis of human dental pulp stem cells (hDPSCs). In this study, the role of OMD in pulpitis and the OMD-induced regulatory mechanism were investigated. The OMD expression in normal and inflamed human pulp tissues was detected via immunofluorescence staining. Intriguingly, the OMD expression decreased in the inflammatory infiltration area of pulpitis specimens. The cellular experiments demonstrated that recombined human OMD could resist the detrimental effects of lipopolysaccharide (LPS)-induced inflammation. A conditional Omd knockout mouse model with pulpal inflammation was established. LPS-induced inflammatory impairment significantly increased in conditional Omd knockout mice, whereas OMD administration exhibited a protective effect against pulpitis. Mechanistically, the transcriptome alterations of OMD overexpression showed significant enrichment in the nuclear factor-κB (NF-κB) signaling pathway. Interleukin-1 receptor 1 (IL1R1), a vital membrane receptor activating the NF-κB pathway, was significantly downregulated in OMD-overexpressing hDPSCs. Additionally, the interaction between OMD and IL1R1 was verified using co-immunoprecipitation and molecular docking. In vivo, excessive pulpal inflammation in Omd-deficient mice was rescued using an IL1R antagonist. Overall, OMD played a protective role in the inflammatory response via the IL1R1/NF-κB signaling pathway. OMD may optimize the immunomodulatory functions of hDPSCs and can be used for regenerative endodontics.
Pulpitis/metabolism* ; NF-kappa B/metabolism* ; Animals ; Signal Transduction ; Humans ; Mice ; Mice, Knockout ; Dental Pulp/metabolism* ; Disease Models, Animal ; Lipopolysaccharides