ObjectiveTo investigate the therapeutic effects and mechanism of decoctions from four kinds of processed products of Aconiti Radix Lateralis Praeparata（ARLP） in deficiency-cold syndrome. MethodsA total of 36 SD rats were randomly divided into the control group， model group， Shengfupian（SFP） group， Paofuzi（PFZ） group， Heishunpian（HSP） group and Paofupian（PFP） group with 6 rats in each group. Except for the control group， rats in other groups were administered hydrocortisone sodium succinate via intramuscular injection to induce a cold deficiency syndrome model. After 14 consecutive days， each ARLP decoction pieces was administered via continuous gastric lavage at a dose of 12 g·kg^-1·d^-1 for 7 d， while the control and model groups received an equivalent volume of physiological saline. After the end of administration， body weight， spleen weight and thymus weight were measured for calculating the spleen and thymus indexes. Hematoxylin-eosin（HE） staining was used to observe the pathological morphology of adrenal tissue. The fully automatic biochemistry analyzer was used to measure the total cholesterol（TC）， triglyceride（TG）， lactic dehydrogenase（LDH） and lactate（LAC） levels in serum. Enzyme-linked immunosorbent assay（ELISA） was employed to measure the contents of 17-hydroxycorticosteroid（17-OHCS）， cortisol（CORT）， triiodothyronine（T₃）， thyroxine（T₄）， thyrotropin（TSH）， immunoglobulin（Ig） M， IgG， cyclic adenosine monophosphate（cAMP） and cyclic guanosine monophosphate（cGMP）. Western blot was used to measure the protein expression levels of protein kinase A（PKA）， cAMP response element-binding protein（CREB）， silent information regulator 1（Sirt1） and peroxisome proliferator-activated receptor γ coactivator-1α（PGC-1α）. And high performance liquid chromatography（HPLC） was used to determine the content of major alkaloids， followed by Pearson correlation analysis with pharmacodynamic indicators. ResultsAfter modeling， compare with the control group， the model rats exhibited symptoms such as lethargy and loose stools， mild abnormalities were observed in adrenal tissue structure， and both spleen and thymus indices were significantly reduced（P<0.01）. Thyroid， adrenal and immune system functions were suppressed， with decreased serum cAMP level and significantly elevated cGMP level（P<0.01）. Compared with the model group， the adrenal injury by hydrocortisone sodium succinate were repaired and the spleen index were increased significantly in all four ARLP groups（P<0.05， P<0.01）. The thymus index in SFP and PFZ groups were increased significantly（P<0.05）. The contents of T₃， TSH， 17-OHCS and CORT were increased significantly in SFP and PFZ groups（P<0.05）. In addition， the content of IgG in SFP， PFZ and PFP groups were increased significantly（P<0.01）， while the content of IgM in PFZ and HSP groups were also increased significantly（P<0.05）. Regarding the cyclic nucleotide system， PFZ significantly elevated cAMP level while reducing cGMP level（P<0.05）， exhibiting the most pronounced effect among the four decoction pieces. For energy metabolism indicators， PFZ significantly improved abnormal markers including TC， TG， LDH， and LAC（P<0.05）. HSP showed marked improvement effects on TG， LDH， and LAC（P<0.05）. Both PFZ and SFP significantly elevated the expression levels of PKA， CREB， Sirt1， and PGC-1α proteins（P<0.01）. Additionally， the diester alkaloids in ARLP showed a strong positive correlation with TG， IgG， and CORT， a strong negative correlation with LAC， a moderate positive correlation with T₄， and moderate negative correlations with cAMP and spleen index. Monomeric alkaloids showed strong positive correlations with TG and IgG， strong negative correlations with LAC， moderate positive correlations with CORT and T₄， and moderate negative correlations with cAMP and spleen index. However， the content of water-soluble alkaloids showed strong positive correlations with TC， LDH， 17-OHCS， T₃， TSH， and thymus index， moderate positive correlations with cAMP， CORT， T₄， and spleen index， and moderate negative correlation with cGMP. ConclusionAmong different processed ARLP decoction pieces， PFZ processed according to ZHANG Zhongjing's method exhibits the most potent warming and cold-dispelling effects. Its pharmacological actions are mediated through regulating the thyroid， adrenal， immune， cyclic nucleotide systems， and material-energy metabolism pathways. Among these， water-soluble alkaloids show strong or moderate correlations with more indicators of deficiency-cold syndrome and exhibit the highest content in PFZ. Therefore， PFZ processed according to ZHANG Zhongjing's method may exert its warming and cold-dispelling effects through water-soluble alkaloids.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective To analyze the current status of human papillomavirus(HPV) vaccination among women aged 9-45 years in Chaoyang District of Beijing, and to provide a basis for further promoting population vaccination.Methods The HPV vaccination(including HPV2, HPV4 and HPV9) data among women aged 9-45 in Chaoyang District of Beijing as of December 31, 2024 in Beijing's immunization planning information system were derived, and the estimated HPV vaccination rate in Beijing's female population was obtained by data analysis.Results By December 31, 2024, the estimated first dose vaccination rate of HPV vaccine among women aged 9-45 years in Chaoyang District of Beijing had been 50. 88%, and the estimated full dose vaccination rate was 48. 66%. The estimated coverage of the first dose and the full dose among girls aged9-15 years was 4. 62% and 2. 87%, respectively. The estimated full dose coverage rate was 62. 73% in subdistrict and 37. 33%in district.Conclusion The estimated HPV vaccination rate of 9-45-year-old women in Chaoyang District of Beijing is higher than that in other regions of China, but the estimated vaccination rate of adolescent women aged 9-15 is significantly lower than that of other age groups. It is recommended to improve the HPV vaccination rate through multiple joint efforts to achieve the action goal of accelerating the elimination of cervical cancer in China and the world as soon as possible.

ObjectiveTo study the pharmacological substances and mechanisms through which sesquiterpene ZH-13 from Aquilariae Lignum Resinatum improves neuroinflammation. MethodsBV-2 microglial cells were stimulated with lipopolysaccharide （LPS） to induce neuroinflammation. The cells were divided into the normal group， the model group， and the ZH-13 low- and high-dose treatment groups （10， 20 μmol·L^-1）. The model group was treated with 1 μmol·L^-1 LPS. Cell viability was assessed using the cell proliferation and activity assay （CCK-8 kit）. Nitric oxide （NO） release in the cell supernatant was measured using a nitric oxide kit （Griess method）. The mRNA expression levels of interleukin-1β （IL-1β）， tumor necrosis factor-α （TNF-α）， inducible nitric oxide synthase （iNOS）， and interleukin-6 （IL-6） were detected by real-time fluorescence quantitative polymerase chain reaction （Real-time PCR）. The phosphorylation of mitogen-activated protein kinase （MAPK） pathway proteins was assessed by Western blot. ResultsCompared with the model group， ZH-13 dose-dependently reduced NO release from BV-2 cells under LPS stimulation （P<0.05， P<0.01）. In the 20 μmol·L^-1 ZH-13 treatment group， the mRNA expression levels of IL-1β， TNF-α， iNOS， and IL-6 were significantly reduced compared to the model group （P<0.05， P<0.01）. In both the low- and high-dose ZH-13 groups， the expression of the inflammatory factor TNF-α and the phosphorylation of c-Jun N-terminal kinase （JNK） in the upstream MAPK pathway were significantly reduced （P<0.05）. After stimulation with the JNK agonist anisomycin （Ani）， both low- and high-dose ZH-13 treatment groups showed reduced phosphorylation of JNK proteins compared to the Ani-treated group （P<0.01）. ConclusionThe sesquiterpene compound ZH-13 from Aquilariae Lignum Resinatum significantly ameliorates LPS-induced neuroinflammatory responses in BV-2 cells by inhibiting excessive JNK phosphorylation and reducing TNF-α expression. These findings elucidate the pharmacological substances and mechanisms underlying the sedative and calming effects of Aquilariae Lignum Resinatum.

Diabetic macular edema(DME), a serious complication of diabetic retinopathy(DR), is a chronic condition caused by multiple factors. Throughout its progression, inflammatory factors and vascular endothelial growth factor(VEGF)play a critical role. Anti-VEGF drugs have shown significant effectiveness in the treatment of DME; however, some patients may experience persistent DME after injection or require frequent injections. Dexamethasone intravitreal implants(DEX implants)serve as a sustained-release implant characterized by a reasonable release profile and high bioavailability. They offer safe, effective, and prolonged anti-inflammatory effects, aiding in the repair of retinal barrier and reduction of exudation. To further enhance patients' visual quality, exploring the efficacy of DEX implants in combination with existing treatment regimens has great clinical significance. This review primarily discusses the research advancements in DEX implants, focusing on their pharmacological properties, indications for use, and their combination with existing drugs and treatment methods. It also evaluates the advantages and disadvantages of combination therapy or switching to DEX implants compared to current standard treatments, aiming to provide guidance for personalized treatment options for patients with DME.

AIM: To evaluate the effectiveness and safety of compound anisodine combined with laser photocoagulation in the treatment of diabetic retinopathy(DR).METHODS: A prospective cohort study was used to select 80 patients(160 eyes)diagnosed with severe non-proliferative diabetic retinopathy(NPDR)and proliferative diabetic retinopathy(PDR)in Beijing Tongren Hospital, Capital MedTcal University and Beijing Daxing District People's Hospital from May 2023 to July 2023. They were divided into control group(40 cases, 80 eyes)and observation group(40 cases, 80 eyes)by random number table method. The control group only received 532 nm laser panretinal photocoagulation(PRP)treatment, while the observation group received PRP treatment together with superficial temporal subcutaneous injection of compound anisodine. The clinical efficacy, changes in hemorheology, changes in retinal blood vessels, and incidence of adverse reactions in the two groups were observed before and at 2 mo after treatment.RESULTS: The visual acuity, fundus changes and hemorheological parameters of the two groups were analyzed before and after treatment. There were no significant differences in the two groups before treatment(all P>0.05). The best corrected visual acuity of the observation group was better than that of the control group at 2 mo after treatment(P<0.05), and the clinical curative effect of fundus was also better than that of the control group(all P<0.05). The hemorheological indexes of central retinal artery blood flow(peak systolic velocity and end diastolic velocity)in the observation group were higher than those of the control group(all P<0.05), and the blood flow resistance index was lower than that of the control group(P<0.05).CONCLUSION: Compound anisodine combined with 532 nm laser photocoagulation is safe and effective in the treatment of DR, and the visual recovery effect is better.

ObjectiveTo study the chemical constituents of Bidens pilosa and the in vitro antiproliferative activity of some compounds against gastric cancer cells. MethodsThe chemical constituents were isolated and purified by methods such as silica gel column chromatography， preparative thin layer chromatography， medium pressure preparation chromatography， semi-preparative high performance liquid chromatography（HPLC） and recrystallization， their structures were identified on the basis of physicochemical properties， spectral data and circular dichroism spectra. Thiazole blue（MTT） assay was used to determine the in vitro inhibitory activityies of some isolated compounds against human gastric cancer SGC-7901 cells， and molecular docking was used to predict their potential targets. ResultsTwenty-five compounds were isolated from the petroleum ether fraction of B. pilosa and identified as bidpillignan A（1）， 5α， 8α-epidioxy-（22E， 24R）-ergosta-6， 22-diene-3β-ol（2）， 3β-hydroxysitost-5-en-7-one（3）， （20R）-6β-hydroxystigmasta-4， 22-dien-3-one（4）， 3β-hydroxylstigmasta-5， 22-dien-7-one（5）， （22E， 24S）-24-methyl-5α-choleata-7， 22-diene-3β， 5α， 6β-triol（6）， stigamast-5-ene-3β， 7α-diol（7）， stigmast-5， 22-diene-3β， 7α-diol（8）， 7β-hydroxysitosterol（9）， stigmasterol（10）， artabotrol（11）， cosmosoic acid（12）， ent-4（15）-eudesmene-1β， 6α-diol（13）， clovandiol（14）， 1H-indole-3-carboxaldehyde（15）， 6， 7-dimethoxycoumarin（16）， 3'， 4'-dimethoxyquercetin（17）， 8， 8'-bis-（dihydroconiferyl）-diferuloylate（18）， hydroxydihydrobovolide（19）， 2-deacetyl-11β， 13-dihydroxyxanthinin（20）， loliolide（21）， pubescone（22）， （+）-dehydrovomifoliol（23）， 2， 3-dihydroxypropyl palmitate（24） and n-hexadecane acid（25）. Among them， compound 1 was a new compound， compounds 3-9， 11-12， 18-20， 22-23 were first isolated from Bidens genus plants， and compounds 13 and 14 were isolated from this plant for the first time. Compounds 17 and 18 showed good in vitro proliferation inhibitory activities against SGC-7901 cells with the half inhibitory concentrations（IC₅₀） of 3.11， 7.22 μmol·L^-1， respectively. Molecular docking results showed that the potential targets of the two exerting anti-gastric cancer activity might be vascular endothelial growth factor receptor 2（VEGFR2） and poly（adenosine diphosphate-ribose） polymerase 7（PARP7）. ConclusionOne new compound， 14 genus first compounds， and 2 species first compounds were isolated from B. pilosa， among which compounds 17 and 18 processed anti-gastric cancer cell proliferation activity in vitro， and the targets may be VEGFR2 and PARP7.

With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.

Objective To investigate the safety, economic benefits and psychological effects of day breast conserving surgery for breast cancer. Methods The demographic data and clinical data of breast cancer patients undergoing day (day surgery group) and ward (ward surgery group) breast conserving surgeries in West China Hospital of Sichuan University from March 2020 to June 2021 were retrospectively collected; the demographic data, clinical data, medical and related transportation costs, and preoperative and postoperative BREAST-Q scores of breast cancer patients undergoing day (day surgery group) and ward (ward surgery group) breast conserving surgery in West China Hospital of Sichuan University from June 2021 to June 2022 were prospectively collected. The safety, economic benefit, and psychological satisfaction of day surgery was analyzed. Results A total of 42 women with breast cancer were included in the retrospective study and 39 women with breast cancer were included in the prospective study. In both prospective and retrospective studies, the mean age of patients in both groups were <50 years. There were only statistical differences between the two groups in the aspects of hypertension (P=0.022), neoadjuvant chemotherapy (P=0.037) and postoperative pathological estrogen receptor (P=0.033) in the prospective study. In postoperative complications, there were no statistical differences in the surgical-related complications or anesthesia-related complications between the two groups in either the prospective study or the retrospective study (P>0.05). In terms of the overall cost, we found that the day surgery group was more economical than the ward surgery group in the prospective study (P=0.002). There were no statistical differences in postoperative psychosocical well-being, sexual well-being, satisfaction with breasts or chest condition between the two groups (P>0.05). Conclusion It is safe and reliable to carry out breast conserving surgery in day surgery center under strict management standards, which can save medical costs and will not cause great psychological burden to patients.

Objective To evaluate the safety and efficacy of basic anesthesia combined with local anesthesia in the preoperative localization of multiple pulmonary nodules. Methods The clinical data of patients who underwent preoperative localization for multiple pulmonary nodules resection under single-port thoracoscopy in Nanjing Brain Hospital from July 2023 to September 2023 were extracted. They were divided into a group A and a group B according to the localization method. The patients in the group A were localized under local anesthesia, and the patients in the group B were localized with basic anesthesia combined with local anesthesia. The basic clinical characteristics, localization success rate, incidence of localization complications, localization time, and pain score of the two groups were compared and analyzed. Results Finally, we included 200 patients with 100 patients in each group. There were 49 males and 51 females at age of 25-77 (50.94±14.29) years in the group A. There are 45 males and 55 females at age of 24-78 (48.25±14.04) years in the group B. The incidence of localization complications (4% vs. 13%, P=0.04), localization time [(19.90±8.66) min vs. (15.23±5.98) min, P<0.01], and pain score[ (2.01±2.09) vs. (3.29±2.54), P<0.01] in the group B were significantly lower than those in the group A, and the differences were statistically significant. The localization success rate of the group B was significantly higher than that of the group A (98% vs. 92%, P=0.04), and the difference was statistically significant.Conclusion Mobile CT combined with basic anesthesia for preoperative localization of multiple pulmonary nodules is highly safe, has a high success rate, and provides high patient comfort, making it a valuable approach for clinical promotion.