ObjectiveTo investigate the therapeutic effects and mechanism of decoctions from four kinds of processed products of Aconiti Radix Lateralis Praeparata（ARLP） in deficiency-cold syndrome. MethodsA total of 36 SD rats were randomly divided into the control group， model group， Shengfupian（SFP） group， Paofuzi（PFZ） group， Heishunpian（HSP） group and Paofupian（PFP） group with 6 rats in each group. Except for the control group， rats in other groups were administered hydrocortisone sodium succinate via intramuscular injection to induce a cold deficiency syndrome model. After 14 consecutive days， each ARLP decoction pieces was administered via continuous gastric lavage at a dose of 12 g·kg^-1·d^-1 for 7 d， while the control and model groups received an equivalent volume of physiological saline. After the end of administration， body weight， spleen weight and thymus weight were measured for calculating the spleen and thymus indexes. Hematoxylin-eosin（HE） staining was used to observe the pathological morphology of adrenal tissue. The fully automatic biochemistry analyzer was used to measure the total cholesterol（TC）， triglyceride（TG）， lactic dehydrogenase（LDH） and lactate（LAC） levels in serum. Enzyme-linked immunosorbent assay（ELISA） was employed to measure the contents of 17-hydroxycorticosteroid（17-OHCS）， cortisol（CORT）， triiodothyronine（T₃）， thyroxine（T₄）， thyrotropin（TSH）， immunoglobulin（Ig） M， IgG， cyclic adenosine monophosphate（cAMP） and cyclic guanosine monophosphate（cGMP）. Western blot was used to measure the protein expression levels of protein kinase A（PKA）， cAMP response element-binding protein（CREB）， silent information regulator 1（Sirt1） and peroxisome proliferator-activated receptor γ coactivator-1α（PGC-1α）. And high performance liquid chromatography（HPLC） was used to determine the content of major alkaloids， followed by Pearson correlation analysis with pharmacodynamic indicators. ResultsAfter modeling， compare with the control group， the model rats exhibited symptoms such as lethargy and loose stools， mild abnormalities were observed in adrenal tissue structure， and both spleen and thymus indices were significantly reduced（P<0.01）. Thyroid， adrenal and immune system functions were suppressed， with decreased serum cAMP level and significantly elevated cGMP level（P<0.01）. Compared with the model group， the adrenal injury by hydrocortisone sodium succinate were repaired and the spleen index were increased significantly in all four ARLP groups（P<0.05， P<0.01）. The thymus index in SFP and PFZ groups were increased significantly（P<0.05）. The contents of T₃， TSH， 17-OHCS and CORT were increased significantly in SFP and PFZ groups（P<0.05）. In addition， the content of IgG in SFP， PFZ and PFP groups were increased significantly（P<0.01）， while the content of IgM in PFZ and HSP groups were also increased significantly（P<0.05）. Regarding the cyclic nucleotide system， PFZ significantly elevated cAMP level while reducing cGMP level（P<0.05）， exhibiting the most pronounced effect among the four decoction pieces. For energy metabolism indicators， PFZ significantly improved abnormal markers including TC， TG， LDH， and LAC（P<0.05）. HSP showed marked improvement effects on TG， LDH， and LAC（P<0.05）. Both PFZ and SFP significantly elevated the expression levels of PKA， CREB， Sirt1， and PGC-1α proteins（P<0.01）. Additionally， the diester alkaloids in ARLP showed a strong positive correlation with TG， IgG， and CORT， a strong negative correlation with LAC， a moderate positive correlation with T₄， and moderate negative correlations with cAMP and spleen index. Monomeric alkaloids showed strong positive correlations with TG and IgG， strong negative correlations with LAC， moderate positive correlations with CORT and T₄， and moderate negative correlations with cAMP and spleen index. However， the content of water-soluble alkaloids showed strong positive correlations with TC， LDH， 17-OHCS， T₃， TSH， and thymus index， moderate positive correlations with cAMP， CORT， T₄， and spleen index， and moderate negative correlation with cGMP. ConclusionAmong different processed ARLP decoction pieces， PFZ processed according to ZHANG Zhongjing's method exhibits the most potent warming and cold-dispelling effects. Its pharmacological actions are mediated through regulating the thyroid， adrenal， immune， cyclic nucleotide systems， and material-energy metabolism pathways. Among these， water-soluble alkaloids show strong or moderate correlations with more indicators of deficiency-cold syndrome and exhibit the highest content in PFZ. Therefore， PFZ processed according to ZHANG Zhongjing's method may exert its warming and cold-dispelling effects through water-soluble alkaloids.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Surgical treatment is one of the key approaches for non-small cell lung cancer (NSCLC). Regular postoperative follow-up is crucial for early detection and timely management of tumor recurrence, metastasis, or second primary tumors. A scientifically sound and reasonable follow-up strategy not only extends patient survival but also significantly improves quality of life, thereby enhancing overall prognosis. This consensus aims to build upon the previous version by incorporating the latest clinical research advancements and refining postoperative follow-up protocols for early-stage NSCLC patients based on different treatment modalities. It provides a scientific and practical reference for clinicians involved in the postoperative follow-up management of NSCLC. By optimizing follow-up strategies, this consensus seeks to promote the standardization and normalization of lung cancer diagnosis and treatment in China, helping more patients receive high-quality care and long-term management. Additionally, the release of this consensus is expected to provide insights for related research and clinical practice both domestically and internationally, driving continuous development and innovation in the field of postoperative management for NSCLC.

OBJECTIVE To systematically evaluate risk prediction models for chemotherapy-induced myelosuppression in breast cancer， and provide a scientific reference for clinical healthcare workers in selecting or developing effective predictive models. METHODS A systematic search was conducted for studies on predictive models of the risk of chemotherapy-induced myelosuppression in breast cancer across the CNKI， VIP， Wanfang， PubMed， Web of Science， Cochrane Library， Embase， and Scopus databases， with a time frame of the establishment of the database to May 7， 2024. Literature was independently screened by 2 investigators， data were extracted according to critical appraisal and data extraction for systematic reviews of predictive model studies， and the risk of bias evaluation tool for predictive model studies was used to analyze the risk of bias and applicability of the included studies. RESULTS There were totally 7 studies， comprising 12 models. Among them， 11 models indicated an area under the subject operating characteristic curve of 0.600-0.908； 2 models indicated calibration. The common predictor variables of the included models were age， pre-chemotherapy neutrophil count， pre-chemotherapy lymphocyte count， and pre-chemotherapy albumin. The overall risk of bias of the 7 studies was high， which was mainly attributed to the flaws in the study design， insufficient sample sizes， inappropriate treatment of variables， non-reporting of missing data， and the lack of indicators for the assessment of the models， but the applicability was good. CONCLUSIONS The predictive performance of risk predictive models for chemotherapy-induced myelosuppression in breast cancer remains to be further enhanced， and the overall risk of model bias is high. Future studies should follow the specifications of model development and reporting， then combine machine learning algorithms to develop risk predictive models with good predictive performance， high stability， and low risk of bias， so as to provide a decision-making basis for the clinic.

BACKGROUND:Platelet-derived extracellular vesicles are the most abundant vesicles in the circulation,rich in bioactive molecules,genetic material,proteins and other information molecules,involved in cellular communication and material exchange,not only has good procoagulant activity,but also has the promotion of tissue repair and regeneration,and has a wide range of applications in regenerative medicine. OBJECTIVE:To elaborate the secretion mechanism of platelet-derived extracellular vesicles,their application in regenerative medicine,and limiting factors for clinical transformation,and to provide some theoretical support for the clinical translation of platelet-derived extracellular vesicles. METHODS:A computerized search of the PubMed database from January 2005 to August 2023 was applied to articles relating to platelet-derived extracellular vesicles with the search terms"platelet-derived,platelet-rich plasma,extracellular vesicles,isolated,microvesicles exosomes,applications".A total of 62 articles that met the subject criteria were finally included. RESULTS AND CONCLUSION:(1)Activated platelet-derived extracellular vesicles produce two types of vesicles,platelet-derived microparticles,whose secretion may be associated with the asymmetry of the actin cytoskeleton,and platelet-derived exosomes,which may be associated with the regulation of H+-ATPase.(2)Platelet-derived extracellular vesicles are potential effectors of platelet concentrates and platelets themselves,and may intervene in tissue regeneration by promoting angiogenesis,influencing cellular behavior,promoting coagulation and hemostasis,and exerting inflammatory effects.(3)Platelet-derived extracellular vesicles have been reported preclinically in the field of regenerative medicine such as tissue injury,muscle regeneration,cartilage regeneration,and osteoarthritis,and clinical trial data are available as potential therapeutic approaches for wound healing.However,factors such as isolation methods,sample sources,and the types of activators limit the clinical translation of platelet-derived extracellular vesicles into the field of regenerative medicine.(4)In the future,platelet-derived extracellular vesicles may become a cell-free alternative to platelet-rich plasma in regenerative medicine,but the clinical translation of platelet-derived extracellular vesicles needs to actively search for specific markers to differentiate platelet-derived microparticles from platelet-derived exosomes.The mechanism of activator-stimulated platelet-derived extracellular vesicle production,as well as the optimal method of platelet-derived extracellular vesicle collection,the optimal method of storage,the shelf life of the platelet-derived extracellular vesicles,the recommended dosage of platelet-derived extracellular vesicles for clinical application,and the optimal clinical indications need to be further investigated.

OBJECTIVE:The main clinical manifestations of knee osteoarthritis are pain,swelling,stiffness,and limited activity,which have a serious impact on the life of patients.Exercise therapy can effectively improve the related symptoms of patients with knee osteoarthritis.This paper uses the method of network meta-analysis to compare the efficacy of different exercise types in the treatment of knee osteoarthritis. METHODS:CNKI,WanFang,PubMed,Embase,Cochrane Library,Web of Science,Scopus,Ebsco,SinoMed,and UpToDate were searched with Chinese search terms"knee osteoarthritis,exercise therapy"and English search terms"knee osteoarthritis,exercise".Randomized controlled trials on the application of different exercise types in patients with knee osteoarthritis from October 2013 to October 2023 were collected.The outcome measures included visual analog scale,Western Ontario and McMaster Universities Osteoarthritis Index score,Timed Up and Go test,and 36-item short form health survey.Literature quality analysis was performed using the Cochrane Manual recommended tool for risk assessment of bias in randomized controlled trials.Two researchers independently completed the data collection,collation,extraction and analysis.RevMan 5.4 and Stata 18.0 software were used to analyze and plot the obtained data. RESULTS:A total of 29 articles with acceptable quality were included,involving 1 633 patients with knee osteoarthritis.The studies involved four types of exercise:aerobic training,strength training,flexibility/skill training,and mindfulness relaxation training.(1)The results of network meta-analysis showed that compared with routine care/health education,aerobic training could significantly improve pain symptoms(SMD=-3.26,95%CI:-6.33 to-0.19,P<0.05);strength training(SMD=-0.79,95%CI:-1.34 to-0.23,P<0.05)and mindfulness relaxation training(SMD=-0.79,95%CI:-1.23 to-0.34,P<0.05)could significantly improve the function of patients.Aerobic training(SMD=-1.37,95%CI:-2.24 to-0.51,P<0.05)and mindfulness relaxation training(SMD=-0.41,95%CI:-0.80 to-0.02,P<0.05)could significantly improve the functional mobility of patients.Mindfulness relaxation training(SMD=0.70,95%CI:0.21-1.18,P<0.05)and strength training(SMD=0.42,95%CI:0.03-0.81,P<0.05)could significantly improve the quality of life of patients.(2)The cumulative probability ranking results were as follows:pain:aerobic training(86.6%)>flexibility/skill training(60.1%)>strength training(56.8%)>mindfulness relaxation training(34.7%)>routine care/health education(11.7%);Knee function:strength training(73.7%)>mindfulness relaxation training(73.1%)>flexibility/skill training(56.1%)>aerobic training(39.9%)>usual care/health education(7.6%);Functional mobility:aerobic training(94.7%)>mindfulness relaxation training(65.5%)>strength training(45.1%)>flexibility/skill training(41.6%)>routine care/health education(3.2%);Quality of life:mindfulness relaxation training(91.3%)>strength training(68.0%)>flexibility/skill training(44.3%)>aerobic training(34.0%)>usual care/health education(12.3%). CONCLUSION:(1)Exercise therapy is effective in the treatment of knee osteoarthritis,among which aerobic training has the best effect on relieving pain and improving functional mobility.Strength training and mindfulness relaxation training has the best effect on improving patients'function.Mindfulness relaxation training has the best effect on improving the quality of life of patients.(2)Limited by the quality and quantity of the included literature,more high-quality studies are needed to verify it.

BACKGROUND:The capability of repairing articular cartilage damage is very limited,and tissue engineering technology provides new therapeutic options for repairing damaged cartilage,in which the interaction and induction between chondrocytes,bone marrow mesenchymal stem cells,and synovial mesenchymal stem cells is the basis of autologous healing of cartilage damage. OBJECTIVE:To construct the chondrocyte-bone marrow mesenchymal stem cell-synovial mesenchymal stem cell co-culture system to simulate the in vitro microenvironment of chondrocytes,and to explore the optimal cell inoculation ratio,meanwhile to observe the effects of icariin-containing serum on the proliferation of chondrocytes and the chondrogenic differentiation of stem cells in the system. METHODS:Rat knee chondrocytes,bone marrow mesenchymal stem cells and synovial mesenchymal stem cells were extracted,cultured and identified,and a chondrocyte-bone marrow mesenchymal stem cell-synovial mesenchymal stem cell non-contact co-culture system was constructed according to different cell inoculation ratios.After 72 hours of co-culturing,the chondrocyte proliferative activity and phenotypic ability were observed,and the co-culture system with the best overall effect was selected.New Zealand white rabbits were gavaged with icariin solution(0.25 mg/mL)to prepare icariin-containing serum,and cultured in conventional complete medium(high sugar DMEM culture medium containing 10%fetal bovine serum and 1%double antibody by volume)as the control group,while the experimental group was intervened by adding 10%icariin-containing serum by volume on the basis of above.The proliferative activity of chondrocytes and the expression of collagen type II were tested for the two groups after 24 and 48 hours.The differentiation of bone marrow mesenchymal stem cells and synovial mesenchymal stem cells into chondrocytes in the co-culture system was tested by immunofluorescence staining after 14 days. RESULTS AND CONCLUSION:(1)The three kinds of cells grew normally adherently to the wall in different ratios of co-culture,where chondrocytes showed the best proliferative activity and phenotypic ability in the co-culture system when chondrocytes:bone marrow mesenchymal stem cells:synovial mesenchymal stem cells=2:1:1.(2)Compared with the control group,the proliferative activity and type II collagen expression of chondrocytes in the experimental group were significantly increased after 24 hours(P<0.01),and the two groups still had difference after 48 hours(P<0.05).The two groups showed obvious chondrogenic differentiation of bone marrow mesenchymal stem cells and synovial mesenchymal stem cells after 14 days(P<0.01),and some of the cells appeared round or oval,and the cytoplasmic type II collagen immunofluorescence staining was positive.The fluorescence intensity of the experimental group was significantly higher than that of the control group(P<0.01).(3)The results showed that the chondrocyte-bone marrow mesenchymal stem cell-synovial mesenchymal stem cell co-culture system could be successfully established by the non-contact co-culture method,and the best chondrocyte proliferative activity and phenotypic ability could be obtained when the cell ratio was 2:1:1.Icariin-containing serum had the promoting effect on chondrocyte proliferation,and chondrogenic differentiation of bone marrow mesenchymal stem cells and synovial mesenchymal stem cells in the system.

OBJECTIVE To provide reference for improving the pre-prescription review system and reducing the occurrence of medication error by analyzing the drug-related problems （DRPs） in the pre-prescription review orders of pediatric outpatient clinics using the Pharmaceutical Care Network Europe （PCNE） classification system. METHODS The data of pre-prescription review orders were retrospectively collected from outpatient department of Shanghai Children’s Medical Center， Shanghai Jiao Tong University School of Medicine from July 2022 to June 2023； DRPs in the pre-prescription review orders were classified and summarized by using the PCNE classification system （version 9.1）， and then analyzed in terms of types and causes of issues， and the acceptance of interventions. RESULTS A total of 66 017 DRPs orders were included， involving 41 165 patients. The proportion of DRPs orders in children aged ≤5 years old was the highest （58.25%）， followed by children aged 6-12 years old （33.52%）； the department with the highest proportion of DRPs was internal medicine of pediatrics department （71.41%）； the department with the highest incidence of DRPs was thoracic surgery department （9.73%）； top three drug categories of DRPs orders were systemic anti- infective drugs （25.26%）， Chinese patent medicines （24.74%） and respiratory drugs （22.38%）. Referring to PCNE classification system， the types of DRPs mainly focused on treatment safety （64.86%）； the reasons of DRPs orders mainly focused on dose selection （82.09%）， of which 41.26% were due to excessive drug dosage； 92.13% of interventions could be accepted and fully executed by doctors. CONCLUSIONS DRPs orders identified by the pre-prescription review system can be effectively analyzed by using PCNE classification system. Pharmacists should focus on medication use in children aged ≤5 years old， update and develop personalized prescription review rules timely， and meet the rational needs of clinical medication for children.

With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.

ObjectiveTo investigate the efficacy of Xingpi capsules （XPC） in treating diarrhea-predominant irritable bowel syndrome （IBS-D） with spleen deficiency and elucidate its potential molecular mechanisms. MethodsA rat model of IBS-D with spleen deficiency was established by administering senna leaf in combination with restrained stress and swimming fatigue for 14 d. Ten specific pathogen free （SPF）-grade healthy rats were used as the normal control group. After successful modeling， SPF-grade rats were randomly divided into a model group， a pinaverium bromide group （1.5 mg·kg^-1）， and low- and high-dose XPC groups （0.135 and 0.54 g·kg^-1）， with 10 rats in each group. Rats in the normal control group and the model group were given distilled water by gavage， while the remaining groups were administered corresponding drug solutions by gavage once a day for 14 consecutive days. The rat body weights and fecal condition were observed every day， and the Bristol score was recorded. Enzyme-linked immunosorbent assay （ELISA） was used to determine the levels of 5-hydroxytryptamine （5-HT） in serum and colon tissue. Transmission electron microscopy was used to observe the microvilli and tight junctions in the colon. The integrity of the colonic barrier， intestinal motility， and expression of related pathway proteins were evaluated by hematoxylin-eosin （HE） staining， immunohistochemistry， and Western blot. ResultsCompared with those in the normal control group， rats in the model group showed a significantly decreased body weight and increased diarrhea rate， diarrhea grade， and Bristol score （P<0.01）. HE staining revealed incomplete colonic mucosa in the model group， with evident congestion and edema observed. Electron microscopy results indicated decreased density and integrity of the colonic barrier， shedding and disappearance of microvilli， and significant widening of tight junctions. The expression levels of colonic tight junction proteins Occludin and Claudin-5 were downregulated （P<0.01）， and the levels of 5-HT in serum and colon tissue were elevated （P<0.01）. The small intestine propulsion rate significantly increased （P<0.01）， and the expression of contractile proteins Ras homolog family member A （RhoA） and Rho-associated coiled-coil containing protein kinase 2 （ROCK2） in colon and phosphorylation of myosin light chain （MLC₂₀） were upregulated （P<0.01）. Compared with the model group， the treatment groups showed alleviated diarrhea， diarrhea-associated symptoms， and pathological manifestations of colon tissue to varying degrees. Specifically， high-dose XPC exhibited effectively relieved diarrhea， promoted recovery of colonic mucosal structure， significantly reduced congestion and edema， upregulated expression of Occludin and Claudin-5 （P<0.01）， decreased levels of 5-HT in serum and colon tissue （P<0.05，P<0.01）， significantly slowed small intestine propulsion rate （P<0.01）， and significantly downregulated expression of contractile proteins RhoA and ROCK2 in colon and phosphorylation of MLC₂₀ （P<0.05，P<0.01）. ConclusionXPC effectively alleviates symptoms of spleen deficiency and diarrhea and regulates the secretion of brain-gut peptide. The characteristics of XPC are mainly manifested in alleviating IBS-D with spleen deficiency from the aspects of protecting intestinal mucosa and inhibiting smooth muscle contraction， and the mechanism is closely related to the regulation of the 5-HT-RhoA/ROCK2 pathway expression.