1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Research progress in the signaling pathways of thyroid-associated ophthalmopathy
Xiaoying LIU ; Xianfang PU ; Jianshu KANG
International Eye Science 2026;26(3):467-472
Thyroid-associated ophthalmopathy(TAO)is a common autoimmune complication in thyroid diseases. Its pathogenesis is complex and involves the abnormal activation of multiple signaling pathways. With the rapid development of molecular biology and genomics technologies, the signal transduction mechanisms and regulatory networks related to TAO have been deeply analyzed. At present, studies have found that the interaction between the TSH receptor(TSHR)and the insulin-like growth factor-1 receptor(IGF-1R)signaling pathway, as well as immune inflammation-related pathways, oxidative stress, and calcium signaling pathways, play important roles in the pathogenesis of TAO. In addition, the research on the regulatory mechanism of non-coding RNA and fibrosis-related signaling molecules has gradually become the focus. Despite much advancement, there are still many unsolved mysteries regarding the exact pathogenesis of TAO. This article aims to systematically review the latest research progress of the main signaling pathways of TAO. By combining the latest achievements in gene expression profiles, single-cell sequencing and drug design, it analyzes potential therapeutic targets and the development directions of innovative drugs, providing a theoretical basis for the pathological mechanism of TAO and a scientific basis for the optimization of clinical treatment strategies at the same time.
3.Stimulating effects of conjunctival sac implants after eye enucleation on orbital bone tissue in rabbits
Xiaoying LIU ; Zhulin HU ; Jianshu KANG ; Hong ZHANG
Chinese Journal of Experimental Ophthalmology 2018;36(10):761-766
Objective To investigate the stimulating effects of conjunctival sac implants following eye enucleation on orbital bone tissue in rabbits model.Methods Eighty 1-month-old New Zealand rabbits were randomly divided into normal control group,only eyeball enucleation group,2-week interval group and 4-week interval group.The right eyeballs were enucleated in the rabbits in the only eyeball enucleation group,2-week interval group and 4-week interval group,and conjunctival sac implants were placed intraoperatively.Then a larger implant was replaced in a 2-week interval or 4-week interval in different groups,respectively.Spiral CT scan was used to evaluate the orbital bone development with aging.The peripheral blood of 3 ml was collected in the rabbits for the detection of osteocalcin and alkaline phosphatase using osteocalcin test kit (N-MID Osteocalcin) and alkaline phosphatase assay kit (NPP substrate-AMP buffer method),respectively.The animals were sacrificed at 3 months after operation for the histopathological examination of orbital bone tissue.Results The operation was successful in all the rabbits and no infection occurred after operation.The variance of orbital bone CT value was obvious in all the rabbits.The intercalated osteocalcin concentration was (48.55 ± 7.99),(59.80 ± 2.96),(57.94 ± 5.20) and (55.96 ± 3.22) μg/L and the alkaline phosphatase concentration was (284.66± 132.69),(232.96±54.39),(232.40± 118.23),(284.20± 130.41) μg/L in the normal control group,only eyeball enucleation group,2-week interval group and 4-week interval group,respectively,showing insignificant differences among the four groups (F =2.710,0.281,both at P > 0.05).Similar pathological findings were in the 2-week interval group and 4-week interval group,such as no obvious orbital bone malformations,weak bone absorption and few bone osteoclasts under the optical microscope.Varying degrees of orbital deformities and bone tissue absorption were found in the only eyeball enucleation group.No orbital bone developing abnormality was seen in the normal control group and the left eyes in various groups under the optical microscope.Conclusions Compared with the only eyeball enucleated eyes,the orbital bone tissue has a well developed process in conjunctiva sac implant eyes following eyeball enucleation.Conjunctiva sac implant is an effective method to stimulate orbital growth and orbital volume increasing.
4.ERK5 and MMP-9 expression levels in osteosarcoma and their clinical significance
Jianshu WANG ; Zhigang YI ; Yanchuan PU ; Jianmin SONG ; Bin GENG ; Yaqiong KANG ; Shuping MA ; Liping WANG ; Yayi XIA
Chinese Journal of Clinical Oncology 2017;44(14):689-694
Objective:To investigate the extracellular signal-regulated kinase 5 (ERK5) and matrix metallo proteinase-9 (MMP-9) expres-sion levels in osteosarcoma tissues and their clinical significance. Methods:The ERK5 and MMP-9 expression levels in 71 specimens of osteosarcoma tissue and 40 specimens of normal bone tissue were detected by immunohistochemistry. The relationship between ERK5 and MMP-9 expression levels, their clinical characteristics, and prognosis of patients with osteosarcoma were analyzed. Results:The positive expression of ERK5 and MMP-9 in osteosarcoma tissues was 85.9%(61/71) and 74.65%(53/71), respectively, which were significantly higher than those in normal bone tissues at 12.5%(5/40) and 10.0%(4/40) (all P<0.05). The positive expression of ERK5 and MMP-9 was associated with Enneking stage and metastasis (all P<0.05). Kaplan-Meier analysis showed that the survival duration of patients with positive ERK5 and MMP-9 expression levels was shorter than those of the patients in the negative expression groups (all P<0.05). Univariate analysis of COX proportional hazards regression model revealed that tumor size, Enneking stage, metastasis, and positive ERK5 and MMP-9 expression levels are relevant to the overall survival of patients with osteosarcoma (all P<0.05). Multi-variate analysis of COX proportional hazards regression model confirmed that Enneking stage, metastasis, and positive ERK5 and MMP-9 expression levels can act as independent prognostic factors for osteosarcoma patients (all P<0.05). Conclusion:The ERK5 and MMP-9 expression levels are high in osteosarcoma tissues and are related to the clinical characteristics and prognosis of patients with osteo-sarcoma. Thus, ERK5 and MMP-9 expression levels may play important roles in osteosarcoma development and progression.
5.The Clinical Effect of Conjunctival Sac Artificial Eye in Stimulating the Growth of Orbital and Conjunctival Sac
Xiaoying LIU ; Hong ZHANG ; Jianshu KANG ; Zhulin HU
Journal of Kunming Medical University 2013;(12):40-43
Objective To observe the clinical effect oflamellar keratectomy+conjunctival flap+implanted artificial eyein stimulating the orbital and conjunctival sac growth. Methods A retrospective case study: 12 cases (12 eyes) with congenital microphthalmos in the Fourth Affiliated Hospital of Kunming Medical University in 2009-2013 were selected. In these cases, there were 11 cases of microphthalmos, and 1 patient due to congenital absence of the eye without surgery, were given direct implant of the artificial eye;7 patients without significant stenosis in conjunctival sac,received thelamellar keratectomy+conjunctival Flap+implantation of artificial eye, 4 patients with conjunctival sac stenosis recieved thelamellar keratectomy+conjunctival flap+implanted artificial eye+eyelid suture. Results For stunted children who couldn't wear a prosthetic eye, after treated withlamellar keratectomy + conjunctival flap + artificial eye implantation, the conjunctival sac developed well, cornea was covered with conjunctiva well and no exposure,the appearance and volume of orbit was also improved. ConclusionLamellar keratectomy+conjunctival flap+artificial eye implantsurgery is an effective way to promote orbital and conjunctival sac development of the children with congenital microphthalmos.

Result Analysis
Print
Save
E-mail