OBJECTIVE: To investigate the detection patterns, clinical phenotypic characteristics, and differences in diagnostic timeliness of Klinefelter syndrome (KS) across prenatal and postnatal stages, with an aim to provide a basis for optimizing strategies for early screening, diagnosis, and intervention. METHODS: A retrospective study was conducted to analyze data from two phases. The prenatal diagnosis group included 33,302 pregnant women who underwent amniocytic karyotyping due to advanced maternal age, abnormal ultrasound findings, or high-risk non-invasive prenatal testing (NIPT). The postnatal diagnosis group included 52,101 patients who underwent peripheral blood karyotyping due to primary infertility, abnormal external genitalia, or growth and developmental abnormalities. Additionally, medical histories of adult diagnosed patients were reviewed retrospectively to identify early occult symptoms. This study was approved by the Medical Ethics Committee of Chengdu Women's and Children's Central Hospital (Ethics No.: LCYJ-2025-030). RESULTS: In the prenatal group, 96 cases of KS were detected (detection rate 0.29%). The primary indications for referral were NIPT indicating sex chromosome abnormalities (45.83%), advanced maternal age (16.66%), and ultrasound abnormalities (17.70%). In the postnatal group, 128 cases of KS were detected (detection rate 0.25%). Clinical presentations were primarily primary infertility/azoospermia (77.34%), and the patients were predominantly adults (84.40%). Retrospective analysis revealed that adult patients presented with specific physical signs that had been overlooked during childhood. CONCLUSION As KS lacks typical early clinical manifestations, diagnosis is often delayed until adulthood when reproductive needs arise, showing a pattern of "passive detection" and resulting in missed opportunities for optimal intervention. By conducting a comparative analysis of prenatal diagnostic data and postnatal retrospective data, a risk association model linking prenatal screening indications with childhood-specific signs was developed. This study has provided empirical evidence for establishing a multidisciplinary, full life-cycle management system of "screening ~ diagnosis ~ monitoring ~ intervention" helping to shift from "passive detection in adulthood" to "proactive management across the entire life course," and laid a foundation for improving early diagnosis rate and long-term quality of life for patients.
Humans ; Klinefelter Syndrome/genetics* ; Female ; Adult ; Pregnancy ; Retrospective Studies ; Prenatal Diagnosis/methods* ; Male ; Phenotype ; Karyotyping ; Young Adult ; Adolescent ; Middle Aged

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.

Objective:To investigate improvement of dexamethasone(DM)treatment after intrauterine adhesion decomposition on uterine fibrosis and inflammatory factors.Methods:A total of 60 patients with moderate to severe intrauterine adhesions admitted to The Reproductive Medicine Center of Jilin Provincial People's Hospital from March 2021 to March 2023 were selected,and divided into experimental group and control group according to random number table method,with 30 cases in each group.Control group under-went simple hysteroscopic adhesion decomposition,and experimental group underwent intrauterine infusion treatment with DM injec-tion after intrauterine adhesion decomposition.Improvement of clinical symptoms in the two groups was observed.RT-qPCR was used to detect changes in mRNA levels of intimal receptivity-related factors ER,EGFR,LIF,ITGB3,HOXA10,HOXA11,fibrosis-related factors TGF-β1,E-cadherin,N-cadherin,Smad,and inflammatory related factors IL-8,IL-2 and CD138 in two groups.Western blot was used to detect changes in expression levels of inflammatory related proteins IL-8,IL-2 and CD138.Results:Compared with before treatment,endometrial thickness,mRNA levels of ER,EGFR,LIF,ITGB3,HOXA10,HOXA11 and E-cadherin were significantly increased,while mRNA levels of TGF-β1,N-cadherin,Smad,IL-8,IL-2 and CD138,protein levels of IL-8,IL-2 and CD138,and endometrial blood flow parameters PI,RI and adhesion were significantly decreased.Eendometrial thickness,mRNA levels of ER,EGFR,LIF,ITGB3,HOXA10,HOXA11 and E-cadherin in experimental group were significantly higher than those in control group,while mRNA levels of IL-8,IL-2,TGF-β1,N-cadherin,Smad,CD138,IL-8,IL-2 and CD138,and endometrial blood flow parameters PI,RI and adhesion were lower than those in control group(P<0.05).Conclusion:Treatment of DM after intrauterine adhe-sion decomposition can improve intrauterine adhesion,blood flow parameters and endometrial receptivity,and prevent the recurrence of intrauterine adhesion,which mechanism may be related to up-regulation of E-cadherin expression and down-regulation of IL-8,IL-2,CD138,TGF-β1,N-cadherin and Smad expressions.

Objective To investigate the clinical efficacy of oblique lumbar interbody fusion(OLIF)combined with lateral plate fixation in the treatment of single-level adjacent segment disease(ASDis)following lumbar fusion surgery so as to evaluate the safety and effectiveness of this surgical approach.Methods A retrospective analysis was conducted on 46 patients with single-level ASDis after lumbar fusion surgery from August 2022 to October 2024.Twenty-three patients underwent OLIF combined with lateral plate fixation(OLIF group),while 23 patients received posterior lumbar interbody fusion(PLIF)(PLIF group).The following parameters were compared between the two groups:operative time,intraoperative blood loss,visual analogue scale(VAS)for pain,Oswestry disability index(ODI),disc height(DH),intervertebral foramen height(IFH),and interbody fusion status.Results All the 46 patients successfully completed surgery for single-level ASDis and were followed up for(13.7±1.1)months.The OLIF group had significantly shorter operative time[(70.7±4.6)min vs.(128.6±12.0)min]and less intraoperative blood loss[(58.6±5.7)mL vs.(313.3±47.5)mL]compared to the PLIF group(all P＜0.05).Both groups showed significant improvements in postoperative lumbar VAS and ODI scores at all follow-up time points compared to preoperative values(P＜0.05).The OLIF group exhibited significantly lower lumbar VAS scores at 3 days and 3 months postoperatively than those of the PLIF group(P＜0.05),and there was no statistical difference in VAS scores at the other follow-up time points(P＞0.05).There was no significant difference in postoperative ODI between OLIF group and PLIF group at each time point(P＞0.05).Postoperative DH and IFH were significantly improved in both groups compared to preoperative measurements(P＜0.05).In OLIF group,1 case of transient left thigh numbness resolved with conservative treatment within 2 weeks;1 case of cage subsidence was observed at 1 month postoperatively,achieving fusion without further displacement by 13 months.All the OLIF cases achieved complete fusion(fusion rate:100％).In PLIF group,2 cases of cerebrospinal fluid leakage healed with bed rest,1 case of wound exudation resolved with intensive dressing changes,and 1 case failed to achieve fusion(fusion rate:96％).Conclusion OLIF combined with lateral plate fixation demonstrates satisfactory early clinical outcomes for single-level ASDis after lumbar fusion,with significant advantages in operative efficiency(shorter time plus reduced blood loss)and short-term pain relief.Therefore,it is a safe and effective surgical approach.

Objective:To investigate improvement of dexamethasone(DM)treatment after intrauterine adhesion decomposition on uterine fibrosis and inflammatory factors.Methods:A total of 60 patients with moderate to severe intrauterine adhesions admitted to The Reproductive Medicine Center of Jilin Provincial People's Hospital from March 2021 to March 2023 were selected,and divided into experimental group and control group according to random number table method,with 30 cases in each group.Control group under-went simple hysteroscopic adhesion decomposition,and experimental group underwent intrauterine infusion treatment with DM injec-tion after intrauterine adhesion decomposition.Improvement of clinical symptoms in the two groups was observed.RT-qPCR was used to detect changes in mRNA levels of intimal receptivity-related factors ER,EGFR,LIF,ITGB3,HOXA10,HOXA11,fibrosis-related factors TGF-β1,E-cadherin,N-cadherin,Smad,and inflammatory related factors IL-8,IL-2 and CD138 in two groups.Western blot was used to detect changes in expression levels of inflammatory related proteins IL-8,IL-2 and CD138.Results:Compared with before treatment,endometrial thickness,mRNA levels of ER,EGFR,LIF,ITGB3,HOXA10,HOXA11 and E-cadherin were significantly increased,while mRNA levels of TGF-β1,N-cadherin,Smad,IL-8,IL-2 and CD138,protein levels of IL-8,IL-2 and CD138,and endometrial blood flow parameters PI,RI and adhesion were significantly decreased.Eendometrial thickness,mRNA levels of ER,EGFR,LIF,ITGB3,HOXA10,HOXA11 and E-cadherin in experimental group were significantly higher than those in control group,while mRNA levels of IL-8,IL-2,TGF-β1,N-cadherin,Smad,CD138,IL-8,IL-2 and CD138,and endometrial blood flow parameters PI,RI and adhesion were lower than those in control group(P<0.05).Conclusion:Treatment of DM after intrauterine adhe-sion decomposition can improve intrauterine adhesion,blood flow parameters and endometrial receptivity,and prevent the recurrence of intrauterine adhesion,which mechanism may be related to up-regulation of E-cadherin expression and down-regulation of IL-8,IL-2,CD138,TGF-β1,N-cadherin and Smad expressions.

Objective:To evaluate the cost-effectiveness of Artificial Intelligence(AI)-assisted physician image interpretation in the screening of early-stage lung cancer(stage Ⅰ)from the perspective of the healthcare system,so as to provide evidence for screening strategy optimization.Methods:Based on community populations,a decision tree model was constructed to simulate the cost-effectiveness of two screening strategies:Al-assisted physician image interpretation and independent physician image interpretation,and the Incremental Cost-Effectiveness Ratio(ICER)was calculated.Results:In the basic analysis,the per capita costs of the AI-assisted group and the physician group were 1 483 yuan and 1 489 yuan,respectively,and the effectiveness was 17.02 Quality-Adjusted Life Years(QALYs)and 16.99 QALYs,respectively.Compared with the physician group,the AI-assisted group saved 6 yuan per case and obtained an additional 0.03 QALY per case.The ICER was negative,indicating that the AI-assisted group had an absolute advantage.Threshold analysis showed that when the inspection cost of Al-assisted physician image interpretation increased to 428 yuan per case,the average cost per case was the same between these two groups,and the ICER was 0.When the inspection cost of Al-assisted physician image interpretation was above 428 yuan,the ICER was positive,still demonstrating economic efficiency.Conclusion:AI-assisted image interpretation is cost-effective in the screening of early-stage lung cancer and can facilitate the"early detection,early diagnosis,and early treatment"of lung cancer based on improving the efficiency and accuracy of screening,so as to provide scientific support for health system resource optimization.

Objective: To explore the brain-predicted age difference (Brain-PAD) in patients with type 2 diabetes mellitus (T2DM) by a machine learning prediction model based on structural magnetic resonance ( sMRI) in the Southwest University Adult Lifespan Dataset (SALD) , and to reveal the relationship between Brain-PAD and dura- tion of T2DM and cognition . Methods: Group comparisons about demographic variables and cognitive function were conducted respectively in local database of 104 T2DM patients and 83 healthy controls (HC) . The prediction model via Gaussian process regression (GPR) was constructed by training sMRI data of 329 healthy volunteers in SALD , then its performance was validated and evaluated . Furthermore , Brain-PAD ( predicted age-chronological age) in the local database was calculated . Group comparisons of Brain-PAD between T2DM patients and HCs were conducted by Mann-Whitney U test. Finally , Pearson correlation coefficient (r) was calculated between Brain-PAD and duration of disease and cognition . Results: Poor performance in auditory verbal learning test (AVLT)-delayed recall , AVLT-recognition , symbol digital modalities test (SDMT) (P < 0. 05) , and increased Brain-PAD were ob- served in T2DM patients , compared with HCs [1 . 619 ( - 4. 001 , 8. 272) years vs - 1 . 289 ( - 4. 128 , 4. 134) years , Z = 2. 056 , P = 0. 034] . Notably , the median of Brain-PAD in T2DM group was positive , indicating that the brain of T2DM patient maybe relatively “older”than his chronological age . Brain-PAD in T2DM group was as- sociated with performance in AVLT-immediate recall ( r = 0. 291 , P = 0. 003) , AVLT-delayed recall ( r = 0. 248 , P = 0. 011) , SDMT( r = 0. 376 , P = 0. 001) and trail making test (TMT)-A ( r = - 0. 206 , P = 0. 036) . However , the relationships between Brain-PAD and duration of T2DM were not explored . Conclusion Decreased cognitive function in patients with T2DM is demonstrated in this study . The machine learning prediction model based on sMRI supports the identification of brain aging objectively in patients with T2DM .

ObjectiveTo evaluate pharmacological effects of Shengmai injection（SMI）on cerebral ischemia and study its neuroprotective mechanism. MethodsMale specific pathogen-free （SPF） Sprague-Dawley （SD） rats were randomly divided into a sham group， a model group， a low-dose SMI group（3 mL·kg^-1）， a middle-dose SMI group（6 mL·kg^-1）， a high-dose SMI group（12 mL·kg^-1）， and a Ginaton group（4 mL·kg^-1）according to the random number table method， with 12 rats in each group. The rat model of cerebral ischemia-reperfusion（MCAO/R）was prepared via the suture method. The administration groups were intraperitoneally injected with corresponding concentrations of SMI or Ginaton injection after reperfusion， which was conducted for 3 consecutive days. The sham group and model group were administered the equivalent volume of physiological saline. The pharmacological effects of SMI on brain injury in MCAO/R rats were evaluated by neurological function scores， cerebral infarction area， hematoxylin-eosin （HE） staining， Nissl staining， terminal deoxynucleotidyl transferase dUTP nick-end labeling （TUNEL） staining， and Western blot. The dominant link and key protein of SMI treating cerebral injury were explored using proteomic analysis. The related mechanisms of SMI were further validated using enzyme-linked immunosorbent assay （ELISA）， Western blot， and chloride ion fluorescence probe with oxygen-glucose deprivation/reoxygenation（OGD/R）-treated PC12 cells and MCAO/R rats. ResultsCompared with the sham group， the model group showed significantly increased neurological function scores， cerebral infarction area， neuronal apoptosis rate， and expression levels of apoptosis related proteins （P<0.05， P<0.01）and significantly decreased density of Nissl bodies and neurons（P<0.01）. Compared with the model group， the SMI groups exhibited significantly decreased neurological function scores， cerebral infarction area， neuronal apoptosis rate， and expression levels of apoptosis related proteins （P<0.05， P<0.01）and significantly increased density of Nissl bodies and neurons （P<0.05）. The proteomic analysis results showed that oxidative stress and inflammatory response were important processes of SMI intervening in MCAO/R injury， and the chloride intracellular channel protein 1 （CLIC1） was one of key proteins in its action network. The levels of representative indicators of oxidative stress and inflammatory response in the MCAO/R rats of the SMI groups were significantly reduced， compared with those in the model group（P<0.05， P<0.01）， and the expression levels of CLIC1 and downstream NOD-like receptor protein 3 （NLRP3） decreased （P<0.01）. In addition， the experimental results based on the OGD/R PC12 cells showed that SMI significantly increased the cell survival rate（P<0.01） and significantly decreased the intracellular chloride ion concentration（P<0.05）. ConclusionSMI has neuroprotective effects. Oxidative stress and inflammatory response are key processes of SMI intervening in MCAO/R injury. The potential mechanism is closely related to the regulation of CLIC1.

This paper systematically summarizes the practical experience of the 2025 Dingri earthquake emergency medical rescue in Tibet. It analyzes the requirements for earthquake medical rescue under conditions of high-altitude hypoxia, low temperature, and low air pressure. The paper provides a detailed discussion on the strategic layout of earthquake medical rescue at the national level, local government level, and through social participation. It covers the construction of rescue organizational systems, technical systems, material support systems, and information systems. The importance of building rescue teams is emphasized. In high-altitude and cold conditions, rapid response, scientific decision-making, and multi-party collaboration are identified as key elements to enhance rescue efficiency. By optimizing rescue organizational structures, strengthening the development of new equipment, and promoting telemedicine technologies, the precision and effectiveness of medical rescue can be significantly improved, providing important references for future similar disaster rescues.

Objective:To explore the clinical features, histopathological morphology, and differential diagnosis of lymphoepithelioma-like carcinoma with abnormal expression of follicular dendritic cell markers.Methods:From 2020 to 2021, 4 cases of lymphoepithelioma-like carcinoma with abnormal expression of follicular dendritic cell markers diagnosed in Fujian Cancer Hospital (2 cases) and the Second Affiliated Hospital of Fujian Medical University (2 cases) were collected. Different ancillary procedures such as HE, special stains, immunohistochemistry, and in situ hybridization techniques were used to assess the histopathological features and immunophenotypes. The clinical data were collected and literature was reviewed.Results:All 4 cases of lymphoepithelioma-like carcinoma with abnormal expression of follicular dendritic cell markers were male. They were 32, 45, 67 and 39 years old, respectively. The main clinical manifestations were bloody phlegm, abdominal pain, fatigue and anorexia. The clinical stages at diagnosis were stage Ⅳ (3 cases) and stage Ⅱ (1 case). Cases 2 and 3 had two pathological examinations at different sites, with a total of six pathological examinations. The histomorphology showed singly scattered or nests of tumor cells in a background of abundant small lymphocytes. The tumor cells were enlarged and pleomorphic, some appeared polygonal with inconspicuous cell borders, and they were arranged in a syncytial pattern. There were megakaryocytes, multinucleated tumor cells, and a few spindle-shaped cells seen. Atypical mitosis was commonly noted. By immunohistochemistry, the tumor cells were positive for CKpan(5/6), CK8/18(4/4), CAM5.2(2/5), CK-H(0/4), CK-L(3/4), EMA(4/5), CK5/6(3/6), p63(1/6), p40(1/6), E-cadherin (4/6), SSTR2(6/6), PD-L1(5/5), LCA(0/6), vimentin(5/6), CD2 (6/6), CD23(6/6), CD35(5/6), CXCL-13(4/5) and D2-40(1/5). The Ki-67 proliferative index was 60%-95%. In situ hybridization for EBER were all positive (6/6). Special stain for reticulin showed positive staining surrounding nests of tumor cells.Conclusions:The expression of follicular dendritic cell markers in lymphoepithelioma-like carcinoma is very rare, which may be related to EBV infection. Occasionally, it can overlap with follicular dendritic cell sarcoma by morphology and immunophenotype, which can lead to misdiagnosis. Only by combining clinical information, morphological characteristics and immunophenotype can an appropriate diagnosis be made.