1.Chaihu Guizhi Ganjiangtang and Its Single Active Ingredient in Treatment of Dyspepsia Caused by Chronic Cholecystitis: A Review
Wenwen YANG ; Yubei LU ; Lin CHEN ; Jing ZHANG ; Ying GAO ; Yajuan ZHANG ; Xiaoyan LI ; Jianfei YANG ; Xiaoli SHI ; Huanhuan LIN
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(4):289-298
Chaihu Guizhi Ganjiangtang was first recorded in the Treatise on Cold Damage (Shang Han Lun). This prescription is composed of Bupleuri Radix, Scutellariae Radix, Cinnamomi Ramulus, Zingiberis Rhizoma, Trichosanthis Radix, Ostreae Concha, and Glycyrrhizae Radix et Rhizoma. It has the effects of soothing Lesser Yang, warming the spleen, and stimulating the generation of body fluid. It is mainly used to treat digestive tract diseases such as chronic cholecystitis (CC), irritable bowel syndrome, and non-alcoholic fatty liver disease. Dyspepsia caused by CC presents a variety of gastrointestinal symptoms such as abdominal pain, poor appetite, postprandial fullness, aversion to greasy food, soft stool, and bitter mouth, being a type of biliary dyspepsia. In modern medicine, dyspepsia caused by CC is mainly managed by medical treatment and surgical treatment. Internal medicine mainly focuses on reducing inflammation, promoting the function of gallbladder, resolving stones, alleviating spasms, and relieving the pain for CC, demonstrating definite short-term efficacy but suffering from single effects, high recurrence rate, and poor compliance. Although surgical treatment can cure cholecystitis, it is accompanied by the increased incidence of adverse events such as abdominal pain, diarrhea, and dyspepsia. Modern clinical studies have confirmed that Chaihu Guizhi Ganjiangtang can significantly alleviate the symptoms such as abdominal pain and dyspepsia of CC patients. Pharmacological studies have found that Chaihu Guizhi Ganjiangtang mainly contains active ingredients such as Bupleuri Radix saponins, baicalin, cinnamaldehyde, gingerol, Trichosanthis Radix polysaccharide, Ostreae Concha polysaccharide, and Glycyrrhizae Radix et Rhizoma total flavonoids. Chaihu Guizhi Ganjiangtang can ameliorate the symptoms of dyspepsia caused by CC by inhibiting inflammatory responses, improving gallbladder contraction and gastrointestinal motility, regulating the bile acid-intestinal flora axis and the brain-gut axis, and modulating blood lipids through multiple targets. By reviewing the previous literature, this article summarizes the research progress in the treatment of dyspepsia caused by CC with Chaihu Guizhi Ganjiangtang and its main active ingredients as well as the pathogenesis of this disease and puts forward the shortcomings and improvement strategies for the current research. The review aims to provide a reference for the further research on Chaihu Guizhi Ganjiangtang in the treatment of dyspepsia caused by CC.
2.Serologic and molecular biology analysis of a rare Pk phenotype
Huanhuan GAO ; Na ZHANG ; Wei GENG ; Fansheng KONG
Chinese Journal of Blood Transfusion 2025;38(3):426-430
[Objective] To analyze the serological characteristics and molecular biology results for a Pk phenotype. [Methods] One patient with Pk phenotype upon unexpected antibodies at Jining Blood Center in July 2022 was selected as the study subject. The blood groups and unexpected antibodies of the proband and his second son were identified using serological methods. The sequences of 3-β-N-acetylgalactosaminyltransferase gene (B3GALNT1) and the coding region of α-1,4-galactosyltransferase gene (A4GALT) were amplified and analyzed by PCR direct sequencing, and haploid sequence analysis was carried out on the variant sites of the B3GALNT1 gene. PROVEAN, SIFT, PolyPhen2 and Mutation Taster were used to analyze the effect of mutations on the protein. [Results] Serological test results suggested that the proband was a P
3.Analysis of clinical characteristics and etiologies of hospitalized patients with spike-and-wave activation in sleep
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Applied Clinical Pediatrics 2025;40(6):426-433
Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.
4.Experience of ICU nurses in communication with patients under mechanical ventilation:a qualitative study
Rong CHEN ; Zaoqiong GAO ; Jia WAN ; Liu HU ; Ling JIN ; Huanhuan HU
Modern Clinical Nursing 2025;24(4):29-37
Objective To investigate the experience of ICU nurses in communication with the patients under mechanical ventilation,therefore to provide a reference for establishing and improving effective strategies in communication with the patients.Methods Using qualitative research,semi-structured interviews were conducted on 14 ICU nurses in a Tire-IIIA hospital.Data were analysed using Colaizzi's seven-step method to extract themes.Results A total of 4 themes were extracted with 11 sub-themes,they were:emotional stress in non-verbal communication(frustration and feeling of defeat,emotional exhaustion and burnout),difficulty and challenge in ineffective communication(difficulty in establishing an equal and trusting communication quickly,difficulty in accurately understanding communication requirement of patients,and difficulty in achieving effective communication and cooperation),active promotion of effective communication(use of assistive communication tools,actively seek external collaboration,early assessment and prevention of delirium),and enhancement of communication skills and a sense of professional benefit(improvement of professional communication skills and enhancement of cultural communication literacy).Conclusion ICU nurses face various emotional pressures and communication challenges.It is important to actively provide psychological support to the nurses and optimise the communication environment in order to reduce the work stress and enhance the sense of achievement and values.
5.Two cases of developmental and epileptic encephalopathy related to the EEF1A2 gene and a literature review
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Neurology 2025;58(4):404-413
Objective:To investigate the clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene. Methods:The clinical data and whole exome sequencing results of 2 patients who were diagnosed as developmental and epileptic encephalopathy related to the EEF1A2 gene in the Children′s Hospital, Capital Institute of Pediatrics in June 2016 and August 2018 were retrospectively analyzed. Relevant literatures were retrieved using " EEF1A2" and "epileptic encephalopathy" or "epilepsy" as key words in Online Mendelian Inheritance in Man, PubMed, CNKI and Wanfang databases (literatures searching from establishment of these databases to June 2024). The clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene were summarized based on literature reports and the data of these 2 patients. Results:Patient 1 was a 9 months old male infant. He presented with global developmental delay. He developed myoclonic seizures at 4 months old. Valproic acid, clonazepam, topiramate and vagus nerve stimulation were all ineffective. Both of his hands had transverse palmar crease. The de novo c.364G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Patient 2 was a 2 years and 2 months old boy. He presented with global developmental delay. Myoclonic seizures occurred when he was 2 years and 3 months old, and various anti-epileptic drugs were ineffective. He had left eye esotropia and low muscle tone in the extremities. He died at the age of 4. The de novo c.208G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Eight literatures on developmental and epileptic encephalopathy related to the EEF1A2 gene (all in English) were retrieved, reporting 28 cases (totally 30 patients, including 2 cases in this study). The main clinical manifestations were psychomotor developmental delay (30/30, 100.0%), facial dysmorphism (15/30, 50.0%), refractory epilepsy (14/26, 53.8%), myoclonic seizures (19/26, 73.1%), and movement disorders (8/16). A total of 15 mutation sites in the EEF1A2 gene were reported, all of which were missense mutations. Conclusions:Developmental and epileptic encephalopathy related to the EEF1A2 gene is primarily characterized by delayed psychomotor development, distinctive facial features, drug-resistant epilepsy, myoclonic seizures, and movement disorders. Variants in the EEF1A2 gene are predominantly missense mutations, and identifying these variants plays a crucial role in accurate diagnosis of the disease.
6.Research progress and nursing inspiration on the relationship between social activities and cognitive function in older adults
Yuqing HAO ; Huixiu HU ; Yajie ZHAO ; Jie GAO ; Huanhuan LUO ; Chao SUN
Chinese Journal of Nursing 2025;60(2):251-256
With the increasing aging of the population in China,the problem of cognitive decline with age is becoming more prominent,and how to move forward to maintain and improve cognitive function in older adults has become an important research topic.Active participation in social activities has a protective effect on cognitive function in older adults.This paper summarizes the concepts of social activities,relationships with cognitive function,and strategies for promoting interventions.The corresponding nursing inspirations were proposed,aiming to provide new perspectives for improving cognitive function in older adults.
7.Establishment of Fingerprints of Danggui Buxue Granules with Different Drying Processes and Study of the Spectrum-Effect Relationship of Antioxidant Activity
Pan CHEN ; Wufeng GAO ; Zhitong ZHANG ; Huanhuan GUAN ; Lei BAI ; Wenjian LIU ; Li CHEN ; Dongping YUAN ; Guojun YAN
Journal of Nanjing University of Traditional Chinese Medicine 2025;41(9):1213-1223
OBJECTIVE To establish HPLC fingerprints of three drying processes(Atmospheric pressure drying,Decompression drying,Freeze-drying)of Danggui Buxue granules,and combine them with antioxidant tests to determine the optimal drying process and main active components of Danggui Buxue granules.METHODS The fingerprints of multiple batches of Danggui Buxue granules were established by HPLC;the"Fingerprint Similarity Evaluation System of Traditional Chinese Medicine Chromatogram"was used to evaluate the similarity;Hierarchical Cluster Analysis(HCA)and Principal Component Analysis(PCA)were used to characterize the different drying processes of Danggui Buxue granules;evaluate the antioxidant activity of Danggui Buxue granules in different drying processes using 1,1-diphenyl-2-picrylhydrazy(DPPH)and 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)diammonium salt(ABTS)free radical scavenging method;the spectrum-effect relationship between Danggui Buxue granules fingerprint and antioxi-dant activity was analyzed by grey correlation degree and Pearson,Spearman,Kendall's tau-b correlation analysis methods.RE-SULTS The results of fingerprint showed that there were 16 common peaks in 30 batches of Danggui Buxue granules,and 6 of them were identified by comparison.The results of Cluster Analysis and Principal Component Analysis showed that 30 batches of Danggui buxue granules were divided into 3 categories,and the difference between the groups of atmospheric pressure drying was the least.The results of oxidation test showed that different drying processes of Danggui Buxue granules had good antioxidant activity,and the atmos-pheric pressure drying had the lowest IC50 and the strongest antioxidant activity.Finally,combining the results of gray correlation anal-ysis and correlation analysis,the compounds F2,F10,F13(calycosin),F15(formononetin),F16 might be important characteristic peaks reflecting the antioxidant activity of Danggui Buxue granules.CONCLUSION Compared with other drying processes,atmos-pheric pressure drying has higher batch consistency and stronger antioxidant activity,and can be used as the preferred drying process for Danggui Buxue granules,and components 2,10,13,15 and 16 are the main active ingredients for Danggui Buxue granules to exert antioxidant effects.
8.Establishment of Fingerprints of Danggui Buxue Granules with Different Drying Processes and Study of the Spectrum-Effect Relationship of Antioxidant Activity
Pan CHEN ; Wufeng GAO ; Zhitong ZHANG ; Huanhuan GUAN ; Lei BAI ; Wenjian LIU ; Li CHEN ; Dongping YUAN ; Guojun YAN
Journal of Nanjing University of Traditional Chinese Medicine 2025;41(9):1213-1223
OBJECTIVE To establish HPLC fingerprints of three drying processes(Atmospheric pressure drying,Decompression drying,Freeze-drying)of Danggui Buxue granules,and combine them with antioxidant tests to determine the optimal drying process and main active components of Danggui Buxue granules.METHODS The fingerprints of multiple batches of Danggui Buxue granules were established by HPLC;the"Fingerprint Similarity Evaluation System of Traditional Chinese Medicine Chromatogram"was used to evaluate the similarity;Hierarchical Cluster Analysis(HCA)and Principal Component Analysis(PCA)were used to characterize the different drying processes of Danggui Buxue granules;evaluate the antioxidant activity of Danggui Buxue granules in different drying processes using 1,1-diphenyl-2-picrylhydrazy(DPPH)and 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)diammonium salt(ABTS)free radical scavenging method;the spectrum-effect relationship between Danggui Buxue granules fingerprint and antioxi-dant activity was analyzed by grey correlation degree and Pearson,Spearman,Kendall's tau-b correlation analysis methods.RE-SULTS The results of fingerprint showed that there were 16 common peaks in 30 batches of Danggui Buxue granules,and 6 of them were identified by comparison.The results of Cluster Analysis and Principal Component Analysis showed that 30 batches of Danggui buxue granules were divided into 3 categories,and the difference between the groups of atmospheric pressure drying was the least.The results of oxidation test showed that different drying processes of Danggui Buxue granules had good antioxidant activity,and the atmos-pheric pressure drying had the lowest IC50 and the strongest antioxidant activity.Finally,combining the results of gray correlation anal-ysis and correlation analysis,the compounds F2,F10,F13(calycosin),F15(formononetin),F16 might be important characteristic peaks reflecting the antioxidant activity of Danggui Buxue granules.CONCLUSION Compared with other drying processes,atmos-pheric pressure drying has higher batch consistency and stronger antioxidant activity,and can be used as the preferred drying process for Danggui Buxue granules,and components 2,10,13,15 and 16 are the main active ingredients for Danggui Buxue granules to exert antioxidant effects.
9.Experience of ICU nurses in communication with patients under mechanical ventilation:a qualitative study
Rong CHEN ; Zaoqiong GAO ; Jia WAN ; Liu HU ; Ling JIN ; Huanhuan HU
Modern Clinical Nursing 2025;24(4):29-37
Objective To investigate the experience of ICU nurses in communication with the patients under mechanical ventilation,therefore to provide a reference for establishing and improving effective strategies in communication with the patients.Methods Using qualitative research,semi-structured interviews were conducted on 14 ICU nurses in a Tire-IIIA hospital.Data were analysed using Colaizzi's seven-step method to extract themes.Results A total of 4 themes were extracted with 11 sub-themes,they were:emotional stress in non-verbal communication(frustration and feeling of defeat,emotional exhaustion and burnout),difficulty and challenge in ineffective communication(difficulty in establishing an equal and trusting communication quickly,difficulty in accurately understanding communication requirement of patients,and difficulty in achieving effective communication and cooperation),active promotion of effective communication(use of assistive communication tools,actively seek external collaboration,early assessment and prevention of delirium),and enhancement of communication skills and a sense of professional benefit(improvement of professional communication skills and enhancement of cultural communication literacy).Conclusion ICU nurses face various emotional pressures and communication challenges.It is important to actively provide psychological support to the nurses and optimise the communication environment in order to reduce the work stress and enhance the sense of achievement and values.
10.Research progress and nursing inspiration on the relationship between social activities and cognitive function in older adults
Yuqing HAO ; Huixiu HU ; Yajie ZHAO ; Jie GAO ; Huanhuan LUO ; Chao SUN
Chinese Journal of Nursing 2025;60(2):251-256
With the increasing aging of the population in China,the problem of cognitive decline with age is becoming more prominent,and how to move forward to maintain and improve cognitive function in older adults has become an important research topic.Active participation in social activities has a protective effect on cognitive function in older adults.This paper summarizes the concepts of social activities,relationships with cognitive function,and strategies for promoting interventions.The corresponding nursing inspirations were proposed,aiming to provide new perspectives for improving cognitive function in older adults.

Result Analysis
Print
Save
E-mail