Chaihu Guizhi Ganjiangtang was first recorded in the Treatise on Cold Damage （Shang Han Lun）. This prescription is composed of Bupleuri Radix， Scutellariae Radix， Cinnamomi Ramulus， Zingiberis Rhizoma， Trichosanthis Radix， Ostreae Concha， and Glycyrrhizae Radix et Rhizoma. It has the effects of soothing Lesser Yang， warming the spleen， and stimulating the generation of body fluid. It is mainly used to treat digestive tract diseases such as chronic cholecystitis （CC）， irritable bowel syndrome， and non-alcoholic fatty liver disease. Dyspepsia caused by CC presents a variety of gastrointestinal symptoms such as abdominal pain， poor appetite， postprandial fullness， aversion to greasy food， soft stool， and bitter mouth， being a type of biliary dyspepsia. In modern medicine， dyspepsia caused by CC is mainly managed by medical treatment and surgical treatment. Internal medicine mainly focuses on reducing inflammation， promoting the function of gallbladder， resolving stones， alleviating spasms， and relieving the pain for CC， demonstrating definite short-term efficacy but suffering from single effects， high recurrence rate， and poor compliance. Although surgical treatment can cure cholecystitis， it is accompanied by the increased incidence of adverse events such as abdominal pain， diarrhea， and dyspepsia. Modern clinical studies have confirmed that Chaihu Guizhi Ganjiangtang can significantly alleviate the symptoms such as abdominal pain and dyspepsia of CC patients. Pharmacological studies have found that Chaihu Guizhi Ganjiangtang mainly contains active ingredients such as Bupleuri Radix saponins， baicalin， cinnamaldehyde， gingerol， Trichosanthis Radix polysaccharide， Ostreae Concha polysaccharide， and Glycyrrhizae Radix et Rhizoma total flavonoids. Chaihu Guizhi Ganjiangtang can ameliorate the symptoms of dyspepsia caused by CC by inhibiting inflammatory responses， improving gallbladder contraction and gastrointestinal motility， regulating the bile acid-intestinal flora axis and the brain-gut axis， and modulating blood lipids through multiple targets. By reviewing the previous literature， this article summarizes the research progress in the treatment of dyspepsia caused by CC with Chaihu Guizhi Ganjiangtang and its main active ingredients as well as the pathogenesis of this disease and puts forward the shortcomings and improvement strategies for the current research. The review aims to provide a reference for the further research on Chaihu Guizhi Ganjiangtang in the treatment of dyspepsia caused by CC.

OBJECTIVE To evaluate the influence of pharmaceutical quality control on the efficiency and outcomes of standardized medication therapy management （MTM） services for patients with coronary heart disease by using Economic， Clinical and Humanistic Outcomes （ECHO） model. METHODS This study collected case data of coronary heart disease patients who received MTM services during January-March 2023 （pre-quality control implementation group， n＝96） and June-August 2023 （post-quality control implementation group， n＝164）. Using propensity score matching analysis， 80 patients were selected from each group. The study subsequently compared the economic， clinical， and humanistic outcome indicators of pharmaceutical services between the two matched groups. RESULTS There were no statistically significant differences in baseline data between the two groups after matching （P＞0.05）. Compared with pre-quality control implementation group， the daily treatment cost （16.26 yuan vs. 24.40 yuan， P＜0.001）， cost-effectiveness ratio [23.12 yuan/quality-adjusted life year （QALY） vs. 32.32 yuan/QALY， P＜0.001]， and the incidence of general adverse drug reactions （2.50% vs. 10.00%， P＝0.049） of post-quality control implementation group were decreased significantly； the utility value of the EuroQol Five-Dimensional Questionnaire （0.74± 0.06 vs. 0.71±0.07， P＝0.003）， the reduction in the number of medication related problems （1.0 vs. 0.5， P＜0.001）， the medication adherence score （[ 6.32±0.48） points vs. （6.10±0.37） points， P＝0.001]， and the satisfaction score （[ 92.56±1.52） points vs. （91.95±1.56） points， P＝0.013] all showed significant improvements. Neither group experienced serious adverse drug reactions. There was no statistically significant difference in the incidence of new adverse reactions between the two groups （1.25% vs. 3.75%， P＝0.310）. CONCLUSIONS Pharmaceutical quality control can improve the quality of pharmaceutical care， and the ECHO model can quantitatively evaluate the effect of MTM services， making pharmaceutical care better priced and more adaptable to social needs， thus being worthy of promotion.

Objective To analyze the developmental trends and research hotspots of anoikis in cancer research from 2005 to 2024.Methods Relevant literature was retrieved from the Web of Sci-ence Core Collection.Visualization tools including CiteSpace,VOSviewer and SCImago Graphica were employed to analyze publication volume,countries,institutions,authors,journals,keywords and other bibliometric indicators.Results A total of 2,252 articles were included in this study,showing an overall upward trend in publication volume,with a notable increase after 2012.China and the United States ranked highest in terms of publication volume and citation frequency.Representative institutions included Shanghai Jiao Tong University,Chulalongkorn University and MD Anderson Cancer Center,while a representative scholar was CHANVORACHOTE Pithi.The core journal was Oncogene.Keyword and co-citation analyses revealed that research focused on genetic characteristics,cancer treatment,prognostic prediction and metabolic reprogramming,with core terms including"ex-pression""metastasis"and"anoikis".Conclusion Research interest in the field of anoikis contin-ues to rise,with future directions focusing on drug resistance mechanisms,the tumor microenvironment,immunotherapy,signaling pathways and epithelial-mesenchymal transition(EMT).

Objective : To investigate the expression and interaction of activating transcription factor 3(ATF3) and smad family member 4(Smad4) in pterygium. Methods: In this study, two sets of data GSE51995 and GSE2513 in NCBI database were analyzed by bioinformatics methods to screen out the key difference-expressed gene ATF3 in pterygium when normal conjunctiva was used as the control. The differential genes identified by bioinformatics analysis were further detected by reverse transcription quantitative polymerase chain reaction(RT-qPCR). Finally, the literatures were searched and The Gene Transcription Regulation Database(GTRD) was used to predict whether there was a target gene Smad4 that might bind to the target gene. The expression of Smad4 in normal conjunctival and pterygium tissues was verified by RT-qPCR, and the interaction between the target protein ATF3 and Smad4 in the pterygium was investigated through Co-Immunoprecipitation(Co-IP). Results : The results of bioinformatics a- nalysis showed that compared with normal conjunctival tissue , there was significantly different expression of ATF3 gene in pterygium tissue (P < 0. 05) . RT-qPCR confirmed that ATF3 was less expressed in pterygium tissue than normal conjunctival tissue (P < 0. 001) . Genomic data from the GTRD database revealed that Smad4 contains two ATF3 binding motifs , suggesting functional interaction potential . Compared with normal conjunctiva , RT-qPCR re- vealed Smad4 downregulation in pterygium tissues (P < 0. 01) ; Co-IP demonstrated enhanced interaction between Smad4 and ATF3 in pterygium tissues following immunoprecipitation with anti-ATF3 antibodies (P < 0. 05) . Conclusion ATF3 interacts with Smad4 in pterygium , and the low expression of both in pterygium tissues and their in- teraction may be associated with the pathogenesis of pterygium .

Objective:To investigate the clinical experience and efficacy of unrelated umbilical cord blood hematopoietic stem cell transplantation (HSCT) for the treatment of congenital amegakaryocytic thrombocytopenia (CAMT).Methods:A case summary was conducted.The clinical data of 2 children with CAMT who were finally cured by unrelated umbilical cord blood HSCT in the Department of Pediatric Medicine, the First Affiliated Hospital of Zhengzhou University from March 2020 to August 2023 were retrospectively analyzed.Related studies were retrieved from databases CNKI, Wanfang and PubMed using search terms including " congenital amegakaryocytic thrombocytopenia" and " hematopoietic stem cell transplantation" from the inception to July 2024.The clinical characteristics, diagnosis and treatment processes, and prognosis of CAMT patients treated by HSCT were then summarized.Results:Both cases exhibited scattered skin haemorrhages throughout the body and carried 2 compound heterozygous mutations with pathogenicity in the MPL gene.Both patients were finally diagnosed with CAMT.Case 1 was a girl aged 3 at the time of transplantation, and case 2 was also a girl, who aged 5 at the time of transplantation.Both of them received unrelated umbilical cord blood HSCT and hematopoietic reconstruction was achieved.The time of neutrophil and platelet implantation was 21 and 40 days after transplantation in case 1, and 20 and 31 days in case 2, respectively.The chimerism rate of neutrophil implantation in both children was complete chimerism of donor cells.Implantation syndrome was detected in case 1 following transplantation.Case 2 suffered implantation syndrome, hypertensive encephalopathy, and cytomegalovirus infection following transplantation.Both children showed no graft-versus-host disease (GVHD).Both children had hematopoietic and immune reconstruction after transplantation and their primary diseases were cured.Cases 1 and 2 were followed up for more than 14 and 17 months, respectively.Both of them achieved disease-free survival during the follow up.Literature review of 26 cases with CAMT treated by HSCT, including the above-mentioned 2 cases was conducted, with an overall disease-free survival rate of 92.3%(24/26).Of 12 cases with CAMT typing, 10 were type Ⅰ and 2 were type Ⅱ.Of the 26 cases treated by HSCT, 17 had bone marrow HSCT, with an overall survival rate of 88.2%(15/17), and 2 had peripheral blood HSCT.Seven cases had umbilical cord blood HSCT (6 cases receiving unrelated umbilical cord blood HSCT and 1 case receiving related umbilical cord blood HSCT), with an overall survival rate of 100%.Unlike bone marrow and peripheral blood HSCT, unrelated umbilical cord blood HSCT did not result in 3-4 grade GVHD. Conclusions:Unrelated umbilical cord blood HSCT can achieve good therapeutic effects in CAMT patients when there is no suitable donor.Myeloablative pretreatment is conducive to CAMT patients.

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.

Debates persist regarding the efficacy and safety of azvudine, particularly its real-world outcomes. This study involved patients aged ≥60 years who were admitted to 25 hospitals in mainland China with confirmed SARS-CoV-2 infection between December 1, 2022, and February 28, 2023. Efficacy outcomes were all-cause mortality during hospitalization, the proportion of patients discharged with recovery, time to nucleic acid-negative conversion (T _NANC), time to symptom improvement (T _SI), and time of hospital stay (T _HS). Safety was also assessed. Among the 5884 participants identified, 1999 received azvudine, and 1999 matched controls were included after exclusion and propensity score matching. Azvudine recipients exhibited lower all-cause mortality compared with controls in the overall population (13.3% vs. 17.1%, RR, 0.78; 95% CI, 0.67-0.90; P = 0.001) and in the severe subgroup (25.7% vs. 33.7%; RR, 0.76; 95% CI, 0.66-0.88; P < 0.001). A higher proportion of patients discharged with recovery, and a shorter T _NANC were associated with azvudine recipients, especially in the severe subgroup. The incidence of adverse events in azvudine recipients was comparable to that in the control group (2.3% vs. 1.7%, P = 0.170). In conclusion, azvudine showed efficacy and safety in older patients hospitalized with COVID-19 during the SARS-CoV-2 omicron wave in China.

Ulcerative colitis (UC) is an idiopathic, relapsing, and etiologically complicated chronic inflammatory bowel disease. Despite substantial progress in the management of UC, the outcomes of mucosal barrier repair are unsatisfactory. In this study, phillygenin (PHI) treatment alleviated the symptoms of chronic colitis in mice, including body weight loss, severe disease activity index scores, colon shortening, splenomegaly, oxidative stress, and inflammatory response. In particular, PHI treatment ameliorated the tight junction proteins (TJs) reduction, fibrosis, apoptosis, and intestinal stem cell activity, indicating that PHI exerted beneficial effects on the intestinal mucosal barrier in mice with chronic colitis. In the NCM460 cells damage model, dextran sulfate sodium triggered the sequential induction of TJs reduction, fibrosis, and apoptosis. Takeda G protein-coupled receptor-5 (TGR5) dysfunction mediated NCM460 cell injury. Moreover, PHI treatment enhanced TJs and suppressed fibrosis and apoptosis to maintain NCM460 cell function, depending on TGR5 activation. PHI promoted TGR5 activation and elevated intracellular cyclic adenosine monophosphate levels in HEK 293T cells transfected with TGR5 expression plasmids. Cellular thermal shift assay and molecular docking studies confirmed that PHI directly binds to TGR5, indicating that PHI is an agonist of TGR5. The process of PERK-eIF2α pathway-mediated endoplasmic reticulum Ca²⁺ release was involved in NCM460 cell injury as well, which was associated with TGR5 dysfunction. When NCM460 cells were pretreated with PHI, the PERK-eIF2α pathway and elevated Ca²⁺ levels were blocked. In conclusion, our study demonstrated a novel mechanism that PHI inhibited the PERK-eIF2α-Ca²⁺ pathway through TGR5 activation to against DSS-induced TJs reduction, fibrosis, and apoptosis.

OBJECTIVE: To investigate the predictive value of oxygenation index (PaO₂/FiO₂) at intensive care unit (ICU) admission on 30-day mortality in patients with sepsis. METHODS: A retrospective study was conducted. Patients with sepsis who were hospitalized in the ICU of the Affiliated Hospital of Jining Medical University from April 2015 to October 2023 were enrolled. The demographic information, comorbidities, sites of infection, vital signs and laboratory test indicators at the time of admission to the ICU, disease severity scores within 24 hours of admission to the ICU, treatment process and prognostic indicators were collected. According to the PaO₂/FiO₂ at ICU admission, patients were divided into Q1 group (PaO₂/FiO₂ of 4.1-16.4 cmHg, 1 cmHg ≈ 1.33 kPa), Q2 group (PaO₂/FiO₂ of 16.5-22.6 cmHg), Q3 group (PaO₂/FiO₂ of 22.7-32.9 cmHg), and Q4 group (PaO₂/FiO₂ of 33.0-94.8 cmHg). Differences in the indicators across the four groups were compared. Multifactorial Cox regression analysis was used to assess the relationship between PaO₂/FiO₂ and 30-day mortality of patients with sepsis. The predictive value of PaO₂/FiO₂, sequential organ failure assessment (SOFA) and acute physiology and chronic health evaluation II (APACHE II) on 30-day prognosis of patients with sepsis was analyzed by receiver operator characteristic curve (ROC curve). RESULTS: A total of 1 711 patients with sepsis were enrolled, including 428 patients in Q1 group, 424 patients in Q2 group, 425 patients in Q3 group, and 434 patients in Q4 group. 622 patients died at 30-day, the overall 30-day mortality was 36.35%. There were statistically significant differences in age, body mass index (BMI), history of smoking, history of alcohol consumption, admission heart rate, respiratory rate, APACHE II score, SOFA score, Glasgow coma score (GCS), site of infection, Combined chronic obstructive pulmonary disease (COPD), blood lactic acid (Lac), prothrombin time (PT), albumin (Alb), total bilirubin (TBil), pH, proportion of mechanical ventilation, duration of mechanical ventilation, proportion of vasoactive medication used, and maximal concentration, length of ICU stay, hospital stay, incidence of acute kidney injury, in-hospital mortality, 30-day mortality among the four groups. Multivariate Cox regression analysis showed that after adjusting for confounding factors, for every 1 cmHg increase in PaO₂/FiO₂ at ICU admission, the 30-day mortality risk decreased by 2% [hazard ratio (HR) = 0.98, 95% confidence interval (95%CI) was 0.98-0.99, P < 0.001]. The 30-day mortality risk in the Q4 group was reduced compared with the Q1 group by 41% (HR = 0.59, 95%CI was 0.46-0.76, P < 0.001). The fitted curve showed that a curvilinear relationship between PaO₂/FiO₂ and 30-day mortality after adjustment for confounders. In the inflection point analysis, for every 1 cmHg increase in PaO₂/FiO₂ at PaO₂/FiO₂ < 28.55 cmHg, the risk of 30-day death in sepsis patients was reduced by 5% (HR = 0.95, 95%CI was 0.94-0.97, P < 0.001); when PaO₂/FiO₂ ≥ 28.55 cmHg, there was no statistically significant association between PaO2/FiO2 and the increase in the risk of 30-day death in sepsis (HR = 1.01, 95%CI was 0.99-1.02, P = 0.512). ROC curve analysis showed that the area under the curve (AUC) for the prediction of 30-day mortality by admission PaO₂/FiO₂ in ICU sepsis patients was 0.650, which was lower than the predictive ability of the SOFA score (AUC = 0.698) and APACHE II score (AUC = 0.723). CONCLUSION In patients with sepsis, PaO₂/FiO₂ at ICU admission is strongly associated with 30-day mortality risk, alerting healthcare professionals to pay attention to patients with low PaO₂/FiO₂ for timely interventions.
Humans ; Sepsis/mortality* ; Intensive Care Units ; Retrospective Studies ; Prognosis ; Hospital Mortality ; Oxygen ; Male ; Predictive Value of Tests ; Female ; Middle Aged ; Aged

OBJECTIVE: To explore the clinical features of the sepsis in immunocompromised hosts and establish an early warning equation. METHODS: A retrospective study was conducted on sepsis patients admitted to the intensive care unit (ICU) of Binzhou Medical University Hospital from October 2011 to October 2022. General information, infection site, etiology results and drug susceptibility, clinical symptoms, inflammatory indicators, acute physiology and chronic health status evaluation II (APACHE II), sequential organ failure assessment (SOFA), incidence of immune paralysis, and outcome during hospitalization were collected. Based on whether they met the diagnostic criteria for immunocompromised hosts, patients were divided into immunocompromised group and immune normal group. The clinical information of the two groups were compared. Multivariate Logistic regression was used to analyze the risk factors of patients with immunocompromised sepsis and the regression equation model was initially established. Omnibus test and Hosmer-Lemeshow test were used to evaluate the model. RESULTS: A total of 169 patients with sepsis were included, including 61 in the immunocompromised group and 108 in the normal immune group. The top 3 infection sites in the immunocompromised group were bloodstream infection, pulmonary infection and abdominal infection. The top 3 infection sites in the normal immune group were pulmonary infection, bloodstream infection and abdominal infection. The infection rate of Gram-negative bacteria in the immunocompromised group was significantly lower than that in the normal group [49.2% (30/61) vs. 64.8% (70/108), P < 0.05]. The infection rate of Gram-positive bacteria [27.9% (17/61) vs. 13.9% (15/108)] and multidrug-resistant bacteria [54.1% (33/61) vs. 29.6% (32/108)] were significantly higher than those in normal immune group (both P < 0.05). In terms of clinical symptoms, the proportion of fever in the immunocompromised group was significantly lower than that in the immune normal group [49.2% (30/61) vs. 66.7% (72/108), P < 0.05]. Neutrophil count (NEU) and neutrophil percentage (NEU%) in the immunocompromised group were significantly lower than those in the normal immune group. Lymphocyte percentage (LYM%), neutrophil/lymphocyte ratio (NLR), C-reactive protein (CRP), procalcitonin (PCT), APACHE II score, combined shock rate, incidence of immune paralysis, and mortality during hospitalization in the immunocompromised group were significantly higher than those in the normal immune group. Logistic regression analysis showed that NLR, CRP and PCT were risk factors for patients with immunocompromised sepsis (all P < 0.05). The above indicators were used as covariables to construct a Logistic regression equation, that was, Logit (P) = 0.025X₁+0.010X₂+0.013X₃-2.945, where X₁, X₂ and X₃ represent NLR, CRP and PCT respectively. Omnibus test and Hosmer-Lemeshow test show that the model fits well and has certain early warning value. CONCLUSIONS Patients with immunocompromised sepsis have more intense inflammatory response, with Gram-negative bacteria being the predominant pathogen, and a higher incidence of Gram-positive bacterial infections and multi-drug resistant infections. The severity of the disease, in-hospital mortality, the incidence of shock and the incidence of immune paralysis after sepsis were significantly higher. NLR, CRP and PCT were independent risk factors for sepsis in immunocompromised hosts. The regression equation constructed based on this may have early warning significance for patients with immunocompromised sepsis.
Humans ; Sepsis/immunology* ; Immunocompromised Host ; Retrospective Studies ; Risk Factors ; Intensive Care Units ; Logistic Models ; Male ; APACHE ; Female ; Middle Aged ; Aged