1.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.
2.Progress of cross-linking mass spectrometry based on liquid chromatography-mass spectrometry technology in the research of protein-protein interactions
Maolin WANG ; Yan LIU ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(6):793-802
Cross-linking mass spectrometry (XL-MS) technology has become a key tool for identifying protein-protein interactions (PPIs) and revealing the protein structures in living cells, tissues, or organelles. The XL-MS technology has demonstrated remarkable superiority compared with conventional methods for studying PPIs and protein structures. In the past few years, new cross-linker structures have been arising continuously. They have not only broadened the range of cross-linking reactions but also provided additional methods for the enrichment of cross-linking peptides. Moreover, owing to the advancement of computer software and artificial intelligence, cross - linking data search engines and visualization software have also been enhancing the speed and accuracy of cross-linking peptide identification. The evolution of cross-linkers and cross-linking peptide search engines has promoted the application of the XL-MS technology in the research on protein-protein interactions (PPIs) within organelles and even living cells and in the analysis of protein structures.
3.Quality Control and Analysis of Treatment for Hospitalized Cancer Patients: Interview and Medical Records Study from Nine Hospitals in Beijing
Liting LU ; Yanping ZHOU ; Xiang WANG ; Xiaoyuan LI ; Xiaorong HOU ; Lidong ZHU ; Xiaohong XU ; Guibin SUN ; Ziyuan WANG ; Jieshi ZHANG ; Lin ZHAO ; Yi BA
Medical Journal of Peking Union Medical College Hospital 2024;16(2):399-405
To analyze the current quality of treatment for hospitalized cancer patients in Beijing, identify major issues in treatment practices, and propose improvements. Nine hospitals in Beijing were selected for examination. Expert on-site interviews and medical record sampling were conducted. The "Beijing Cancer Diagnosis and Treatment Quality Control Checklist" was used to assess the hardware, management, anti-cancer drug therapy, radiation therapy, and surgical treatment during cancer treatment at these hospitals from January to October 2023. The relevant problems were analyzed. Among the nine hospitals, two (22.2%) were equipped with laminar flow rooms, and three (33.3%) had intravenous drug preparation centers. In terms of institutional management, seven hospitals (77.8%) had standardized anti-cancer drug prescription authority management, eight (88.9%) had complete emergency plans, and five (55.6%) had oncology specialist pharmacists. Regarding anti-cancer drug therapy, the areas with higher completion rates included pathology diagnosis support (97.6%), routine pre-treatment examinations (96.3%), adverse reaction evaluation(92.7%), discharge summaries (95.1%), and admission records (91.5%). However, the accuracy of tumor staging before treatment (70.7%) and the evaluation of therapeutic efficacy after drug treatment (76.9%) needed improvement. The oncology specialty significantly outperformed the non-oncology specialty in terms of the accuracy rate of TNM staging (86.0% There remains significant room for improvement in the quality of cancer treatment in China. It is recommended to standardize tumor staging assessment processes, strengthen entry assessments for non-oncology departments, promote the implementation of multidisciplinary treatment models, and establish a multi-department collaborative management model.Continuous monitoring of cancer diagnosis and treatment quality indicators is essential to promote ongoing improvements in cancer treatment quality.
4.The methodological framework of surgical innovation: the introduction of IDEAL framework and recommendation
Jiajie YU ; Fei SHAN ; McCulloch Peter ; Hirst Allison ; Jiankun HU ; Xin SUN ; Youping LI ; Lunxu LIU ; Xuemei LIU ; Lianguo DONG ; Jimei CHEN ; Guibin QIAO ; Hecheng LI
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2021;28(02):131-136
Surgical innovation is an important part of surgical research and practice. The evaluation of surgical innovation through the stages is similar to those for drug development, but with important differences. The Idea, Development, Exploration, Assessment, and Long-term follow-up (IDEAL) Framework and Recommendations represent a new paradigm for the evaluation of surgical intervention and devices which was developed in 2009. The IDEAL is a five-stage framework involving the nature stages of surgical innovation, together with recommendations for surgical research pathway. The Framework and Recommendations were updated and published in 2019, which added a pre-IDEAL stage if necessary. The updated IDEAL also underlines the purpose, key question and ethical issues for each stage. In the first paper of IDEAL Framework and Recommendations series, we conducted a comprehensive introduction of IDEAL (e.g. the development, updates and application of IDEAL) to promote the dissemination and application of IDEAL in China.
5.The methodological framework of surgical innovation: The interpretation of IDEAL reporting guideline
Jiajie YU ; Hirst Allison ; McCulloch Peter ; Fei SHAN ; Jiankun HU ; Xin SUN ; Lunxu LIU ; Xuemei LIU ; Nianguo DONG ; Jimei CHEN ; Guibin QIAO ; Hecheng LI ; Hao LIU ; Youping LI
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2021;28(03):263-270
Adherence to reporting guidelines contributes to report methodology and outcomes of research distinctly and transparently. There are some checklists with specific study types related to surgery on the EQUATOR Network’s website. However, the IDEAL framework focuses on stepwise evaluation of surgical innovation through all stages with some key elements, which those existing guidelines may not mention. This likely results in the inaccuracy in reporting in studies attempting to follow the IDEAL recommendations and suggests a pressing need for IDEAL reporting guidelines. Considering these limitations, the IDEAL developed the IDEAL reporting guidelines between October 2018 and May 2019. The paper aimed to provide interpretation of IDEAL reporting guideline, and promote its understanding and use among Chinese researchers.
6.Continuous prone position ventilation in patients with severe acute respiratory distress syndrome at high altitude
Jinhai HAN ; Siqing MA ; Bin SUN ; Hao WANG ; Xiaolin SUN ; Guibin JIA
Chinese Critical Care Medicine 2021;33(2):161-164
Objective:To investigate the therapeutic effect of different prone position ventilation (PPV) on patients with severe acute respiratory distress syndrome (ARDS) at high altitude.Methods:The severe ARDS patients who met the Berlin standard admitted to the department of intensive care unit (ICU) of Qinghai Provincial People's Hospital from January 2017 to January 2020 were enrolled. The patients with classic PPV treatment (i.e. alternate prone supine position, about 16 hours per day) were included in the discontinuous PPV group; the patients with modified PPV treatment (i.e. alternate left and right prone positions 20°-30°, every 4 hours and continuous treatment for 24 hours per day) were included in the continuous PPV group. The oxygenation index (PaO 2/FiO 2), mechanics of breathing, ventilator parameters before treatment and 72 hours after treatment, and mechanical ventilation time, the length of ICU stay, and related complications between the two groups were analyzed. Results:Eighteen cases were treated with continuous PPV and 20 cases were treated with discontinuous PPV. There were no significant differences in gender, age, acute physiology and chronic health evaluation Ⅱ (APACHEⅡ), PaO 2/FiO 2, lung compliance, driving pressure (ΔP) and positive end expiratory pressure (PEEP) before treatment between the two groups. Compared with before treatment, PaO 2/FiO 2 in discontinuous PPV group and continuous PPV group was increased significantly after 72-hour treatment [mmHg (1 mmHg = 0.133 kPa): 99.7±15.4 vs. 55.5±6.3, 121.8±25.3 vs. 55.1±7.1, both P < 0.05], lung compliance was improved significantly (mL/cmH 2O: 36.8±2.4 vs. 28.0±2.0, 43.4±6.7 vs. 27.7±2.1, both P < 0.05), and ΔP was decreased significantly [cmH 2O (1 cmH 2O = 0.098 kPa): 10.5 (10.0, 12.0) vs. 13.0 (12.3, 14.0), 10.0 (8.0, 12.0) vs. 13.0 (12.0, 14.0), both P < 0.05], PEEP was also decreased [cmH 2O: 12 (12, 14) vs. 14 (13, 14), 10 (8, 10) vs. 14 (12, 15), both P < 0.05], and the indexes in continuous PPV group were improved more significantly than those in discontinuous PPV group [PaO 2/FiO 2 (mmHg): 121.8±25.3 vs. 99.7±15.4, lung compliance (mL/cmH 2O): 43.4±6.7 vs. 36.8±2.4, ΔP (cmH 2O): 10.0 (8.0, 12.0) vs. 10.5 (10.0, 12.0), PEEP (cmH 2O): 10 (8, 10) vs. 12 (12, 14), all P < 0.05]. The duration of mechanical ventilation and the length of ICU stay in the continuous PPV group were significantly shorter than those in the intermittent PPV group [days: 6.0 (5.0, 7.3) vs. 8.0 (7.0, 9.0), 9.7±1.5 vs. 12.1±2.2, both P < 0.01]. During the PPV treatment, there were 3 cases of cheek skin damage and 2 cases of ear skin damage in the continuous PPV group, and 3 cases of facial skin damage in the intermittent PPV group. There was no significant difference in the incidence of complications between the two groups ( χ2 = 0.321, P = 0.571). All patients were repaired normally after PPV, without adverse consequences. Conclusion:Continuous PPV is more effective than discontinuous PPV in the treatment of severe ARDS patients at high altitude, and the related complications are did not increased in prolonged time of PPV.
7.Recurrent laryngeal nerve inlet zone lymph node metastasis in papillary thyroid cancer
Guibin ZHENG ; Haiqing SUN ; Guochang WU ; Chi MA ; Guojun ZHANG ; Yawen GUO ; Huanjie CHEN ; Xiangfeng LIN ; Shujian WEI ; Hui ZHAO ; Xicheng SONG ; Haitao ZHENG
Chinese Journal of General Surgery 2020;35(9):709-712
Objective:To explore the clinical significance of recurrent laryngeal nerve inlet zone(RLNIZ) lymph node metastasis in papillary thyroid cancer(PTC).Methods:The clinical data of the clinicopathologic characteristics of 738 cases with papillary thyroid cancer at our centers from Jul 2017 to Jun 2018 was retrospectively reviewed. 108 cases with RLNIZ lymph node dissection for pathological examination were included. The relationship between metastasis of RLNIZ lymph node and clinicopathologic characteristics was analyzed.Results:RLNIZ lymph node was detected in 12.3%(91/738)cases, the mean lymph node number in RLNIZ was 1.5±0.7, and 30.8%(28/91) cases suffered RLNIZ lymph node metastasis. RLNIZ lymph node metastasis(LNM) is associated with tumor size( P=0.028), capsular invasion( P=0.019), No. of central compartment LNM( P<0.001) and lateral neck LNM( P<0.001). No. of central compartment LNM was found to be the independent risk factor of RLNIZ lymph node metastasis. The incidence of dysphagia and inferior parathyroid damage was 0.9%(1/108)respectively. Conclusions:RLNIZ lymph node metastasis is common among PTC patients , therefore, RLNIZ lymph node should be routinely removed especially in patients with tumor size over 1cm、suspected capsular invasion and lateral neck lymph node metastasis confirmed by preoperative imaging examination.
8.Epitranscriptomic 5-Methylcytosine Profile in PM2.5-induced Mouse Pulmonary Fibrosis
Han XIAO ; Liu HANCHEN ; Zhang ZEZHONG ; Yang WENLAN ; Wu CHUNYAN ; Liu XUEYING ; Zhang FANG ; Sun BAOFA ; Zhao YONGLIANG ; Jiang GUIBIN ; Yang YUN-GUI ; Ding WENJUN
Genomics, Proteomics & Bioinformatics 2020;18(1):41-51
Exposure of airborne particulate matter (PM) with an aerodynamic diameter less than 2.5 lm (PM2.5) is epidemiologically associated with lung dysfunction and respiratory symptoms, including pulmonary fibrosis. However, whether epigenetic mechanisms are involved in PM2.5-induced pulmonary fibrosis is currently poorly understood. Herein, using a PM2.5-induced pulmonary fibrosis mouse model, we found that PM2.5 exposure leads to aberrant mRNA 5-methylcytosine (m5C) gain and loss in fibrotic lung tissues. Moreover, we showed the m5C-mediated regulatory map of gene functions in pulmonary fibrosis after PM2.5 exposure. Several genes act as m5C gain-upregulated factors, probably critical for the development of PM2.5-induced fibrosis in mouse lungs. These genes, including Lcn2, Mmp9, Chi3l1, Adipoq, Atp5j2, Atp5l, Atpif1, Ndufb6, Fgr, Slc11a1, and Tyrobp, are highly related to oxidative stress response, inflammatory responses, and immune system processes. Our study illustrates the first epitranscrip-tomic RNA m5C profile in PM2.5-induced pulmonary fibrosis and will be valuable in identifying biomarkers for PM2.5 exposure-related lung pathogenesis with translational potential.
9.The expression and clinical significance of miR-143-3p in papillary thyroid cancer
Guibin ZHENG ; Shujian WEI ; Guochang WU ; Chi MA ; Haiqing SUN ; Huanjie CHEN ; Xiangfeng LIN ; Hui ZHAO ; Haitao ZHENG
Chinese Journal of Endocrine Surgery 2020;14(1):28-31
Objective:To explore the expression and clinical significance of miR-143 in papillary thyroid cancer (PTC) .Methods:Tumor samples and adjacent tissues from 52 patients with PTC were obtained from Jan. 1st, 2018 to Mar. 31st, 2018 in Thyroid Surgery Department of the Affiliated Yantai Yuhuangding Hospital of Qingdao University. Quantitative reverse-transcriptase PCR (RT-qPCR) was used to measure the expression of miR-143 in those subjects. In addition, the relationship between the expression levels of miR-143 and the clinicopathological characteristics was analyzed.Results:RT-qPCR indicated that the expression of miR-143 was down-regulated in PTC, which was significantly lower than that in adjacent tissues ( t=-21.39, 95% CI: 18.20-15.07, P<0.001) . Low expression of miR-143 was related to the number of lymph node metastasis ≥3 in central compartment ( t=10.13, P=0.012) and lateral neck lymph node metastasis ( t=-4.67, P<0.001) . Conclusion:Downregulation of miR-143 in PTC is linked to the metastasis of PTC and may be a potential target for therapeutic intervention.

Result Analysis
Print
Save
E-mail