1.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.
2.Progress of cross-linking mass spectrometry based on liquid chromatography-mass spectrometry technology in the research of protein-protein interactions
Maolin WANG ; Yan LIU ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(6):793-802
Cross-linking mass spectrometry (XL-MS) technology has become a key tool for identifying protein-protein interactions (PPIs) and revealing the protein structures in living cells, tissues, or organelles. The XL-MS technology has demonstrated remarkable superiority compared with conventional methods for studying PPIs and protein structures. In the past few years, new cross-linker structures have been arising continuously. They have not only broadened the range of cross-linking reactions but also provided additional methods for the enrichment of cross-linking peptides. Moreover, owing to the advancement of computer software and artificial intelligence, cross - linking data search engines and visualization software have also been enhancing the speed and accuracy of cross-linking peptide identification. The evolution of cross-linkers and cross-linking peptide search engines has promoted the application of the XL-MS technology in the research on protein-protein interactions (PPIs) within organelles and even living cells and in the analysis of protein structures.
3.The application law of Moutan Cortex in Synopsis of the Golden Chamber
Chuanlong ZHANG ; Fudong LIU ; Guibin WANG ; Bo PANG ; Baojin HUA
International Journal of Traditional Chinese Medicine 2023;45(2):136-140
We aimed to study the articles and applied prescriptions of Moutan Cortex in Synopsis of theGolden Chamber, summarize and analyze its laws on the disease location and disease nature, and analyze its compatibility, dosage and processing laws. Based on the knowledge of Moutan Cortex by Zhongjing, we found that the kidney, bladder, uterus and intestine involved in Zhongjing's application of peony bark prescription, which belongs to the disease of "lower abdomen" in Huangdi Nei Jing. And the prescription of Moutan Cortex mainly focused on the syndromes of "depression" and "blood stasis", which are characterised by five kinds: water depression, dampness depression, stasis-heat, blood stasis and ecchymosis. and the compatibility rule of Zhongjing application of Moutan Cortex is analyzed accordingly. In addition, the study found that as the downward movement of the disease position, the amount of Moutan Cortex increased, and the processing of the problem followed the principle of "if disease is slow onset, the Moutan Cortex heart should be removed, but if disease is acute, Moutan Cortex heart should be kept". Finally, we combined modern clinical application of Moutan Cortex with modern pharmacological research, in order to expand the scope of clinical application of Moutan Cortex and "the same treatment of different diseases" to provide theoretical guidance.
4.Efficacy and safety for robotic bronchoscope in biopsy of pulmonary nodules: A systematic review and meta-analysis
Chao GUO ; Jiaqi ZHANG ; Zhen LI ; Guibin BIAN ; Lei LIU ; Shanqing LI
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2023;30(02):226-232
Objective To systematically review the clinical utilization of robotic bronchoscopes in diagnosis of pulmonary nodules, including MonarchTM and IonTM platforms, and then evaluate the efficacy and safety of the procedure. Methods PubMed, EMbase, Web of Science and Cochrane Central Register of Controlled Trials databases were searched by computer for literature about the biopsy of pulmonary nodules with robotic bronchoscope from January 2018 to February 14, 2022. The quality of research was evaluated with Newcastle-Ottawa Scale. RevMan 5.4 software was used to conduct the meta-analysis. Results Finally, 19 clinical studies with 1 542 patients and 1 697 targeted pulmonary nodules were included, of which 13 studies used the IonTM platform and 6 studies used the MonarchTM platform. The overall diagnostic rate of the two systems was 84.96% (95%CI 62.00%-95.00%), sensitivity for malignancy was 81.79%(95%CI 43.00%-96.00%), the mean maximum diameter of the nodules was 16.22 mm (95%CI 10.98-21.47), the mean procedure time was 61.86 min (95%CI 46.18-77.54) and the rate of complications occurred was 4.76% (95%CI 2.00%-15.00%). There was no statistical difference in the outcomes between the two systems. Conclusion Robotic bronchoscope provides a high efficacy and safety in biopsy of pulmonary nodules, and has a broad application prospect for pulmonary nodules diagnosis.
5.Chinese expert consensus on diagnosis, treatment and prevention of venous thrombus embolism associated with chest trauma (2022 version)
Kaibin LIU ; Yi YANG ; Hui LI ; Yonten TSRING ; Zhiming CHEN ; Hao CHEN ; Xinglong FAN ; Congrong GAO ; Chundong GU ; Yutong GU ; Guangwei GUO ; Zhanlin GUO ; Jian HU ; Ping HU ; Hai HUANG ; Lijun HUANG ; Weiwei HE ; Longyu JIN ; Baoli JING ; Zhigang LIANG ; Feng LIN ; Wenpan LIU ; Danqing LI ; Xiaoliang LI ; Zhenyu LI ; Haitao MA ; Guibin QIAO ; Zheng RUAN ; Gang SUI ; Dongbin WANG ; Mingsong WANG ; Lei XUE ; Fei XIA ; Enwu XU ; Quan XU ; Jun YI ; Yunfeng YI ; Jianguo ZHANG ; Dongsheng ZHANG ; Qiang ZHANG ; Zhiming ZHOU ; Zhiqiang ZOU
Chinese Journal of Trauma 2022;38(7):581-591
Chest trauma is one of the most common injuries. Venous thromboembolism (VTE) as a common complication of chest trauma seriously affects the quality of patients′ life and even leads to death. Although there are some consensus and guidelines on the prevention and treatment of VTE at home and abroad, the current literatures lack specificity considering the diagnosis, treatment and prevention of VTE in patients with chest trauma have their own characteristics, especially for those with blunt trauma. Accordingly, China Chest Injury Research Society and editorial board of Chinese Journal of Traumatology organized relevant domestic experts to jointly formulate the Chinese expert consensus on the diagnosis, treatment and prevention of chest trauma venous thromboembolism associated with chest trauma (2022 version). This consensus provides expert recommendations of different levels as academic guidance in terms of the characteristics, clinical manifestations, risk assessment, diagnosis, treatment, and prevention of chest trauma-related VTE, so as to offer a reference for clinical application.
6.The methodological framework of surgical innovation: the introduction of IDEAL framework and recommendation
Jiajie YU ; Fei SHAN ; McCulloch Peter ; Hirst Allison ; Jiankun HU ; Xin SUN ; Youping LI ; Lunxu LIU ; Xuemei LIU ; Lianguo DONG ; Jimei CHEN ; Guibin QIAO ; Hecheng LI
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2021;28(02):131-136
Surgical innovation is an important part of surgical research and practice. The evaluation of surgical innovation through the stages is similar to those for drug development, but with important differences. The Idea, Development, Exploration, Assessment, and Long-term follow-up (IDEAL) Framework and Recommendations represent a new paradigm for the evaluation of surgical intervention and devices which was developed in 2009. The IDEAL is a five-stage framework involving the nature stages of surgical innovation, together with recommendations for surgical research pathway. The Framework and Recommendations were updated and published in 2019, which added a pre-IDEAL stage if necessary. The updated IDEAL also underlines the purpose, key question and ethical issues for each stage. In the first paper of IDEAL Framework and Recommendations series, we conducted a comprehensive introduction of IDEAL (e.g. the development, updates and application of IDEAL) to promote the dissemination and application of IDEAL in China.
7.The methodological framework of surgical innovation: The interpretation of IDEAL reporting guideline
Jiajie YU ; Hirst Allison ; McCulloch Peter ; Fei SHAN ; Jiankun HU ; Xin SUN ; Lunxu LIU ; Xuemei LIU ; Nianguo DONG ; Jimei CHEN ; Guibin QIAO ; Hecheng LI ; Hao LIU ; Youping LI
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2021;28(03):263-270
Adherence to reporting guidelines contributes to report methodology and outcomes of research distinctly and transparently. There are some checklists with specific study types related to surgery on the EQUATOR Network’s website. However, the IDEAL framework focuses on stepwise evaluation of surgical innovation through all stages with some key elements, which those existing guidelines may not mention. This likely results in the inaccuracy in reporting in studies attempting to follow the IDEAL recommendations and suggests a pressing need for IDEAL reporting guidelines. Considering these limitations, the IDEAL developed the IDEAL reporting guidelines between October 2018 and May 2019. The paper aimed to provide interpretation of IDEAL reporting guideline, and promote its understanding and use among Chinese researchers.
8.Follow-up ultrasonographic examinations on gallbladder polyps and to identify their risk factors of formation
Guibin YAO ; Liwei LIU ; Xuesong BAI ; Zhen ZHOU ; Yue HUANG ; Yamin ZHENG
Chinese Journal of Hepatobiliary Surgery 2020;26(8):606-610
Objective:To study the occurrence and disappearance of gallbladder polyps in patients who underwent multiple ultrasonographic examinations, and to determine the risk factors of formation of gallbladder polyps.Methods:From January 2014 to December 2017, relevant data on patients who underwent follow-up abdominal ultrasound examinations at the Health Screening Center of Xuanwu Hospital was retrospectively analyzed, and the dynamic changes of gallbladder polyps were assessed. A comparative analysis was then conducted between those who had gallbladder polyps (the gallbladder polyps group, n=1 149) and those who had no gallbladder polyps (the control group, n=18 243). The occurrence, changes and disappearance of gallbladder polyps shown on multiple untrasonographic examinations were compared. Results:The patterns of changes of gallbladder polyps showed that the proportions of patients with gallbladder polyps which were stable in size ( n=1 149, 52.1%) were greater than those who had new appearance of gallbladder polyps ( n=797, 36.2%), and these 2 groups of patients were having higher proportions than those who had disappearance of gallbladder polyps ( n=258, 11.7%). The largest proportion of gallbladder polyps were found in middle-aged people, and new polyps were mainly found in the age group of 30.0-59.0 years. The peak of gallbladder polyps incidence was after age 60. There were significant differences in age, male, blood glucose, total cholesterol, low density lipoprotein (LDL), and diastolic blood pressure between the study and the control groups (all P<0.05). Multivariate analysis showed that age ( OR=1.152), male ( OR=1.407) and LDL ( OR=1.656) were independent risk factors of gallbladder polyp formation. Conclusions:The annual incidence of gallbladder polyps was 9.7‰. Gallbladder polyps were more commonly found in middle age, and the incidence of gallbladder polyps was increasing. Gallbladder polyps could disappear. However, with increase in initial diameter of gallbladder polyps, the probability of disappearance decreased. Age, male gender and elevated LDL were independent risk factors of gallbladder polyps formation.
9.Retrospective study on treatment of intrathoracic fistula after esophageal cancer surgery
Shaohui ZHOU ; Yongbin SONG ; Wenhao WANG ; Shaohui HAN ; Guibin ZHANG ; Lijun LIU
Chinese Journal of Thoracic and Cardiovascular Surgery 2020;36(11):690-693
Objective:By comparing the clinical outcome of the modified triple tube method and the traditional three-tube method in the treatment of thoracic internal fistula after esophageal cancer surgery, in order to provide a basis for the clinical treatment of thoracic fistula after esophageal cancer surgery.Methods:The traditional three-tube method for the treatment of thoracic fistula after esophageal cancer surgery was the traditional group, and the modified three-tube method was the modified group. There was no spillover of the contrast agent during the above gastrointestinal angiography and the patient could eat normally as the standard of cure. In this study, we collected the data of thoracic fistula patients after esophageal cancer surgery who were treated with two kinds of treatment methods in our hospital in different time period(the traditional group: 10 patients from February 2008 to June 2014; the modified group: 36 patients from January 2012 to December 2019). Retrospective analysis of the two groups of patients in terms of general data(sex, age, etiology and other factors), time to cure and other indicators, compare the pros and cons of these two methods in the treatment of postoperative thoracic fistula.Results:There was no significant difference in general data such as sex, age, and cure time between the two groups, but there was significant difference in the cure time( P<0.01). The average cure time of the modified group was(38.08±11.97) days, which was significantly better than that of the traditional group(95.60 ± 7.79) days. Conclusion:Compared with the traditional three-tube method, the modified three-tube method can significantly shorten the treatment time when treating patients with thoracic fistula after esophageal cancer surgery.
10.Epitranscriptomic 5-Methylcytosine Profile in PM2.5-induced Mouse Pulmonary Fibrosis
Han XIAO ; Liu HANCHEN ; Zhang ZEZHONG ; Yang WENLAN ; Wu CHUNYAN ; Liu XUEYING ; Zhang FANG ; Sun BAOFA ; Zhao YONGLIANG ; Jiang GUIBIN ; Yang YUN-GUI ; Ding WENJUN
Genomics, Proteomics & Bioinformatics 2020;18(1):41-51
Exposure of airborne particulate matter (PM) with an aerodynamic diameter less than 2.5 lm (PM2.5) is epidemiologically associated with lung dysfunction and respiratory symptoms, including pulmonary fibrosis. However, whether epigenetic mechanisms are involved in PM2.5-induced pulmonary fibrosis is currently poorly understood. Herein, using a PM2.5-induced pulmonary fibrosis mouse model, we found that PM2.5 exposure leads to aberrant mRNA 5-methylcytosine (m5C) gain and loss in fibrotic lung tissues. Moreover, we showed the m5C-mediated regulatory map of gene functions in pulmonary fibrosis after PM2.5 exposure. Several genes act as m5C gain-upregulated factors, probably critical for the development of PM2.5-induced fibrosis in mouse lungs. These genes, including Lcn2, Mmp9, Chi3l1, Adipoq, Atp5j2, Atp5l, Atpif1, Ndufb6, Fgr, Slc11a1, and Tyrobp, are highly related to oxidative stress response, inflammatory responses, and immune system processes. Our study illustrates the first epitranscrip-tomic RNA m5C profile in PM2.5-induced pulmonary fibrosis and will be valuable in identifying biomarkers for PM2.5 exposure-related lung pathogenesis with translational potential.

Result Analysis
Print
Save
E-mail