As the core carrier of the inheritance and innovation of traditional Chinese medicine （TCM）， the modern expanded application of classic formulae is an inevitable trend for TCM to adapt to the changes in disease spectrum and achieve academic development. However， several challenges remain， including the vague definition of syndrome-formula ontology between ancient and modern times， the insufficient adaptability of the evidence grading system， and the disconnection between theory and clinical practice， having severely restricted the precise application and standardized development of classic formulae. Based on the current status of the modern expanded application of classic formulae， and grounded in the core theory of formula-syndrome correspondence in TCM， this paper constructs a theoretical framework of "syndrome-formula ontology reconstruction". The framework systematically expounds its core connotations， theoretical foundations and practical logic， and further clarifies the reconstruction direction of the TCM-specific evidence grading system by taking correspondence between formula and syndrome as the core， constructing a multi-dimensional and integrated evaluation framework， and adhering to the orientation of clinical application. The ultimate goal is to form a theoretical paradigm characterized by "syndrome-formula ontology reconstruction-evidence grading reconstruction-precise clinical application"， thereby providing theoretical support for the digital inheritance， evidence-based development， and modern application of classical prescriptions.

Cross-linking mass spectrometry (XL-MS) technology has become a key tool for identifying protein-protein interactions (PPIs) and revealing the protein structures in living cells, tissues, or organelles. The XL-MS technology has demonstrated remarkable superiority compared with conventional methods for studying PPIs and protein structures. In the past few years, new cross-linker structures have been arising continuously. They have not only broadened the range of cross-linking reactions but also provided additional methods for the enrichment of cross-linking peptides. Moreover, owing to the advancement of computer software and artificial intelligence, cross - linking data search engines and visualization software have also been enhancing the speed and accuracy of cross-linking peptide identification. The evolution of cross-linkers and cross-linking peptide search engines has promoted the application of the XL-MS technology in the research on protein-protein interactions (PPIs) within organelles and even living cells and in the analysis of protein structures.

Objectives:To investigate the physical growth status of pediatric patients with transfusion-dependent thalassemia (TDT) and analyze the effects of treatment-related and socioeconomic factors on physical growth.Methods:Based on the specialized thalassemia database from gene therapy clinical research at the Institute of Hematology & Hospital of Blood Diseases, Chinese Academy of Medical Sciences & Peking Union Medical College, we collected data on height and weight development, family economic status, and medical records of 338 pediatric patients with TDT from October 2023 to May 2024. The length/height-for-age and body mass index (BMI) -for-age were classified based on the Growth Standard for Children under 7 Years of Age, Standard for Height Level Classification among Children and Adolescents Aged 7-18 Years, and Dietary Guidelines for Chinese Residents. Logistic regression analysis was conducted to assess the effects of family economic status and disease-related treatment on length/height-for-age and BMI-for-age.Results:Among the 338 patients, 118 were children and 220 were adolescents (192 males and 146 females), with a median age of 12 years (range: 0.8-18) and a median diagnosis duration of 10.3 years (range: 0.5-17.9). Subtypes included α-thalassemia [21 cases (6.2%) ], β-thalassemia [288 cases (85.2%) ], and combined αβ-thalassemia[29 cases (8.6%) ]. The monthly household income of patients was concentrated in 3 000-5 000 yuan (39.9%) and 5 001-10 000 yuan (34.9%), whereas 67.2% of the families had monthly medical expenses of <3 000 yuan. Of the patients, 75.5% received their first transfusion before 1 year of age. The proportions of children and adolescents with pretransfusion hemoglobin (HGB) of ≤70 g/L were 4.2% and 6.4%, respectively. Adolescents demonstrated significantly higher rates of transfusion frequency of <4 weeks/session, monthly red blood cell infusion of >2 U, serum ferritin (SF) of ≥5 000 μg/L, iron chelation therapy, and splenectomy compared with children (all P<0.05). Of the 338 patients, 26.0%, 22.8%, and 8.9% demonstrated stunted growth, underweight, and concurrent stunted growth with underweight, respectively. No significant difference was observed in the stunted growth rates between children (22.9%) and adolescents (27.7%) ( P=0.402). However, the underweight rate in adolescents (26.8%) was significantly higher than that in children (15.3%) ( P=0.023). The multivariate analysis determined the following risk factors for stunted growth: monthly household income of <10 000 yuan (5 001-10 000 yuan: OR=5.49, 95% CI: 1.48-35.76; 3 000-5 000 yuan: OR=6.87, 95% CI: 1.88-44.60; <3 000 yuan: OR=9.29, 95% CI: 2.20-64.77), pretransfusion HGB of ≤70 g/L ( OR=3.25, 95% CI: 1.07-10.18), and SF of ≥5 000 μg/L ( OR = 3.04, 95% CI: 1.20-7.70). Longer diagnostic duration was associated with underweight ( OR=1.10, 95% CI: 1.01-1.20) . Conclusions:Children and adolescents with TDT with pretransfusion SF of ≥5 000 μg/L, HGB of ≤70 g/L, low monthly household income, or longer diagnosis duration were significantly more likely to experience delayed physical growth.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Objectives:To investigate the physical growth status of pediatric patients with transfusion-dependent thalassemia (TDT) and analyze the effects of treatment-related and socioeconomic factors on physical growth.Methods:Based on the specialized thalassemia database from gene therapy clinical research at the Institute of Hematology & Hospital of Blood Diseases, Chinese Academy of Medical Sciences & Peking Union Medical College, we collected data on height and weight development, family economic status, and medical records of 338 pediatric patients with TDT from October 2023 to May 2024. The length/height-for-age and body mass index (BMI) -for-age were classified based on the Growth Standard for Children under 7 Years of Age, Standard for Height Level Classification among Children and Adolescents Aged 7-18 Years, and Dietary Guidelines for Chinese Residents. Logistic regression analysis was conducted to assess the effects of family economic status and disease-related treatment on length/height-for-age and BMI-for-age.Results:Among the 338 patients, 118 were children and 220 were adolescents (192 males and 146 females), with a median age of 12 years (range: 0.8-18) and a median diagnosis duration of 10.3 years (range: 0.5-17.9). Subtypes included α-thalassemia [21 cases (6.2%) ], β-thalassemia [288 cases (85.2%) ], and combined αβ-thalassemia[29 cases (8.6%) ]. The monthly household income of patients was concentrated in 3 000-5 000 yuan (39.9%) and 5 001-10 000 yuan (34.9%), whereas 67.2% of the families had monthly medical expenses of <3 000 yuan. Of the patients, 75.5% received their first transfusion before 1 year of age. The proportions of children and adolescents with pretransfusion hemoglobin (HGB) of ≤70 g/L were 4.2% and 6.4%, respectively. Adolescents demonstrated significantly higher rates of transfusion frequency of <4 weeks/session, monthly red blood cell infusion of >2 U, serum ferritin (SF) of ≥5 000 μg/L, iron chelation therapy, and splenectomy compared with children (all P<0.05). Of the 338 patients, 26.0%, 22.8%, and 8.9% demonstrated stunted growth, underweight, and concurrent stunted growth with underweight, respectively. No significant difference was observed in the stunted growth rates between children (22.9%) and adolescents (27.7%) ( P=0.402). However, the underweight rate in adolescents (26.8%) was significantly higher than that in children (15.3%) ( P=0.023). The multivariate analysis determined the following risk factors for stunted growth: monthly household income of <10 000 yuan (5 001-10 000 yuan: OR=5.49, 95% CI: 1.48-35.76; 3 000-5 000 yuan: OR=6.87, 95% CI: 1.88-44.60; <3 000 yuan: OR=9.29, 95% CI: 2.20-64.77), pretransfusion HGB of ≤70 g/L ( OR=3.25, 95% CI: 1.07-10.18), and SF of ≥5 000 μg/L ( OR = 3.04, 95% CI: 1.20-7.70). Longer diagnostic duration was associated with underweight ( OR=1.10, 95% CI: 1.01-1.20) . Conclusions:Children and adolescents with TDT with pretransfusion SF of ≥5 000 μg/L, HGB of ≤70 g/L, low monthly household income, or longer diagnosis duration were significantly more likely to experience delayed physical growth.

Objective    To systematically review the clinical utilization of robotic bronchoscopes in diagnosis of pulmonary nodules, including MonarchTM and IonTM platforms, and then evaluate the efficacy and safety of the procedure. Methods    PubMed, EMbase, Web of Science and Cochrane Central Register of Controlled Trials databases were searched by computer for literature about the biopsy of pulmonary nodules with robotic bronchoscope from January 2018 to February 14, 2022. The quality of research was evaluated with Newcastle-Ottawa Scale. RevMan 5.4 software was used to conduct the meta-analysis. Results    Finally, 19 clinical studies with 1 542 patients and 1 697 targeted pulmonary nodules were included, of which 13 studies used the IonTM platform and 6 studies used the MonarchTM platform. The overall diagnostic rate of the two systems was 84.96% (95%CI 62.00%-95.00%), sensitivity for malignancy was 81.79%(95%CI 43.00%-96.00%), the mean maximum diameter of the nodules was 16.22 mm (95%CI 10.98-21.47), the mean procedure time was 61.86 min (95%CI 46.18-77.54) and the rate of complications occurred was 4.76% (95%CI 2.00%-15.00%). There was no statistical difference in the outcomes between the two systems. Conclusion     Robotic bronchoscope provides a high efficacy and safety in biopsy of pulmonary nodules, and has a broad application prospect for pulmonary nodules diagnosis.

We aimed to study the articles and applied prescriptions of Moutan Cortex in Synopsis of theGolden Chamber, summarize and analyze its laws on the disease location and disease nature, and analyze its compatibility, dosage and processing laws. Based on the knowledge of Moutan Cortex by Zhongjing, we found that the kidney, bladder, uterus and intestine involved in Zhongjing's application of peony bark prescription, which belongs to the disease of "lower abdomen" in Huangdi Nei Jing. And the prescription of Moutan Cortex mainly focused on the syndromes of "depression" and "blood stasis", which are characterised by five kinds: water depression, dampness depression, stasis-heat, blood stasis and ecchymosis. and the compatibility rule of Zhongjing application of Moutan Cortex is analyzed accordingly. In addition, the study found that as the downward movement of the disease position, the amount of Moutan Cortex increased, and the processing of the problem followed the principle of "if disease is slow onset, the Moutan Cortex heart should be removed, but if disease is acute, Moutan Cortex heart should be kept". Finally, we combined modern clinical application of Moutan Cortex with modern pharmacological research, in order to expand the scope of clinical application of Moutan Cortex and "the same treatment of different diseases" to provide theoretical guidance.

Chest trauma is one of the most common injuries. Venous thromboembolism (VTE) as a common complication of chest trauma seriously affects the quality of patients′ life and even leads to death. Although there are some consensus and guidelines on the prevention and treatment of VTE at home and abroad, the current literatures lack specificity considering the diagnosis, treatment and prevention of VTE in patients with chest trauma have their own characteristics, especially for those with blunt trauma. Accordingly, China Chest Injury Research Society and editorial board of Chinese Journal of Traumatology organized relevant domestic experts to jointly formulate the Chinese expert consensus on the diagnosis, treatment and prevention of chest trauma venous thromboembolism associated with chest trauma (2022 version). This consensus provides expert recommendations of different levels as academic guidance in terms of the characteristics, clinical manifestations, risk assessment, diagnosis, treatment, and prevention of chest trauma-related VTE, so as to offer a reference for clinical application.

Surgical innovation is an important part of surgical research and practice. The evaluation of surgical innovation through the stages is similar to those for drug development, but with important differences. The Idea, Development, Exploration, Assessment, and Long-term follow-up (IDEAL) Framework and Recommendations represent a new paradigm for the evaluation of surgical intervention and devices which was developed in 2009. The IDEAL is a five-stage framework involving the nature stages of surgical innovation, together with recommendations for surgical research pathway. The Framework and Recommendations were updated and published in 2019, which added a pre-IDEAL stage if necessary. The updated IDEAL also underlines the purpose, key question and ethical issues for each stage. In the first paper of IDEAL Framework and Recommendations series, we conducted a comprehensive introduction of IDEAL (e.g. the development, updates and application of IDEAL) to promote the dissemination and application of IDEAL in China.

Adherence to reporting guidelines contributes to report methodology and outcomes of research distinctly and transparently. There are some checklists with specific study types related to surgery on the EQUATOR Network’s website. However, the IDEAL framework focuses on stepwise evaluation of surgical innovation through all stages with some key elements, which those existing guidelines may not mention. This likely results in the inaccuracy in reporting in studies attempting to follow the IDEAL recommendations and suggests a pressing need for IDEAL reporting guidelines. Considering these limitations, the IDEAL developed the IDEAL reporting guidelines between October 2018 and May 2019. The paper aimed to provide interpretation of IDEAL reporting guideline, and promote its understanding and use among Chinese researchers.