With the continuous deepening of the concept of precision diagnosis and treatment for lung cancer, how to achieve higher efficiency and accuracy in the screening, diagnosis, and treatment pathways in clinical practice has become an important issue that urgently needs to be overcome. The current clinical difficulty lies in the fact that despite continuous advancements in imaging and molecular diagnostic technologies, there are still limitations in manual efficiency and subjective experience when it comes to massive data analysis and multi-scale feature extraction. Artificial intelligence (AI), especially algorithm systems based on deep learning, is an innovative technology capable of deeply empowering medical big data. This method utilizes algorithms such as convolutional neural networks, combined with radiomics, pathomics, and multi-modal data fusion analysis, demonstrating immense potential in early precise detection and benign-malignant differentiation of pulmonary nodules, digital pathological subtype recognition and non-invasive prediction of driver genes, precise 3D surgical planning and automatic delineation of radiotherapy target volumes, as well as dynamic risk warning during follow-up. This innovative technology provides a brand-new solution for realizing intelligent and individualized lung cancer diagnosis and treatment models. This consensus, based on the latest evidence from evidence-based medicine and combined with the development trends in the AI field and real-world clinical needs, was ultimately formed by gathering the consensus opinions of multidisciplinary experts in radiology, pathology, thoracic surgery, and other fields. The main content covers the application specifications of AI in the three core scenarios of lung cancer screening, diagnosis, and treatment, the technical standards for data collection and algorithm validation, as well as the ethical and regulatory challenges faced at the current stage. It aims to clarify the applicable boundaries of AI as a clinical auxiliary decision support tool, providing scientific guidance and standardized exploration directions for peers currently engaged in or planning to carry out AI-assisted clinical diagnosis, treatment, and translation of lung cancer.

This paper summarizes professor LIN Yi's clinical experience in treating brain metastases of triple-negative breast cancer （TNBC）. It is believed that the pathogenesis of this disease is fundamentally based on spleen and lung qi deficiency， with the binding of phlegm， stasis， and toxins acting as the critical link for disease progression， and qi stagnation serving as a major factor in its protracted course. The core therapeutic principle of "consolidating the root and cultivating the origin， resolving phlegm and dredging collaterals" is proposed. Clinically， the disease is staged into active， stable， and convalescent phases. During the active phase， characterized by spleen and lung qi deficiency alongside hyperactivity of phlegm-toxin pathogens， the treatment focuses on supplementing qi， fortifying the spleen， resolving phlegm， and dredging collaterals， utilizing the Yiqi Jiangtan Tongluo Formula （益气降痰通络方）. During the stable phase， marked by spleen deficiency， weak qi， and residual phlegm， stasis， and toxins lingering in the collaterals， the treatment aims to fortify spleen， cultivate the origin， expel pathogens， and dredge collaterals， using modified Baihua Qiling Formula （白花芪苓方）. During the convalescent phase， characterized by depletion of healthy qi， dysfunction of zang-fu （脏腑） organs， and deep-seated residual phlegm， stasis， and toxins within the brain collaterals， the treatment focuses on regulating qi movement， protecting body fluids， and applying constitution-based treatments， mostly using mild and nourishing medicinals.

This paper summarizes professor LIN Yi's clinical experience in treating brain metastases of triple-negative breast cancer （TNBC）. It is believed that the pathogenesis of this disease is fundamentally based on spleen and lung qi deficiency， with the binding of phlegm， stasis， and toxins acting as the critical link for disease progression， and qi stagnation serving as a major factor in its protracted course. The core therapeutic principle of "consolidating the root and cultivating the origin， resolving phlegm and dredging collaterals" is proposed. Clinically， the disease is staged into active， stable， and convalescent phases. During the active phase， characterized by spleen and lung qi deficiency alongside hyperactivity of phlegm-toxin pathogens， the treatment focuses on supplementing qi， fortifying the spleen， resolving phlegm， and dredging collaterals， utilizing the Yiqi Jiangtan Tongluo Formula （益气降痰通络方）. During the stable phase， marked by spleen deficiency， weak qi， and residual phlegm， stasis， and toxins lingering in the collaterals， the treatment aims to fortify spleen， cultivate the origin， expel pathogens， and dredge collaterals， using modified Baihua Qiling Formula （白花芪苓方）. During the convalescent phase， characterized by depletion of healthy qi， dysfunction of zang-fu （脏腑） organs， and deep-seated residual phlegm， stasis， and toxins within the brain collaterals， the treatment focuses on regulating qi movement， protecting body fluids， and applying constitution-based treatments， mostly using mild and nourishing medicinals.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

In view of the difficulties and blind spots of western medicine, how to make scientific decisions to standardize the treatment of breast cancer in traditional Chinese medicine and improve the participation of traditional Chinese medicine in the treatment of breast cancer is an important focus of innovative breakthroughs in breast cancer treatment. Based on the clinical experience of Professor LIN Yi, a master of traditional Chinese medicine, and on the basis of "disease identification and syndrome differentiation", this paper summarizes and refines the status of qi and blood imbalance, accumulation of phlegm and blood stasis, viscera deficiency, and cold heat cementation in breast cancer, and further proposes the "six views" of breast cancer balanced treatment: the pathogenesis view focuses on "evil invasion due to vital qi deficiency, and the proliferation of tumors", and the pathogenesis view focuses on "cancer toxin and imbalance of yin and yang", the diagnostic view focuses on "examining the underlying factors and understanding the causes and effects", the differentiation view focuses on "balancing qi, blood, yin, and yang to achieve harmony", the therapeutic view focuses on "supporting vital qi and eliminating evil, and considering the root cause and syndromes", and the rehabilitation view focuses on "adjusting balance to maintain a stable state". We are committed to holistic syndrome differentiation and treatment, balancing yin, yang, qi, and blood, thereby harmonizing the internal environment of the human body, and mobilizing the immune and rehabilitation functions of the body.

Objective    To systematically review the clinical utilization of robotic bronchoscopes in diagnosis of pulmonary nodules, including MonarchTM and IonTM platforms, and then evaluate the efficacy and safety of the procedure. Methods    PubMed, EMbase, Web of Science and Cochrane Central Register of Controlled Trials databases were searched by computer for literature about the biopsy of pulmonary nodules with robotic bronchoscope from January 2018 to February 14, 2022. The quality of research was evaluated with Newcastle-Ottawa Scale. RevMan 5.4 software was used to conduct the meta-analysis. Results    Finally, 19 clinical studies with 1 542 patients and 1 697 targeted pulmonary nodules were included, of which 13 studies used the IonTM platform and 6 studies used the MonarchTM platform. The overall diagnostic rate of the two systems was 84.96% (95%CI 62.00%-95.00%), sensitivity for malignancy was 81.79%(95%CI 43.00%-96.00%), the mean maximum diameter of the nodules was 16.22 mm (95%CI 10.98-21.47), the mean procedure time was 61.86 min (95%CI 46.18-77.54) and the rate of complications occurred was 4.76% (95%CI 2.00%-15.00%). There was no statistical difference in the outcomes between the two systems. Conclusion     Robotic bronchoscope provides a high efficacy and safety in biopsy of pulmonary nodules, and has a broad application prospect for pulmonary nodules diagnosis.

Chest trauma is one of the most common injuries. Venous thromboembolism (VTE) as a common complication of chest trauma seriously affects the quality of patients′ life and even leads to death. Although there are some consensus and guidelines on the prevention and treatment of VTE at home and abroad, the current literatures lack specificity considering the diagnosis, treatment and prevention of VTE in patients with chest trauma have their own characteristics, especially for those with blunt trauma. Accordingly, China Chest Injury Research Society and editorial board of Chinese Journal of Traumatology organized relevant domestic experts to jointly formulate the Chinese expert consensus on the diagnosis, treatment and prevention of chest trauma venous thromboembolism associated with chest trauma (2022 version). This consensus provides expert recommendations of different levels as academic guidance in terms of the characteristics, clinical manifestations, risk assessment, diagnosis, treatment, and prevention of chest trauma-related VTE, so as to offer a reference for clinical application.

Objective:To explore the clinical significance of recurrent laryngeal nerve inlet zone(RLNIZ) lymph node metastasis in papillary thyroid cancer(PTC).Methods:The clinical data of the clinicopathologic characteristics of 738 cases with papillary thyroid cancer at our centers from Jul 2017 to Jun 2018 was retrospectively reviewed. 108 cases with RLNIZ lymph node dissection for pathological examination were included. The relationship between metastasis of RLNIZ lymph node and clinicopathologic characteristics was analyzed.Results:RLNIZ lymph node was detected in 12.3%(91/738)cases, the mean lymph node number in RLNIZ was 1.5±0.7, and 30.8%(28/91) cases suffered RLNIZ lymph node metastasis. RLNIZ lymph node metastasis(LNM) is associated with tumor size( P=0.028), capsular invasion( P=0.019), No. of central compartment LNM( P<0.001) and lateral neck LNM( P<0.001). No. of central compartment LNM was found to be the independent risk factor of RLNIZ lymph node metastasis. The incidence of dysphagia and inferior parathyroid damage was 0.9%(1/108)respectively. Conclusions:RLNIZ lymph node metastasis is common among PTC patients , therefore, RLNIZ lymph node should be routinely removed especially in patients with tumor size over 1cm、suspected capsular invasion and lateral neck lymph node metastasis confirmed by preoperative imaging examination.

Objective To investigate the imaging features of alar ligament and its extent, and provide the basis forclinical treatment.Methods 3.0 T superconducting MRI was used to scan the alar ligament with high resolution PDWI sequence (Proton density weighted imaging, PDWI)in 109 patients of emergency admissions due to head and neck trauma. Based on imaging features, ligamentous injury was classified into three degrees(Ⅰ to Ⅲ degrees).Patients with Ⅰ degree ligamentous injury were treated conservatively, andⅡtoⅢdegree injury patients were treated with surgery, then follow-up was performed with MRI for the recovery of ligaments and clinical evaluation for symptoms (6 months follow-up period). Results High-resolution PDWI showed 78 patients with no ligament injury.On follow-up, patients recovered well (atlantoaxial joint motor function and clinical symptoms). Thirty one patients had alar ligament injury in varying degrees, of which 18 patients had grade Ⅰ injury, nine patients had degree Ⅱinjury, and four patients had degreeⅢinjury .All gradeⅠinjury patients received conservative treatment. Follow-up of patients showed good recovery, MR revealed the lesions shrank in varying degrees or disappear.
Six gradeⅡinjury patients had surgical treatment, and three received conservative treatment. On follow-up, seven patients had a good recovery, two patients underwent surgical treatment within 3 months after injury and recovered well.Three gradeⅢpatients treated by surgery, and all with good recovery postoperative, and a patient died of respiratory failure. Conclusions High resolution PDWI is an effective tool to evaluate the extent of the alar ligament injury. Grade Ⅰ ligamentous injury patients treated conservatively can achieve good results, GradeⅡandⅢligamentous injury patients should receive surgical treatment early.

Objective Kangfuling granules can be used for the treatment of radiation damage , but its quality criteria has not been established .This paper aimed to establish the quality criteria of Kangfuling granules to control its quality . Methods Radix as-tragali and Radix angelicae sinensis in the formula both were identified qualitatively by TLC .The content of astragaloside IV was exam-ined by HPLC:Agilent Zorbax Extend-C18 (4.6 mm ×250 mm, 5μm) was used as the chromatographic column .The mobile phase was consisted of acetonitrile-water (32:68) with a flow rate at 1.0 mL/min.The evaporative light scattering detector was used to detect the compound.The content of astragaloside IV and ferulaic acid was examined by HPLC: Agilent Zorbax SB-C18 (4.6 mm ×250 mm, 5 μm) was used as the chromatographic column .The mobile phase was consisted of acetonitrile-0.085% phosphoric acid water (17:83) with a flow rate at 1.0 mL/min.The wave length was 320 nm and column temperature was set at 35℃. Results The same color spot was shown in the chromatogram of the test sample and the control sample in the corresponding position with no interference of negative control.The linear range for Astragaloside IV 0.030 6 mg/mL~0.612 0 mg/mL with R2 =0.999.The RSD of stability test was 2.17%.The RSD of precision test was 1.89%.The RSD of re-peatability test was 1.58%.The average recovery was 101.26%. The linear range for ferulaic acid 0.24-4.80 μg/mL with R2 =0.999.The RSD of stability test was 1.37%.The RSD of precision test was 0.83%.The RSD of repeatability test was 1.14%.The average recovery was 98.39%.This product was tentatively calculat-ed according to the dry matter , the amount of Astragaloside IV and ferulaic acid should not be less than 0.19 mg/g and 0.08 mg/g, re-spectively. Conclusion In this study, the established TLC was used for the qualitative identification of Kangfuling granules , and the content of Astragaloside IV and ferulaic acid was not less than 0.19 mg and 0.08 mg in per gram of Kangfuling granules , respectively. The established standard is suitable for the quality control of Kangfuling granules .