1.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.
2.Concept and strategy of traditional Chinese medicine balanced treatment of breast cancer from the perspective of "pathogenesis and state identification"
Guibin WANG ; Honglin SITU ; Li GUO ; Zhuobin WEN ; Hanguang JING ; Yi LIN
Journal of Beijing University of Traditional Chinese Medicine 2024;47(3):440-444
In view of the difficulties and blind spots of western medicine, how to make scientific decisions to standardize the treatment of breast cancer in traditional Chinese medicine and improve the participation of traditional Chinese medicine in the treatment of breast cancer is an important focus of innovative breakthroughs in breast cancer treatment. Based on the clinical experience of Professor LIN Yi, a master of traditional Chinese medicine, and on the basis of "disease identification and syndrome differentiation", this paper summarizes and refines the status of qi and blood imbalance, accumulation of phlegm and blood stasis, viscera deficiency, and cold heat cementation in breast cancer, and further proposes the "six views" of breast cancer balanced treatment: the pathogenesis view focuses on "evil invasion due to vital qi deficiency, and the proliferation of tumors", and the pathogenesis view focuses on "cancer toxin and imbalance of yin and yang", the diagnostic view focuses on "examining the underlying factors and understanding the causes and effects", the differentiation view focuses on "balancing qi, blood, yin, and yang to achieve harmony", the therapeutic view focuses on "supporting vital qi and eliminating evil, and considering the root cause and syndromes", and the rehabilitation view focuses on "adjusting balance to maintain a stable state". We are committed to holistic syndrome differentiation and treatment, balancing yin, yang, qi, and blood, thereby harmonizing the internal environment of the human body, and mobilizing the immune and rehabilitation functions of the body.
3.Efficacy and safety for robotic bronchoscope in biopsy of pulmonary nodules: A systematic review and meta-analysis
Chao GUO ; Jiaqi ZHANG ; Zhen LI ; Guibin BIAN ; Lei LIU ; Shanqing LI
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2023;30(02):226-232
Objective To systematically review the clinical utilization of robotic bronchoscopes in diagnosis of pulmonary nodules, including MonarchTM and IonTM platforms, and then evaluate the efficacy and safety of the procedure. Methods PubMed, EMbase, Web of Science and Cochrane Central Register of Controlled Trials databases were searched by computer for literature about the biopsy of pulmonary nodules with robotic bronchoscope from January 2018 to February 14, 2022. The quality of research was evaluated with Newcastle-Ottawa Scale. RevMan 5.4 software was used to conduct the meta-analysis. Results Finally, 19 clinical studies with 1 542 patients and 1 697 targeted pulmonary nodules were included, of which 13 studies used the IonTM platform and 6 studies used the MonarchTM platform. The overall diagnostic rate of the two systems was 84.96% (95%CI 62.00%-95.00%), sensitivity for malignancy was 81.79%(95%CI 43.00%-96.00%), the mean maximum diameter of the nodules was 16.22 mm (95%CI 10.98-21.47), the mean procedure time was 61.86 min (95%CI 46.18-77.54) and the rate of complications occurred was 4.76% (95%CI 2.00%-15.00%). There was no statistical difference in the outcomes between the two systems. Conclusion Robotic bronchoscope provides a high efficacy and safety in biopsy of pulmonary nodules, and has a broad application prospect for pulmonary nodules diagnosis.
4.Chinese expert consensus on diagnosis, treatment and prevention of venous thrombus embolism associated with chest trauma (2022 version)
Kaibin LIU ; Yi YANG ; Hui LI ; Yonten TSRING ; Zhiming CHEN ; Hao CHEN ; Xinglong FAN ; Congrong GAO ; Chundong GU ; Yutong GU ; Guangwei GUO ; Zhanlin GUO ; Jian HU ; Ping HU ; Hai HUANG ; Lijun HUANG ; Weiwei HE ; Longyu JIN ; Baoli JING ; Zhigang LIANG ; Feng LIN ; Wenpan LIU ; Danqing LI ; Xiaoliang LI ; Zhenyu LI ; Haitao MA ; Guibin QIAO ; Zheng RUAN ; Gang SUI ; Dongbin WANG ; Mingsong WANG ; Lei XUE ; Fei XIA ; Enwu XU ; Quan XU ; Jun YI ; Yunfeng YI ; Jianguo ZHANG ; Dongsheng ZHANG ; Qiang ZHANG ; Zhiming ZHOU ; Zhiqiang ZOU
Chinese Journal of Trauma 2022;38(7):581-591
Chest trauma is one of the most common injuries. Venous thromboembolism (VTE) as a common complication of chest trauma seriously affects the quality of patients′ life and even leads to death. Although there are some consensus and guidelines on the prevention and treatment of VTE at home and abroad, the current literatures lack specificity considering the diagnosis, treatment and prevention of VTE in patients with chest trauma have their own characteristics, especially for those with blunt trauma. Accordingly, China Chest Injury Research Society and editorial board of Chinese Journal of Traumatology organized relevant domestic experts to jointly formulate the Chinese expert consensus on the diagnosis, treatment and prevention of chest trauma venous thromboembolism associated with chest trauma (2022 version). This consensus provides expert recommendations of different levels as academic guidance in terms of the characteristics, clinical manifestations, risk assessment, diagnosis, treatment, and prevention of chest trauma-related VTE, so as to offer a reference for clinical application.
5.Recurrent laryngeal nerve inlet zone lymph node metastasis in papillary thyroid cancer
Guibin ZHENG ; Haiqing SUN ; Guochang WU ; Chi MA ; Guojun ZHANG ; Yawen GUO ; Huanjie CHEN ; Xiangfeng LIN ; Shujian WEI ; Hui ZHAO ; Xicheng SONG ; Haitao ZHENG
Chinese Journal of General Surgery 2020;35(9):709-712
Objective:To explore the clinical significance of recurrent laryngeal nerve inlet zone(RLNIZ) lymph node metastasis in papillary thyroid cancer(PTC).Methods:The clinical data of the clinicopathologic characteristics of 738 cases with papillary thyroid cancer at our centers from Jul 2017 to Jun 2018 was retrospectively reviewed. 108 cases with RLNIZ lymph node dissection for pathological examination were included. The relationship between metastasis of RLNIZ lymph node and clinicopathologic characteristics was analyzed.Results:RLNIZ lymph node was detected in 12.3%(91/738)cases, the mean lymph node number in RLNIZ was 1.5±0.7, and 30.8%(28/91) cases suffered RLNIZ lymph node metastasis. RLNIZ lymph node metastasis(LNM) is associated with tumor size( P=0.028), capsular invasion( P=0.019), No. of central compartment LNM( P<0.001) and lateral neck LNM( P<0.001). No. of central compartment LNM was found to be the independent risk factor of RLNIZ lymph node metastasis. The incidence of dysphagia and inferior parathyroid damage was 0.9%(1/108)respectively. Conclusions:RLNIZ lymph node metastasis is common among PTC patients , therefore, RLNIZ lymph node should be routinely removed especially in patients with tumor size over 1cm、suspected capsular invasion and lateral neck lymph node metastasis confirmed by preoperative imaging examination.
6.Study on quality standard for Kangfuling granules
Yan DING ; Min DING ; Xiaobin JIA ; Yongmei ZHANG ; Guibin GUO ; Rui SUN ; Mei LIN
Journal of Medical Postgraduates 2015;28(10):1075-1078
Objective Kangfuling granules can be used for the treatment of radiation damage , but its quality criteria has not been established .This paper aimed to establish the quality criteria of Kangfuling granules to control its quality . Methods Radix as-tragali and Radix angelicae sinensis in the formula both were identified qualitatively by TLC .The content of astragaloside IV was exam-ined by HPLC:Agilent Zorbax Extend-C18 (4.6 mm ×250 mm, 5μm) was used as the chromatographic column .The mobile phase was consisted of acetonitrile-water (32:68) with a flow rate at 1.0 mL/min.The evaporative light scattering detector was used to detect the compound.The content of astragaloside IV and ferulaic acid was examined by HPLC: Agilent Zorbax SB-C18 (4.6 mm ×250 mm, 5 μm) was used as the chromatographic column .The mobile phase was consisted of acetonitrile-0.085% phosphoric acid water (17:83) with a flow rate at 1.0 mL/min.The wave length was 320 nm and column temperature was set at 35℃. Results The same color spot was shown in the chromatogram of the test sample and the control sample in the corresponding position with no interference of negative control.The linear range for Astragaloside IV 0.030 6 mg/mL~0.612 0 mg/mL with R2 =0.999.The RSD of stability test was 2.17%.The RSD of precision test was 1.89%.The RSD of re-peatability test was 1.58%.The average recovery was 101.26%. The linear range for ferulaic acid 0.24-4.80 μg/mL with R2 =0.999.The RSD of stability test was 1.37%.The RSD of precision test was 0.83%.The RSD of repeatability test was 1.14%.The average recovery was 98.39%.This product was tentatively calculat-ed according to the dry matter , the amount of Astragaloside IV and ferulaic acid should not be less than 0.19 mg/g and 0.08 mg/g, re-spectively. Conclusion In this study, the established TLC was used for the qualitative identification of Kangfuling granules , and the content of Astragaloside IV and ferulaic acid was not less than 0.19 mg and 0.08 mg in per gram of Kangfuling granules , respectively. The established standard is suitable for the quality control of Kangfuling granules .
7.Evaluation of alar ligament injury with MR proton-weighted imaging
Jianqiang CHEN ; Yuefu ZHAN ; Guibin HAN ; Xiangjun HAN ; Ziyi GUO ; Wei WANG
Chinese Journal of Radiology 2015;(5):376-379
Objective To investigate the imaging features of alar ligament and its extent, and provide the basis forclinical treatment.Methods 3.0 T superconducting MRI was used to scan the alar ligament with high resolution PDWI sequence (Proton density weighted imaging, PDWI)in 109 patients of emergency admissions due to head and neck trauma. Based on imaging features, ligamentous injury was classified into three degrees(Ⅰ to Ⅲ degrees).Patients with Ⅰ degree ligamentous injury were treated conservatively, andⅡtoⅢdegree injury patients were treated with surgery, then follow-up was performed with MRI for the recovery of ligaments and clinical evaluation for symptoms (6 months follow-up period). Results High-resolution PDWI showed 78 patients with no ligament injury.On follow-up, patients recovered well (atlantoaxial joint motor function and clinical symptoms). Thirty one patients had alar ligament injury in varying degrees, of which 18 patients had grade Ⅰ injury, nine patients had degree Ⅱinjury, and four patients had degreeⅢinjury .All gradeⅠinjury patients received conservative treatment. Follow-up of patients showed good recovery, MR revealed the lesions shrank in varying degrees or disappear.
Six gradeⅡinjury patients had surgical treatment, and three received conservative treatment. On follow-up, seven patients had a good recovery, two patients underwent surgical treatment within 3 months after injury and recovered well.Three gradeⅢpatients treated by surgery, and all with good recovery postoperative, and a patient died of respiratory failure. Conclusions High resolution PDWI is an effective tool to evaluate the extent of the alar ligament injury. Grade Ⅰ ligamentous injury patients treated conservatively can achieve good results, GradeⅡandⅢligamentous injury patients should receive surgical treatment early.
8.Fully Automated Determination of Four Androgenic Hormones in Serum by Online Turbulent Flow Solid Phase Extraction Coupled with Liquid Chromatography-Tandem Mass Spectrometry
Feng GUO ; Jianbo SHI ; Guibin JIANG
Chinese Journal of Analytical Chemistry 2014;(12):1818-1822
A novel method was developed for the direct analysis of testosterone, androstenedione, methyltestosterone and methenolone in serum samples by fully automated online turbulent flow solid phase extraction coupled with high performance liquid chromatography-tandem mass spectrometry. An aliquot of 50 μL serum sample was preconcentrated directly on a Turboflow SPE column after centrifugation. Turboflow SPE C18-P could be used to remove serum matrix effectively. The optimum loading flow rate and elution time were 4. 0 mL/min and 1. 0 min, respectively. The linearity ranges were from 1. 0 μg/L to 100. 0 μg/L for four target compounds. The method limits of detection ( LODs) were in the range of 0. 2-0. 3 μg/L. The relative standard deviations (RSDs) ranged from 2. 9% to 14. 1% (n=5). The time for one sample analysis including extraction, separation and determination was 32 min. The proposed method has been successfully applied for the analysis of serum samples.
9.3.0T-MR high resolution proton density weighted imaging for transverse cervical ligament in healthy adolescents.
Jianqiang CHEN ; Guibin HAN ; Xiangjun HAN ; Ziyi GUO ; Wei WANG
Journal of Central South University(Medical Sciences) 2013;38(10):1009-1013
OBJECTIVE:
To explore the imaging characteristics of the transverse ligament in healthy adolescents, and further understand the imaging characteristics of the ligament injury.
METHODS:
We used 3.0T-MR to scan the transverse ligament with proton-weighted sequence in 32 young volunteers, scanned coronally, horizontally and sagittally, and then observed the morphology, thickness, running and signal characteristics of the ligament.
RESULTS:
The anatomy and signal characteristics of the transverse cervical ligament were clearly displayed by high resolution proton density weighted imaging (PDWI). The whole picture of the transverse ligament was effectively displayed by coronal combined with horizontal image. The transverse ligament was located in the rear of the odontoid, and connected to the inside of both sides of the block like half-arc. The length was (20.4±3.3) mm, the ligament center was the thickest, and both sides gradually became thinner. The middle width of the ligament was (7.3±0.6) mm, the ligament ends narrowed down, and the middle was (2.1±0.4) mm thick; 75% of the transverse ligament showed homogeneous low signal in PDWI, while 25% of the local transverse ligament had high signal.
CONCLUSION
High resolution PDWI with 3.0T-MR is a effective method to evaluate the structure of the transverse cervical ligament. Local high signal may not necessarily be the sign of ligament injure. There may also be some high signal in the normal adolescent ligament, so we must pay much attention to clinical diagnosis and treatment.
Adolescent
;
Diagnostic Imaging
;
Humans
;
Ligaments
;
anatomy & histology
;
Magnetic Resonance Imaging
;
Protons
10.Length of warm ischemic tolerance for epithelial regeneration in heterotopic rat tracheal isografts
Jingquan HAN ; Kai ZHANG ; Jian CUI ; Cheng LIU ; Guibin ZHAO ; Yanzhong XIN ; Qingfeng GUO
Chinese Journal of Organ Transplantation 2011;32(7):430-432
Objective To determine the length of warm ischemic (WI) tolerance in bronchial graft from non-heart-beating donors. Methods Forty-eight rats were randomly divided into 4 groups (each group having 12 rats) according to different WI durations including WI-0 min (group A), WI-30 min (group B), WI-45 min (group C) and WI-60 min (group D). In each group, the tracheae from 6 rats were respectively imbedded in greater omentum of other 6 rats, and 14 days later, the transplanted tracheae were taken from recipients to evaluate epithelial thickness and regeneration. Results Epithelial thickness and the degree of epithelial regeneration had no significant difference (P >0. 05) between the syngeneic control group and the WI-30 minutes group. All of the grafts with WI duration of 45 min were viable, but the epithelium was significantly thinner than that in the syngeneic control group (P<0. 05). However all of the grafts with WI duration of 60 min showed lower viability rate. Conclusion The time limits of tolerance to WI of tracheal grafts from NHBDs may be 45 min.

Result Analysis
Print
Save
E-mail