BACKGROUND: The role of inflammation in the development of gestational diabetes mellitus (GDM) has recently become a focus of research. The systemic immune-inflammation index (SII) and systemic inflammation response index (SIRI), novel indices, reflect the body's chronic immune-inflammatory state. This study aimed to investigate the associations between the SII or SIRI and GDM. METHODS: A prospective birth cohort study was conducted at Beijing Obstetrics and Gynecology Hospital from February 2018 to December 2020, recruiting participants in their first trimester of pregnancy. Baseline SII and SIRI values were derived from routine clinical blood results, calculated as follows: SII = neutrophil (Neut) count × platelet (PLT) count/lymphocyte (Lymph) count, SIRI = Neut count × monocyte (Mono) count/Lymph count, with participants being grouped by quartiles of their SII or SIRI values. Participants were followed up for GDM with a 75-g, 2-h oral glucose tolerance test (OGTT) at 24-28 weeks of gestation using the glucose thresholds of the International Association of Diabetes and Pregnancy Study Groups (IADPSG). Logistic regression was used to analyze the odds ratios (ORs) (95% confidence intervals [CIs]) for the the associations between SII, SIRI, and the risk of GDM. RESULTS: Among the 28,124 women included in the study, the average age was 31.8 ± 3.8 years, and 15.76% (4432/28,124) developed GDM. Higher SII and SIRI quartiles were correlated with increased GDM rates, with rates ranging from 12.26% (862/7031) in the lowest quartile to 20.10% (1413/7031) in the highest quartile for the SII ( Ptrend <0.001) and 11.92-19.31% for the SIRI ( Ptrend <0.001). The ORs (95% CIs) of the second, third, and fourth SII quartiles were 1.09 (0.98-1.21), 1.21 (1.09-1.34), and 1.39 (1.26-1.54), respectively. The SIRI findings paralleled the SII outcomes. For the second through fourth quartiles, the ORs (95% CIs) were 1.24 (1.12-1.38), 1.41 (1.27-1.57), and 1.64 (1.48-1.82), respectively. These associations were maintained in subgroup and sensitivity analyses. CONCLUSION The SII and SIRI are potential independent risk factors contributing to the onset of GDM.
Humans ; Female ; Pregnancy ; Diabetes, Gestational/immunology* ; Prospective Studies ; Adult ; Inflammation/immunology* ; Glucose Tolerance Test ; Birth Cohort

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES

Gestational diabetes mellitus (GDM), a pregnancy-induced hyperglycemia, affects approximately 17% of pregnancies globally. Its pathophysiology remains unclear, with inflammation and vascular remodeling playing key roles. CD248, a glycoprotein linked to inflammation and vascular remodeling, has been implicated in various conditions, but its role in GDM is uncertain.

A prospective case-control study was conducted with 169 pregnant women aged 18 to 49 at a tertiary hospital. Serum CD248 levels were assessed at 24 to 28 weeks of gestation prior to the oral glucose tolerance test (OGTT). Statistical analyses evaluated the association between CD248 levels, BMI and GDM status.

Of the participants, 32 (18.9%) were diagnosed with GDM. CD248 levels were lower in GDM patients (8.15 ± 10.16 ng/mL) than in controls (11.42 ± 15.44 ng/mL), but the difference was not statistically significant (p = 0.084). Although CD248 levels did not correlate with OGTT values, it was positively associated with BMI (pCONCLUSION

Unlike earlier findings associating elevated CD248 levels with early pregnancy GDM risk, this study found no significant relationship during later gestational stages. These results highlight a potentially complex and context-dependent role for CD248 in GDM pathophysiology.

Background: Insulinoma is one of the causes of recurrent hypoglycemia, one of the chief complaints for emergency department admission. The gold standard in diagnosing insulinoma is a 72-hour fasting test which is inconvenient and inefficient as it requires hospitalization. Research has found that measurement of insulin and C-peptide during OGTT may help diagnose insulinoma. We aimed to assess the diagnostic value of OGTT in diagnosing insulinoma. Methodology: The literature search was conducted on 19 August 2022 using several databases (MEDLINE, Scopus, Embase, and ScienceDirect). All studies that measured OGTT as diagnostic tools in diagnosing insulinoma and 72-hour fasting test as reference standard were included. The quality assessment of the selected studies was based on the Centre of Evidence-Based Medicine University of Oxford and the Quality Assessment of Diagnostic Accuracy-2 tool (QUADAS-2). Analysis of the included studies was performed qualitatively. This study was registered on PROSPERO (CRD42022360205). Results: A total of two case-control studies (106 patients) were included, which were at risk of bias and low concern of applicability. Both studies demonstrated that the combination of insulin and C-peptide levels measured during OGTT had high specificity, sensitivity, positive predictive value, and negative predictive value in diagnosing insulinoma compared to the reference standard. A logistic regression model of 8.305 – (0.441 × insulin 2-h/0-h) – (1.679 × C-peptide 1-h/0-h) > 0.351 has the highest diagnostic value in one study (AUC 0.97, Sensitivity 86.5%, Specificity 95.2%, PPV 94.1, NPV 88.9). Conclusion The measurement of 0-h and 2-h insulin and C-peptide levels during 2-h OGTT was found in two small case-control studies with a total of 106 patients to have good sensitivity and specificity. However, due to these limitations, future research is still needed to validate the potential use of OGTT for the diagnosis of insulinoma.
Insulinoma ; Glucose Tolerance Test

Objective: To examine the associations between plasma n-3 polyunsaturated fatty acids (PUFAs) in the second trimester and gestational diabetes mellitus (GDM) among Chinese pregnant women. Methods: Based on data from the Tongji-Shuangliu Birth Cohort enrolled from 2017 to 2019 in the Shuangliu Maternal and Child Health Hospital, it conducted a case-control study among 269 GDM cases who were diagnosed by 75 g oral glucose tolerance test, and 538 non-GDM controls matched at a 1∶2 ratio on maternal age and gestational weeks. The age range of the 807 women was 18-40 years. Fasting plasma n-3 PUFAs were determined by gas chromatography-mass spectrometry in the second trimester (24-28 weeks). Participants were categorized into quartiles (Q1-Q4) of plasma n-3 PUFAs based on distributions in the control group. Conditional logistic regression models were applied to estimate the associations between plasma n-3 PUFAs and GDM. Results: The median (interquartile) relative concentrations of plasma n-3 PUFA C22∶5n-3 was significantly lower in women with GDM 0.87 (0.72, 1.07) compared with women without GDM 0.94 (0.75, 1.19)(P=0.001). Plasma n-3 PUFA C22∶5n-3 was inversely associated with GDM, with an OR (95%CI) of 0.75 (0.62-0.90) for each SD increase of relative concentration. Compared with the Q1 group, the OR values and 95%CIs of Q2, Q3, and Q4 groups were 0.97 (0.62-1.51), 0.72 (0.45-1.15), and 0.54 (0.32-0.90), respectively (P_trend<0.05). However, there were no significant associations of C18∶3n-3, C20∶5n-3, C22∶6n-3, and total n-3 PUFAs with GDM. Conclusion: Plasma n-3 PUFA C22∶5n-3 was inversely associated with GDM during the second trimester.
Case-Control Studies ; Child ; Diabetes, Gestational ; Fatty Acids, Unsaturated ; Female ; Glucose Tolerance Test ; Humans ; Pregnancy ; Pregnancy Trimester, Second

To investigate the effect of dietary fiber on blood glucose and pregnancy outcomes in patients with gestational diabetes mellitus (GDM). One hundred and twelve patients with GDM in the second trimester of pregnancy were recruited from Women's Hospital, Zhejiang University School of Medicine. Patients were randomized into two groups with 56 in each group: the control group received basic nutrition support; while the dietary fiber group were given additional dietary fiber ( total dietary fiber per day) before meals in addition to basic nutrition support. Intervention for all cases lasted for 8 weeks. Fasting blood glucose and postprandial blood glucose (2 h BG) were measured every week, and oral glucose tolerance test (OGTT) was performed at 42 d postpartum to evaluate the glycemic outcomes. Perinatal outcomes were recorded. The dietary fiber intervention markedly improved 2 h BG in patients with GDM and significantly elevated the glucose compliance rate from the 3rd to 8th week compared to the control group ( <0.05 or <0.01). OGTT 2 h glucose and the incidence of impaired glucose tolerance in the dietary fiber group were significantly lower than those in the control group, while the glucose compliance rate was significantly higher than that in the control group (all <0.01). Moreover, the rates of adverse perinatal outcomes, such as premature rupture of membranes and neonatal hyperbilirubinemia were declined in the dietary fiber group (<0.05 or <0.01). Dietary fiber intervention can ameliorate hyperglycemia in GDM patients, improve perinatal outcomes and reduce the incidence of postpartum impaired glucose tolerance.
Blood Glucose ; Diabetes, Gestational ; Dietary Fiber ; Female ; Glucose Tolerance Test ; Humans ; Infant, Newborn ; Pregnancy ; Pregnancy Outcome

To explore the correlation of mid-term oral glucose tolerance test (OGTT) and maternal weight gain with adverse pregnancy outcomes in women with gestational diabetes mellitus (GDM). A total of 2611 pregnant women with GDM who were examined and delivered in Women's Hospital, Zhejiang University School of Medicine from July 1st 2017 to 30th June 2018 were enrolled in this study. According to the number of abnormal items of mid-term OGTT results or maternal gestational weight gain (GWG), patients were classified. The incidence of adverse perinatal outcomes in each group and its relation with OGTT results and GWG were analyzed. The incidence of gestational hypertension, premature delivery, macrosomia and large for gestational age infant (LGA) in three abnormal items GDM patients were significantly higher than those in one or two abnormal items GDM patients (all <0.017). The incidence of gestational hypertension and premature delivery in two abnormal items GDM patients were higher than those in one abnormal item GDM patients (all <0.017). The incidence of gestational hypertension and macrosomia in excessive GWG patients were significantly higher than those in inadequate and appropriate GWG patients (all <0.017), and the incidence of LGA were higher than that in inadequate GWG patients (all <0.017). The incidence of premature delivery and low birth weight infants in appropriate GWG patients were significantly lower than those in inadequate and excessive GWG patients, and the incidence of small for gestational age infant (SGA) were significantly lower than that in inadequate GWG patients (all <0.017). In one abnormal item GDM patients, inadequate GWG was a risk factor for premature delivery and SGA (=1.66, 95%: 1.10-2.52; =2.20, 95%: 1.07-4.53), and protective factor for LGA (=0.40, 95%: 0.27-0.59). And excessive GWG was a risk factor for gestational hypertension, premature delivery and low birth weight infants (=2.15, 95%: 1.35-3.41; =1.80, 95%: 1.20-2.72; =2.18, 95%: 1.10-4.30).In two abnormal items GDM patients, inadequate GWG was a protective factor for macrosomia and LGA (=0.24, 95%: 0.09-0.67; =0.54, 95%: 0.34-0.86), while excessive GWG was risk factor for premature delivery (=1.98, 95%: 1.23-3.18).In three abnormal items GDM patients, there was no significant relationship between GWG and adverse pregnancy outcomes. For GDM women with one or two items of elevated blood glucose in OGTT, reasonable weight management during pregnancy can reduce the occurrence of adverse pregnancy outcomes. For those with three items of elevated blood glucose in OGTT, more strict blood glucose monitoring and active intervention measures should be taken in addition to weight management during pregnancy.
Blood Glucose ; Blood Glucose Self-Monitoring ; Body Mass Index ; Diabetes, Gestational/epidemiology* ; Female ; Gestational Weight Gain ; Glucose Tolerance Test ; Humans ; Pregnancy ; Pregnancy Outcome

To investigate the impact of family history of diabetes (FHD) on blood glucose, lipid levels and perinatal outcomes in pregnant women with gestational diabetes mellitus (GDM). A total of 1265 GDM women who gave childbirth in Women's Hospital, Zhejiang University School of Medicine during January to December 2019 were enrolled in the study, including 253 women with FHD and 1012 women without FHD. The -test or test were used to compare the blood lipid, blood glucose levels and perinatal outcomes including large for gestational age infant, small for gestational age infant, macrosomia, cesarean delivery, preeclampsia, preterm labor, postpartum hemorrhage, fetal distress. The correlation between FHD and perinatal outcomes were estimated by Logistic regression analysis. The high density lipoprotein level at third-trimester was significantly lower in GDM women with FHD (<0.05); and the women with FHD also had higher fasting blood glucose oral glucose tolerance test (OGTT)1 h, OGTT 2 h and glycosylated hemoglobin level (all <0.01). In GDM women, FHD was an independent risk factor for preeclampsia (=3.27, 95%: 1.39-7.68). GDM women with FHD have lower high density lipoprotein and higher glucose levels. FHD is an independent risk factor for preeclampsia in GDM women.
Blood Glucose ; Diabetes, Gestational ; Female ; Glucose Tolerance Test ; Humans ; Infant, Newborn ; Lipids ; Pregnancy ; Pregnant Women ; Risk Factors

BACKGROUND: The prevalence of skin diseases and diabetes mellitus (DM) are prominent around the world. The current scope of knowledge regarding the prevalence of skin diseases and comorbidities with type 2 DM (T2DM) is limited, leading to limited recognition of the correlations between skin diseases and T2DM. METHODS: We collected 383 subjects from the Da Qing Diabetes Study during the period from July 9th to September 1st, 2016. The subjects were categorized into three groups: Normal glucose tolerance (NGT), impaired glucose tolerance (IGT), and T2DM. The prevalence and clinical characteristics of skin diseases were recorded and investigated. RESULTS: In this cross-sectional study, 383 individuals with ages ranging from 53 to 89-year-old were recruited. The overall prevalence of skin diseases was 93.5%, and 75.7% of individuals had two or more kinds of skin diseases. Additionally, there were 47 kinds of comorbid skin diseases in patients with T2DM, of which eight kinds of skin diseases had a prevalence >10%. The prevalence of skin diseases in NGT, IGT, and T2DM groups were 93.3%, 91.5%, and 96.6%, respectively; stratified analysis by categories showed a statistically significant difference in "disturbances of pigmentation" and "neurological and psychogenic dermatoses". The duration of T2DM also significantly associated with the prevalence of "disturbances of pigmentation" and "neurological and psychogenic dermatoses". Subsequently, the prevalence of "disturbances of pigmentation" was higher in males than females in NGT (P < 0.01) and T2DM (P < 0.01) groups. In addition, the difference in the prevalence of "disturbances of pigmentation" was also significant in NGT and T2DM groups (P < 0.01). CONCLUSIONS There was a high prevalence of skin diseases in the Da Qing Diabetes Study. To address the skin diseases in the Da Qing Diabetes Study, increased awareness and intervention measures should be implemented.
Aged ; Aged, 80 and over ; Blood Glucose ; Cross-Sectional Studies ; Diabetes Mellitus, Type 2/epidemiology* ; Female ; Glucose Intolerance/epidemiology* ; Glucose Tolerance Test ; Humans ; Male ; Middle Aged ; Skin Diseases/epidemiology*

Objective: The relationship between serum uric acid (SUA) levels and glycemic indices, including plasma glucose (FPG), 2-hour postload glucose (2h-PG), and glycated hemoglobin (HbA1c), remains inconclusive. We aimed to explore the associations between glycemic indices and SUA levels in the general Chinese population. Methods: The current study was a cross-sectional analysis using the first follow-up survey data from The China Cardiometabolic Disease and Cancer Cohort Study. A total of 105,922 community-dwelling adults aged ≥ 40 years underwent the oral glucose tolerance test and uric acid assessment. The nonlinear relationships between glycemic indices and SUA levels were explored using generalized additive models. Results: A total of 30,941 men and 62,361 women were eligible for the current analysis. Generalized additive models verified the inverted U-shaped association between glycemic indices and SUA levels, but with different inflection points in men and women. The thresholds for FPG, 2h-PG, and HbA1c for men and women were 6.5/8.0 mmol/L, 11.0/14.0 mmol/L, and 6.1/6.5, respectively (SUA levels increased with increasing glycemic indices before the inflection points and then eventually decreased with further increases in the glycemic indices). Conclusion An inverted U-shaped association was observed between major glycemic indices and uric acid levels in both sexes, while the inflection points were reached earlier in men than in women.
Aged ; Asian Continental Ancestry Group ; Blood Glucose/analysis* ; China/epidemiology* ; Cohort Studies ; Diabetes Mellitus/blood* ; Female ; Glucose Tolerance Test ; Glycated Hemoglobin A/analysis* ; Glycemic Index ; Humans ; Male ; Middle Aged ; Uric Acid/blood*