ObjectiveTo observe the effects of Xiaoyaosan on glucagon-like peptide-1 （GLP-1）/GLP-1 receptor （GLP-1r） and protein kinase A （PKA）/cAMP response element binding protein （CREB）/brain-derived neurotrophic factor （BDNF） signaling pathways in the hippocampal CA1 region of rats under chronic restraint stress （CRS），and to explore the mechanism of this formula to alleviate anxiety and depression-like behaviors. Methods40 specific pathogen-free male Sprague-Dawley （SD） rats were randomly divided into normal，model，Xiaoyaosan，and fluoxetine groups，with 10 rats in each group. CRS was used to induce anxiety and depression-like behaviors. The rats in the Xiaoyaosan group were gavaged with aqueous solution of traditional Chinese medicine formula granules （7.36 g·kg^-1·d^-1），while those in the fluoxetine group were gavaged with aqueous solution of fluoxetine （2 mg·kg^-1·d^-1）. Body weight was measured on days 0，7，14，and 21 of the experiment. On days 0 and 22 of the experiment，the sucrose preference test （SPT），forced swimming test （FST），and open field test （OFT） were performed. The pathological morphology of the hippocampal CA1 region was observed by Nissl staining. The relative mRNA expression of post-synaptic density protein-95 （PSD95） and synapsin （SYP） was detected by reverse transcription quantitative real-time polymerase chain reaction. Immunohistochemistry and Western blot were used to detect expression of proteins in the GLP-1/GLP-1r and PKA/CREB/BDNF pathways in the hippocampal CA1 region. ResultsAfter CRS modeling，compared with the normal group，the rats of the model group had anxiety and depression-like behavioral manifestations，neuronal damage in the hippocampal CA1 region，significantly downregulated expression of synaptic plasticity markers PSD95 and SYP genes （P<0.01），and inhibition of GLP-1/GLP-1r and PKA/CREB/BDNF signaling pathways （P<0.05，P<0.01）. Compared with the model group，the Xiaoyaosan group exhibited alleviated anxiety and depression-like behaviors，reduced neuronal damage in the hippocampal CA1 region， significantly increased expression of PSD95 and SYP genes （P<0.01），and the activation of the GLP-1/GLP-1r and PKA/CREB/BDNF signaling pathways （P<0.05，P<0.01）. ConclusionXiaoyaosan can alleviate anxiety and depression-like behaviors in CRS rats by improving synaptic plasticity in the hippocampal CA1 region. The mechanisms may be related to the activation of the GLP-1/GLP-1r pathway and its mediated PKA/CREB/BDNF signaling pathway by the formula.

ObjectiveTo explore the efficacy and mechanisms of Sini San in the treatment of depression and liver injury based on gut microbiota. MethodsThirty-two male Sprague-Dawley （SD） rats were randomly divided into a normal group， model group （M）， Sini San group （MS， 2.5 g·kg^-1）， and fluoxetine group （MF， 2 mg·kg^-1）. Except for the normal group， rats in the other three groups were subjected to chronic unpredictable mild stress （CUMS）. After 8 weeks， the open-field test and sucrose preference test were conducted. Enzyme-linked immunosorbent assay （ELISA） was used to detect serum corticosterone （CORT）， adrenocorticotropic hormone （ACTH）， corticotropin-releasing factor （CRF）， lipopolysaccharide （LPS）， Zonulin， interleukin-6 （IL-6）， tumor necrosis factor-α （TNF-α）， interleukin-1β （IL-1β）， γ-aminobutyric acid （GABA） levels in the hippocampus and prefrontal cortex， and brain-derived neurotrophic factor （BDNF） levels in the hippocampus. Real-time quantitative polymerase chain reaction （Real-time PCR） was used to detect hippocampal BDNF mRNA expression. Serum alanine aminotransferase （ALT） and aspartate aminotransferase （AST） levels were measured using the ultraviolet lactate dehydrogenase method. The ultrastructure of the intestinal epithelium was observed by electron microscopy， and gut microbiota in rat feces were analyzed using 16S rDNA high-throughput sequencing. ResultsCompared with the normal group， the sucrose preference of rats in the model group was significantly reduced （P0.01）， whereas it was significantly increased in the Sini San group compared with the model group （P0.05）. Compared with the normal group， hippocampal GABA protein levels and BDNF mRNA expression in the model group were significantly decreased （P0.05）， and compared with the model group， both were significantly increased in the Sini San group （P0.05， P0.01）. Compared with the normal group， serum LPS and Zonulin levels in the model group were significantly increased （P0.05， P0.01）， and compared with the model group， Zonulin levels in the Sini San group were significantly decreased （P0.05）. No obvious changes were observed in the ultrastructure of the jejunal mucosa among groups. Compared with the normal group， widened and blurred tight junctions， sparse and shortened microvilli， and mitochondrial swelling with cristae disruption in epithelial cells were observed in the ileal and colonic mucosa of the model group， which were markedly improved in the Sini San and fluoxetine groups. The results of 16S rDNA high-throughput sequencing showed that Sini San improved CUMS-induced dysbiosis of Bacteroidetes and Proteobacteria. Correlation analysis indicated that Bacteroidetes and Proteobacteria were significantly correlated with depression-related indicators， liver function， and intestinal mucosal permeability. ConclusionSini San exerts antidepressant and hepatoprotective effects by improving Bacteroidetes and Proteobacteria and inhibiting the increase in intestinal mucosal permeability in CUMS rats.

ObjectiveTo explore the efficacy and mechanisms of Sini San in the treatment of depression and liver injury based on gut microbiota. MethodsThirty-two male Sprague-Dawley （SD） rats were randomly divided into a normal group， model group （M）， Sini San group （MS， 2.5 g·kg^-1）， and fluoxetine group （MF， 2 mg·kg^-1）. Except for the normal group， rats in the other three groups were subjected to chronic unpredictable mild stress （CUMS）. After 8 weeks， the open-field test and sucrose preference test were conducted. Enzyme-linked immunosorbent assay （ELISA） was used to detect serum corticosterone （CORT）， adrenocorticotropic hormone （ACTH）， corticotropin-releasing factor （CRF）， lipopolysaccharide （LPS）， Zonulin， interleukin-6 （IL-6）， tumor necrosis factor-α （TNF-α）， interleukin-1β （IL-1β）， γ-aminobutyric acid （GABA） levels in the hippocampus and prefrontal cortex， and brain-derived neurotrophic factor （BDNF） levels in the hippocampus. Real-time quantitative polymerase chain reaction （Real-time PCR） was used to detect hippocampal BDNF mRNA expression. Serum alanine aminotransferase （ALT） and aspartate aminotransferase （AST） levels were measured using the ultraviolet lactate dehydrogenase method. The ultrastructure of the intestinal epithelium was observed by electron microscopy， and gut microbiota in rat feces were analyzed using 16S rDNA high-throughput sequencing. ResultsCompared with the normal group， the sucrose preference of rats in the model group was significantly reduced （P<0.01）， whereas it was significantly increased in the Sini San group compared with the model group （P<0.05）. Compared with the normal group， hippocampal GABA protein levels and BDNF mRNA expression in the model group were significantly decreased （P<0.05）， and compared with the model group， both were significantly increased in the Sini San group （P<0.05， P<0.01）. Compared with the normal group， serum LPS and Zonulin levels in the model group were significantly increased （P<0.05， P<0.01）， and compared with the model group， Zonulin levels in the Sini San group were significantly decreased （P<0.05）. No obvious changes were observed in the ultrastructure of the jejunal mucosa among groups. Compared with the normal group， widened and blurred tight junctions， sparse and shortened microvilli， and mitochondrial swelling with cristae disruption in epithelial cells were observed in the ileal and colonic mucosa of the model group， which were markedly improved in the Sini San and fluoxetine groups. The results of 16S rDNA high-throughput sequencing showed that Sini San improved CUMS-induced dysbiosis of Bacteroidetes and Proteobacteria. Correlation analysis indicated that Bacteroidetes and Proteobacteria were significantly correlated with depression-related indicators， liver function， and intestinal mucosal permeability. ConclusionSini San exerts antidepressant and hepatoprotective effects by improving Bacteroidetes and Proteobacteria and inhibiting the increase in intestinal mucosal permeability in CUMS rats.

POEMS syndrome is a rare condition associated with plasma cell disorders， and it often involves multiple systems and has diverse clinical manifestations. This article reports two cases of POEMS syndrome with hepatosplenomegaly as the initial manifestation. During the course of the disease， the patients presented with lower limb weakness， hepatosplenomegaly， lymph node enlargement， ascites， hypothyroidism， positive M protein， and skin hyperpigmentation， and ¹⁸F-FDG PET-CT imaging revealed bone lesions mainly characterized by osteolytic changes and plasma cell tumors. There was an increase in the serum level of vascular endothelial growth factor. The patients were finally diagnosed with POEMS syndrome， and the symptoms were relieved after immunomodulatory treatment.

Yttrium-90 selective internal radiation therapy (⁹⁰Y-SIRT) is a treatment technique that delivers radioactive microspheres precisely to the arterial vascular bed of neoplasms, utilizing beta radiation to administer a high local dose of radiation to the neoplasm tissues. This technology has demonstrated significant efficacy in patients with unresectable pirmary liver cancers and liver metastases. This article systematically reviews the development history and clinical application status of ⁹⁰Y-SIRT in the treatment of liver cancer, and looks forward to future development directions.

The improvement of hemophilia treatment is attributed to the development of transfusion medicine, and the discovery of cryoprecipitate has opened up a new era of hemophilia treatment, laying the foundation for the development of modern hemophilia therapies. But with the further improvement of hemophilia treatment and the emergence of new treatment methods, transfusion medicine no longer plays a dominant role in hemophilia treatment. The new technologies and methods for hemophilia treatment can provide reference for the development of transfusion medicine, thereby better serving clinical practice and patients.

Cardiovascular diseases （CVD），a group of common diseases in clinical practice，are witnessing a steady rise in both incidence and mortality rates，posing a challenge to public health. Gualou Xiebai Banxiatang，originating from Synopsis of the Golden Chamber （《金匮要略》），was initially used to treat severe cases of chest impediment. The formula consists of Trichosanthis Fructus，Allii Macrostemonis Bulbus，Pinelliae Rhizoma，and Baijiu. It has a wide range of clinical applications，with therapeutic effects including moving Qi to relieve depression，activating Yang to dissipate mass，and expelling phlegm to alleviate chest congestion. In recent years，clinical research has confirmed that Gualou Xiebai Banxiatang，with or without modification，used alone or in combination with Western medicine，has definite effects in the treatment of CVD such as hyperlipidemia，coronary atherosclerotic heart disease，hypertension，heart failure，and arrhythmia. It can alleviate disease symptoms and reduce the risk of re-hospitalization. Basic research indicates that the mechanisms of Gualou Xiebai Banxiatang include improving endothelial functions，exhibiting anti-inflammatory properties，countering oxidative stress，preventing apoptosis，inhibiting ventricular remodeling，regulating mitochondrial functions，improving hemorheology，and modulating autophagy and neurotransmitters. This article reviews relevant articles in recent years with focuses on the compatibility，clinical application，and mechanism of Gualou Xiebai Banxiatang. This review is expected to provide a theoretical basis for the mechanism research and clinical application of this formula in treating CVD and to offer ideas and reference for in-depth research.

Objective To investigate the effect and mechanism of the signal transducer and activator of transcription 3 (STAT3) inhibitor Stattic on the rejection of mouse heart allograft. Methods BALB/c mice (donors) were used to transplant skin onto C57BL/6 mice (recipients). Four weeks later, memory CD4⁺ T cells (CD4⁺Tm) were isolated from the recipient mice's spleens. Mixed lymphocyte reaction experiment was conducted with C57BL/6 mouse splenocytes and CD4⁺Tm, and the EdU method was used to detect the effect of Stattic on CD4⁺Tm cell proliferation. A C57BL/6 mouse heart transplant (HTx) model was constructed, and the experiment was divided into four groups: Non-HTx group, HTx group, Tm/HTx group, and Tm/HTx+Stattic group. The survival of heart allografts in mice was observed daily. Hematoxylin-eosin staining was used to observe the histopathology of the heart allografts. Real-time fluorescent quantitative polymerase chain reaction was used to detect the expression levels of interferon (IFN)-γ, interleukin (IL)-2, IL-10, and transforming growth factor-β1 (TGF-β1) messenger RNA (mRNA) in the heart allografts. Enzyme-linked immunosorbent assay was used to detect the levels of IFN-γ, IL-2, IL-10, and TGF-β1 in the serum. Flow cytometry was used to detect the levels of CD4⁺Tm (CD4⁺CD44⁺CD62L⁺) in splenic lymphocytes. And Western blotting was used to detect the expression levels of STAT3 and p-STAT3 proteins in the heart allografts. Results When the concentration of Stattic exceeded 2.5 μmol/L, it could inhibit the proliferation of CD4⁺Tm cells. Compared with the HTx group, the Tm/HTx group showed shorter survival time of heart grafts, more severe histopathological damage, increased serum IFN-γ and IL-2 levels, decreased IL-10 and TGF-β1 levels, increased relative expression of IFN-γ and IL-2 mRNA, decreased relative expression of IL-10 and TGF-β1 mRNA in the heart allografts, increased proportion of CD4⁺Tm in splenic lymphocytes, and increased p-STAT3/STAT3 ratio in the heart allografts (all P<0.05). Compared with the Tm/HTx group, the Tm/HTx+Stattic group showed longer survival time of heart grafts, less severe histopathological damage, decreased serum IFN-γ and IL-2 levels, increased IL-10 and TGF-β1 levels, decreased relative expression of IFN-γ and IL-2 mRNA, increased relative expression of IL-10 and TGF-β1 mRNA in the heart allografts, decreased proportion of CD4⁺Tm in splenic lymphocytes, and decreased p-STAT3/STAT3 ratio in the heart allografts (all P<0.05). Conclusions Stattic may prolong the survival time of mouse heart allografts, and its mechanism may be related to the inhibition of CD4⁺Tm- mediated acute rejection.

Objective: To investigate the effects of different storage temperatures and durations on the activities of coagulation factor Ⅷ (Factor Ⅷ, FⅧ) and coagulation factor Ⅸ (Factor Ⅸ, FⅨ) after whole blood collection, so as to provide data support for the optimal storage conditions. Methods: A total of 16 mL of whole blood was collected from each of the 20 healthy volunteers at our blood center and aliquoted into 8 sodium citrate anticoagulant tubes. Two tubes were immediately centrifuged for the measurement of FⅧ and FⅨ activity levels. The remaining 6 tubes of whole blood were respectively stored under room temperature and low-temperature conditions. At 2, 4, and 6 h, the whole blood samples were centrifuged and analyzed for FⅧ and FⅨ activity levels. The mean values of the two immediately tested tubes were used as the control group, while other tubes were designated as the experimental groups for comparison. Statistical analysis was performed using SPSS 26.0. Results: The activity of FⅧ in whole blood remained stable after 4 hours of storage at both room temperature and low temperature (116.53±25.95 vs 125.22±27.33, 109.77±23.23 vs 125.22±27.33) (P>0.05 for both). However, by 6 hours, FⅧ activity showed a statistically significant decline compared to the control group (108.65±22.92 vs 125.22±27.33, 100.46±20.19 vs 125.22±27.33) (P<0.05 for both), though the room temperature group results were closer to the control values. The activity of FⅨ in whole blood remained stable after 6 hours of storage under both conditions (97.14±19.48 vs 96.76±19.67, 97.10±17.45 vs 96.76±19.6) (P>0.05 for all comparisons). Conclusion: For whole blood samples after collection, storage at either room temperature or low temperature for up to 4 hours does not compromise the accuracy of test results. When stored for 6 hours, FⅨ activity remains stable, whereas FⅧ activity decreases significantly. Notably, FⅧ activity demonstrates better stability at room temperature than under low-temperature conditions within the 6-hour storage.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.