Objective: To evaluate the efficacy and safety of plasma exchange (PE) in thymoma-associated myasthenia gravis (MG), thereby to provide theoretical support for its application in the treatment of thymoma-associated MG. Methods: A total of 133 patients with thymoma-associated MG admitted from January 2018 to September 2024 were retrospectively analyzed. Patients were matched using propensity score to reduce selection bias, yielding 22 matched pairs for both PE group (n=22) and non-PE group (n=22). Patient characteristics including gender, age of disease onset, course of disease, history of thymoma resection, clinical absolute scores [clinical absolute scores (CAS) and clinical relative scores (CRS)], and synchronized immunotherapy regimen of the two groups were analyzed. The CAS scores before and after treatment were compared between the two groups, and the CRS was used to assess the treatment efficiency. Safety of the two treatment regimens were also compared. Continuous variables were compared using the t-test or ANOVA, while categorical data were compared by the chi-square test. Results: A total of 133 patients were included and divided into two groups according to whether they underwent plasma exchange treatment: the PE group (n=22) and the non-PE group (n=111). To exclude bias caused by large difference in the number of cases between the two groups, we performed propensity score matching. After matching, the number of cases in both groups was 22. There was no significant difference in baseline clinical characteristics between the two groups (P>0.05), including gender, age of onset, duration of disease course, history of thymectomy and baseline CAS score before treatment. Compared to the non-PE group, patients in the PE group showed more significant improvement in CAS score (5.09±1.95 vs 3.59±1.50, P<0.05) and a higher CRS score (75.00% vs 50.00%, P<0.001). Compared to the non-PE group, PE group had significantly longer ICU stay, longer hospital stay and higher hospitalization cost (P<0.05). There was no statistically significant difference in adverse events between the two groups during treatment (P>0.05). During long-term follow-up, both the PE and non-PE groups showed relatively low 1-, 3-, and 5-year recurrence rate, with no significant difference between the two groups (P>0.05). Conclusion: This study indicates that plasma exchange has clear value in the treatment of patients with thymoma-associated myasthenia gravis. It can not only significantly improve patients' muscle strength to alleviate motor dysfunction and enhance quality of life, but also does not significantly increase the incidence of adverse reactions. Therefore, it can be regarded as one of the preferred treatment options that achieve a "balance between efficacy and safety" for such patients, and provides an important basis for optimizing treatment strategies, improving prognosis, and promoting the application of subsequent treatment regimens.

Objective:To analyze the clinical and immunological characteristics of children with acute viral infection-related encephalopathy.Methods:Case-control study.A retrospective analysis was conducted on the clinical data of children diagnosed with acute viral infection-related encephalopathy during hospitalization at the Children′s Hospital, Capital Institute of Pediatrics from January 2020 to January 2023.According to the last follow-up modified Rankin scale (mRS) score, these children were divided into a good prognosis group (mRS score ≤2) and a poor prognosis group (mRS score >2), and the clinical and immunological characteristics of the children with different prognoses were analyzed.The binary Logistic regression was used to analyze the risk factors for poor prognosis.Results:A total of 28 children with acute viral infection-related encephalopathy aged 4 months to 11 years were included.There were 16 males (57%) and 12 females (43%). Among the preinfection viruses, there were 16 children of Corona virus disease 2019, 8 children of influenza A virus, 3 children of influenza B virus, and 1 child of norovirus.Among them, there were 21 children with acute necrotizing encephalopathy, 4 children with acute encephalopathy with biphasic seizures and late reduced diffusion, 2 children with mild encephalitis with a reversible splenial lesion, and 1 child with hemorrhagic shock and encephalopathy syndrome.Among the first symptoms, 24 children (85.7%) had consciousness disorders, 23 children (82.1%) had seizures, 17 children (60.7%) had speech disorders, 11 children (39.3%) had involuntary movements, and 10 children (35.7%) had abnormal mental behavior.For the site of lesion, the cranial nuclear magnetic resonance imaging revealed 17 in the thalamus, 10 in the brainstem, 9 in the basal ganglia, 8 in the cerebellar hemisphere, and 4 in the corpus callosum.In the last follow-up evaluation, 17 children had a mRS score of >2, and 11 children had a mRS score of ≤2.Univariate analysis showed that disturbance of consciousness, seizure cluster, brain stem lesion, absolute value of serum T lymphocytes, cerebrospinal fluid(CSF) protein, CSF cytokines [interleukin(IL)-1β, IL-6 and IL-8]were higher in the poor prognosis group than those in the good prognosis group.Multivariate Logistic regression analysis indicated that brain stem disease, CSF IL-1β and T lymphocyte absolute number were independent risk factors for poor prognosis.Conclusions:Brain stem lesions, cerebrospinal fluid IL-1β and the absolute number of T lymphocytes have predictive value for the prognosis of acute viral infection-associated encephalopathy.The more severe the conditions, the lower the T lymphocytes, and the higher the cytokines in some cerebrospinal fluid.

Kidney is one of the key target organs involved in autoinflammatory diseases (AIDs). The clinical manifestations of renal impairment associated with AIDs are diverse, including hematuria, proteinuria, nephrotic syndrome, hypertension, renal artery stenosis, renal insufficiency, and others. The pathogenesis is mostly renal amyloidosis and/or renal vasculitis/vasculopathy caused by inflammasome activation. Whether or not the kidney is involved and its degree is closely related to the prognosis of AIDs patients. This article introduces the pathogenesis of AIDs-related renal impairmen and highlights the clinical characteristics of renal damage in some AIDs, aiming to enhance clinicians′ understanding of AIDs-related renal damage, and to implement early diagnosis and treatment to improve patients′ quality of life and prognosis.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

Objective:To summarize the clinical manifestations, diagnosis, treatment and prognosis of acute flaccid myelitis (AFM) in children.Methods:Clinical characteristics of 4 AFM cases from Department of Neurology, Children′s Hospital Affiliated to Capital Institute of Pediatrics, from September 2018 to November 2022, were analyzed retrospectively.Results:The age of 4 children with AFM was 7 years, 4 years and 3 months, 7 years and 1 month, 6 years and 5 months, respectively. There were 2 boys and 2 girls. Prodromal infection status showed 3 children of respiratory tract infection and 1 child of digestive tract infection. The main manifestation was asymmetrical limb weakness after infection, and the affected limb range was from monoplegia to quadriplegia. Cranial nerve injury was involved in 1 child, no encephalopathy. Magnetic resonance imaging in the spinal cord of all 4 children showed long T1 and T2 signals, mainly involving gray matter. Cerebrospinal fluid cell-protein separation was observed in 2 children. Pathogen detected in 1 child pharyngeal swab was enterovirus D68. Antibody IgM to adenovirus was positive in the blood of 1 child. Antibody IgG against Echo and Coxsackie B virus were positive in the blood of another child. After glucocorticoid, human immunoglobulin or simple symptomatic treatment and at the same time under later rehabilitation training, muscle strength recovered to different degrees, but there were disabilities left in 3 children.Conclusions:AFM should be considered in children with acute and asymmetrical flaccid paralysis accompanied by abnormal magnetic resonance imaging signal in the central region of spinal cord, especially post-infection. The effective treatment is limited and the prognosis is poor.

Objective:To summarize the relevant evidence for the prevention of contrast-associated acute kidney injury (CA-AKI) after enhanced CT examination in patients with nephropathy.Methods:The literature on prevention of CA-AKI in patients with nephropathy who underwent enhanced CT examination in relevant websites and medical literature databases at home and abroad were systematically searched, the quality of the literature was evaluated, and the relevant evidence was extracted and summarized. The retrieval period was from January 1, 2013 to December 1, 2023.Results:A total of 17 literature was included, including 6 guidelines, 5 expert consensuses, 2 clinical decisions, 2 cohort studies, 1 evidence summary and 1 systematic review. Evidence was extracted from these literature. After summary and analysis of these evidence, 10 evidence topics were sorted out, including threshold of estimated glomerular filtration rate and high-risk population, screening, hydration prevention, drug prevention, use of nephrotoxic drugs, use of metformin, precautions for dialysis patients, alternative imaging strategies, choice of iodine contrast agents, and points for attention after enhanced CT examination, forming 47 pieces of evidence.Conclusion:The relevant evidence for the prevention of CA-AKI can provide a more systematic evidence-based basis for medical staffs in screening high-risk population and preventing and managing CA-AKI in patients with chronic kidney disease before enhanced CT examination.

Objective:To summarize the relevant evidence for the prevention of contrast-associated acute kidney injury (CA-AKI) after enhanced CT examination in patients with nephropathy.Methods:The literature on prevention of CA-AKI in patients with nephropathy who underwent enhanced CT examination in relevant websites and medical literature databases at home and abroad were systematically searched, the quality of the literature was evaluated, and the relevant evidence was extracted and summarized. The retrieval period was from January 1, 2013 to December 1, 2023.Results:A total of 17 literature was included, including 6 guidelines, 5 expert consensuses, 2 clinical decisions, 2 cohort studies, 1 evidence summary and 1 systematic review. Evidence was extracted from these literature. After summary and analysis of these evidence, 10 evidence topics were sorted out, including threshold of estimated glomerular filtration rate and high-risk population, screening, hydration prevention, drug prevention, use of nephrotoxic drugs, use of metformin, precautions for dialysis patients, alternative imaging strategies, choice of iodine contrast agents, and points for attention after enhanced CT examination, forming 47 pieces of evidence.Conclusion:The relevant evidence for the prevention of CA-AKI can provide a more systematic evidence-based basis for medical staffs in screening high-risk population and preventing and managing CA-AKI in patients with chronic kidney disease before enhanced CT examination.

Humans ; Melanoma/therapy* ; Immunotherapy ; Syndrome ; Skin Neoplasms

Juvenile localized scleroderma is a rare childhood disease, the specific pathogenesis of this disease has not been fully clarified.Early recognition and timely diagnosis are crucial, early intervention is associated with good prognosis.But there is a lack of relatively reliable evaluation of disease activity and treatment response.At present, the main diagnostic basis of the disease is clinical manifestations.When there is doubt about the diagnosis, skin or subcutaneous tissue biopsy is required.In addition, high frequency Doppler ultrasound, shear-wave elastography, infrared thermal imaging, MRI, cone beam computed tomography, and dermatology evaluation tools, etc., all can reflect the patient′s condition to a certain extent.However, systematic evaluation should be improved in the process of diagnosis and treatment.In terms of treatment, hormones and methotrexate are still the first-line treatment for the disease, while evidence for second-line therapy is limited.Mycophenolate, hydroxychloroquine, cyclosporine A, tocilizumab and infliximab may play a certain role in the treatment of this disease.

Acute post streptococcal glomerulonephritis is one of the most common causes of acute post-infectious glomerulonephritis in developing countries.Now, the specific pathogenesis of the disease is unclear, the clinical manifestations are diverse, and the treatment of this disease is symptomatic support therapy.The study of the pathogenesis is helpful to improve the prevention and treatment of ASPGN.In this review, we focused on the pathogenesis, diagnosis and treatment of acute streptococcal glomerulonephritis in pediatrics.