Background Work-related musculoskeletal disorders (WMSDs) are a major occupational health concern, particularly among workers exposed to adverse ergonomic conditions. Manganese production involves heavy physical demands, yet research on WMSDs among manganese workers remains limited. Objective To investigate the prevalence and influencing factors of WMSDs among manganese workers in a manganese enterprise in Guangxi. Methods A cross-sectional survey was conducted from May to June 2024 on workers at a manganese factory in Guangxi. The Chinese Musculoskeletal Disorders Questionnaire was used to collect information on demographic characteristics, distribution of musculoskeletal symptoms, and work-related exposures. χ² test was applied to compare differences in positive WMSDs rates across groups, and logistic regression analysis was performed to identify associated factors. Results A total of 1476 workers were enrolled in the study after pre-determined inclusion and exclusion criteria. The overall prevalence of WMSDs was 34.15%. The most commonly affected body regions were the lower back (17.28%), neck (16.67%), and shoulders (13.82%). The results of logistic regression analysis indicated that female, older age, and education level of college or above were associated with a higher risk of WMSDs (P<0.05). Awkward working postures were significantly associated with WMSDs in corresponding body regions; in particular, awkward postures of the neck, upper limbs, trunk, and lower limbs were related to an increased risk of WMSDs in multiple body sites (P<0.05). In addition, poor lighting conditions, high workplace temperature, frequent or sustained arm support during work, and high job demands were associated with an increased risk of overall or site-specific WMSDs (P<0.05). Conclusion The high prevalence of WMSDs among manganese workers is closely associated with demographic characteristics, working postures, and work environment and organizational factors. Targeted ergonomic interventions focusing on high-risk body regions and key ergonomic exposures are warranted to reduce the risk of WMSDs among manganese workers.

ObjectiveTo explore the application of virtual reality biofeedback training combined with oral localization therapy in dysphagia after oral cancer surgery. MethodsFrom May, 2023 to July, 2024, 86 patients with dysphagia after oral cancer surgery in Zhejiang Provincial People's Hospital were randomly divided into control group (n = 43) and experimental group (n = 43). The control group received conventional swallowing function training, while the experimental group added virtual reality biofeedback training combined with oral positioning therapy, for four weeks. The Standardized Swallowing Function Assessment Scale (SSA), Functional Oral Intake Scale (FOIS) and M.D.Anderson Dysphagia Inventory (MDADI) were used for evaluation before intervention, and two weeks, four weeks and eight weeks after intervention. ResultsFor scores of SSA , the main effects of group (F = 150.190, P < 0.001, η²_p = 0.641) and time (F = 230.870, P < 0.001, η²_p = 0.733), as well as the interaction effect (F = 16.910, P < 0.001, η²_p = 0.168) were all significant. For scores of FOIS, the main effects of group (F = 59.601, P < 0.001, η²_p = 0.415) and time (F = 89.464, P < 0.001, η²_p = 0.516), as well as the interaction effect (F = 7.990, P < 0.001, η²_p = 0.087) were all significant. For scores of MDADI, the main effects of group (F = 33.133, P < 0.001, η²_p = 0.283) and time (F = 49.650, P < 0.001, η²_p = 0.371), as well as the interaction effect (F = 3.224, P = 0.023, η²_p = 0.037) were all significant. ConclusionVirtual reality biofeedback training combined with oral localization therapy could improve the swallowing function, oral feeding ability and overall quality of life of patients with dysphagia after oral cancer surgery.

ObjectiveTo investigate the effects of Jianpi Qinghua granules on blood glucose fluctuations in patients with newly diagnosed overweight/obese type 2 diabetes mellitus （T2DM） and Qi-Yin deficiency syndrome from the perspective of skeletal muscle mass and function， while providing new insights for the treatment of diabetes. MethodsThis study employed a randomized， double-blind， placebo-controlled design. A total of 110 newly diagnosed overweight/obese T2DM patients meeting the inclusion criteria were randomly assigned to either the traditional Chinese medicine （TCM） group （54 cases） or the control group （56 cases）. Patients in the TCM group received Jianpi Qinghua Granules， while those in the control group received a placebo. Both groups underwent dietary and exercise guidance. After 12 weeks of intervention， blood glucose fluctuations were assessed using the following parameters： time in the target blood glucose range （TIR）， mean daily blood glucose （MBG）， standard deviation of mean daily blood glucose （SDBG）， mean amplitude of glycemic excursions （MAGE）， coefficient of variation of blood glucose （CV）， glycated hemoglobin （HbA1c） achievement rate， fasting plasma glucose （FPG）， and 2 hour postprandial glucose （2 hPG）. Skeletal muscle mass was measured by dual-energy X-ray absorptiometry （DXA）， while skeletal muscle function was evaluated using a handheld dynamometer for distal muscle strength and a 5-time sit-to-stand test for lower limb function. Additionally， pancreatic islet function and TCM syndrome scores were analyzed. ResultsNo significant differences were observed in baseline data between the two groups before intervention， ensuring comparability. After treatment， compared to the control group， the TCM group showed a significant increase in TIR （P<0.01）. While the SDBG and CV decreased， and MBG and MAGE increased in the TCM group， these differences were not statistically significant. Notably， the TCM group exhibited significant reductions in 2 hPG （P<0.01） and HbA1c （P<0.05）， though the decrease in FPG was not statistically significant. The HbA1c achievement rate in the TCM group was significantly higher than that in the control group （χ²=45.498， P<0.01）. In terms of skeletal muscle mass and function， the TCM group demonstrated a significant increase in handgrip strength （P<0.01） and a significant reduction in the 5-time sit-to-stand duration （P<0.05）. However， although body fat percentage increased， leading to a decrease in skeletal muscle mass and the ratio of skeletal muscle to fat， these changes were not statistically significant. For pancreatic islet function， the TCM group showed significant reductions in fasting insulin （FINS） and homeostasis model assessment of insulin resistance （HOMA-IR） （P<0.01）. Additionally， the TCM syndrome score in the TCM group was significantly reduced （P<0.01）. ConclusionJianpi Qinghua granules may reduce blood glucose fluctuations in newly diagnosed overweight/obese T2DM patients with Qi-Yin deficiency syndrome by enhancing skeletal muscle function， improving pancreatic islet function， and ameliorating related TCM syndromes.

Objective: To explore the association between executive function and emotional and behavioral problems in first-grade elementary school students, so as to provide a reference for promoting children s mental health. Methods: From March to May 2024, 423 first-grade elementary school students from 6 primary schools aged 6-7 were selected by using stratified cluster random sampling in Shanxi, Shanghai, Shandong, Guangxi, Xinjiang, and Jiangxi. Data were collected by using the Executive Function Assessment Scale and the Strengths and Difficulties Questionnaire. An independent samples t-test was used to analyze differences in executive function of different genders and differences in emotional and behavioral problems among first-grade school students with varying executive function levels; a linear regression model was employed to analyze the association between children s executive function and emotional and behavioral problems. Results: A total of 42 first-grade elementary school students (9.9%) were identified as having executive function deficits. Students in the executive function deficit group scored higher on internalizing behavior (7.50±0.52), externalizing behavior (11.26±0.52), and total difficulties (18.52± 0.93 ) were significantly higher than those of children without deficits (4.37±0.14, 6.69±0.17, 10.64±0.27) ( t =5.79, 8.50, 9.23, all P <0.05). Results of linear regression analysis showed that, after controlling for relevant covariates such as gender, age, family economic status, being an only child, and body mass index, the factor scores, dimensional scores, and total scores of executive function were all positively correlated with scores for externalizing problems, internalizing problems, and total difficulties ( β =0.07-0.32, all P <0.05). Conclusions Children s executive function is closely associated with emotional and behavioral problems, and those with poorer executive function exhibit more pronounced emotional and behavioral problems. Improving children s executive function may help promote their mental health.

Objective:To analyze postictal electroencephalographic(EEG) characteristics of patients with status epilepticus (SE) based on the score of grand total electroencephalography (GTE), and explore the relationship between electroencephalographic characteristics of SE and clinical prognosis.Methods:A total of 110 SE patients were enrolled in the Department of Neurology, the Affiliated Hospital of Yangzhou University from September 1, 2021 to September 1, 2023. EEG and GTE scores were performed in all patients after seizures (0-2 days after the cessation of SE). After one year of discharge, the medication and seizure status of patients were followed up by phone or outpatient visits. The seizure outcomes were recorded according to the international league against epilepsy (ILAE) seizure outcome classification, with favorable outcomes defined as good prognosis group ( n=54) and unfavorable outcomes defined as poor prognosis group ( n=56). SPSS 27.0 software was used for statistical analysis. Binary Logistic regression analysis was employed to screen impact variables of prognosis. The receiver operating characteristic(ROC) curve was plotted to determine the optimal cut-off point for predicting prognosis in epilepsy. Results:There were statistically significant differences in the total GTE score(2(1, 4), 8(5, 10); Z=-6.837, P<0.001), diffuse slow activity(0(0, 1), 2(0, 2); Z=-6.495, P<0.001), reactivity of the rhythmic background activity(0(0, 0), 0(0, 1); Z=-2.705, P=0.007), paroxysmal activity(0(0, 0), 1.5(0, 3.0); Z=-4.420, P<0.001), focal disturbances(0(0, 0), 0(0, 0); Z=-2.130, P=0.033), and sharp wave activity(0(0, 2), 2(2, 3); Z=-5.714, P<0.001)between the good prognosis group and poor prognosis group. The differences in EEG results among SE patients with different types of epileptic seizures were statistically significant in terms of frequency of rhythmic background activity, diffuse slow activity, reactivity of rhythmic background activity and total GTE score (all P<0.05). The differences in EEG results between SE patients with clear and unknown causes were statistically significant in terms of paroxysmal activity and focal disturbances(both P<0.05). The results of binary Logistic regression analysis showed that independent factors associated with the prognosis of SE included medication adherence ( B=-0.496, OR=0.609, 95% CI=0.395-0.940, P=0.025), diffuse slow activity( B=1.580, OR=4.854, 95% CI=1.586-14.855, P=0.006), sharp wave activity( B=0.824, OR=2.280, 95% CI=1.210-4.297, P=0.011), and total GTE score ( B=0.561, OR=1.753, 95% CI=1.360-2.259, P<0.001). In evaluating the prognosis of SE, the GTE score had a certain sensitivity (74.6%) and specificity (85.1%), with a optimal cut-off point of 6. Conclusions:The differences in EEG results among SE patients with different types of epileptic seizures were statistically significant in terms of frequency of rhythmic background activity, diffuse slow activity, reactivity of rhythmic background activity. The appearance of diffuse slow activity and sharp wave activity in the electroencephalogram of SE patients indicates poor prognosis, and the total GTE score≥6 may be a strong predictor of poor prognosis. However, good medication adherence is a protective factor for epilepsy recurrence.

Objective To investigate the damage of pepsin to the mucosal epithelium of the pharynx under a-cidic and non-acidic conditions,and to provide new ideas for the treatment of refractory laryngopharyngeal reflux diseases.Methods A total of 30 healthy guinea pigs were selected and randomly divided into 3 groups(with 10 in each group).The animals in group A were perfused with 0.3％pepsin+hydrochloric acid solution(pH=2),the animals in group B were perfused with 0.3％pepsin+sterilized distilled water(pH=7),and the animals in group C were perfused with sterilized distilled water(pH=7).After 14 days of perfusion,the mucosal tissues of the post-cyclic area were examined by HE staining,immunohistochemistry,and transmission electron microscopy to detect the degree of inflammatory cell infiltration,the expression of occludin and claudin-3 proteins,the degree of epithelial cell gap widening,and also to analyze the changes of cell submicroscopic structure under electron microscopy.Re-sults ① The submucosal leukocyte count was 28.61±7.10 in group A,29.89±7.04 in group B,and 7.81±1.40 in group C.Compared with group C,the leukocyte count was higher in group A and group B(P＜0.05).② Com-pared with group C,both occludin and claudin-3 protein expression were downregulated in group A(P＜0.05),compared with group C,the difference between occludin and claudin-3 protein expression in group B was not statisti-cally significant(P＞0.05).③ Under electron microscopy,the mucosal epithelial cell gap was widened,the mito-chondria was swollen and the cristae was degraded in group A.In group B,there was no widening of the mucosal epithelial cell gap,but the mitochondria in the cytoplasm was swollen and the cristae was degraded,and there was no widening of mucosal epithelial cell gap and the morphological markers of mitochondria were clear in group C.Conclusion Under non-acidic conditions,pepsin still can cause inflammatory changes and mitochondrial damage in the mucosal epithelium of the pharynx.

Objective:To integrate implicit templates with deep learning techniques, a novel neural network, the tooth-deformable deep implicit network (T-DDIN), was constructed to achieve high-precision shape completion of tooth defects in a personalized manner.Methods:A total of 550 intraoral scan models were collected from patients treated at the Department of Orthodontics and Department of Prosthodontics, West China Hospital of Stomatology, Sichuan University (500 for training and 50 for testing), between March 2022 and March 2024. T-DDIN reconstructed defective tooth morphology using an implicit template and a latent encoding prediction network. During model evaluation, Class Ⅱ cavity defects and occlusal wear defects were simulated in the test set. Morphological restoration was performed using both traditional computer aided design (CAD) methods and the T-DDIN deep learning approach. The two methods were compared based on three-dimensional deviation, occlusal adjustment volumes, cusp angle deviation, and restoration time.Results:The T-DDIN group demonstrated significantly lower three-dimensional deviation for Class Ⅱ cavity defects and occlusal wear restoration [(0.14±0.05) and (0.16±0.09) mm], occlusal adjustment volumes [(0.44±0.03) and (0.49±0.03) mm 3], and difference value of the tooth cusp angles (5.69°±1.90° and 6.04°±0.53°) compared to the traditional CAD group (both P<0.001). No significant differences were observed within the T-DDIN group between the two defect types in terms of three-dimensional deviation ( P=0.098) or occlusal adjustment volume ( P=0.154) or difference value of the tooth cusp angles ( P=0.196). However, in the traditional CAD group, three-dimensional deviation, occlusal adjustment volume and difference value of the tooth cusp angles was significantly higher in occlusal wear restorations than in Class Ⅱ cavity defects restorations ( P<0.001). The T-DDIN group, which involved Class Ⅱ cavity defects and occlusal wear, demonstrated significantly less recovery time of morphology (37.2±7.7) and (39.4±6.2) s compared to the traditional CAD group ( P<0.001). Conclusions:T-DDIN demonstrated superior stability and accuracy in morphological reconstruction for various types of dental defects while significantly reducing restoration time.

Objective To investigate the distribution and antimicrobial resistance profiles of clinically isolated Haemophilus influenzae and Moraxella catarrhalis in hospitals across China from 2015 to 2021,and provide evidence for rational use of antimicrobial agents.Methods Data of H.influenzae and M.catarrhalis strains isolated from 2015 to 2021 in CHINET program were collected for analysis,and antimicrobial susceptibility testing was performed by disc diffusion method or automated systems according to the uniform protocol of CHINET.The results were interpreted according to the CLSI breakpoints in 2022.Beta-lactamases was detected by using nitrocefin disk.Results From 2015 to 2021,a total of 43 642 strains of Haemophilus species were isolated,accounting for 2.91％of the total clinical isolates and 4.07％of Gram-negative bacteria in CHINET program.Among the 40 437 strains of H.influenzae,66.89％were isolated from children and 33.11％were isolated from adults.More than 90％of the H.influenzae strains were isolated from respiratory tract specimens.The prevalence of β-lactamase was 53.79％in H.influenzae strains.The H.influenzae strains isolated from children showed higher resistance rate than the strains isolated from adults.Overall,779 strains of H.influenzae did not produce β-lactamase but were resistant to ampicillin(BLNAR).Beta-lactamase-producing strains showed significantly higher resistance rates to these antimicrobial agents than the β-lactamase-nonproducing strains.Of the 16 191 M.catarrhalis strains,80.06％were isolated from children and 19.94％isolated from adults.M.catarrhalis strains were mostly susceptible to both amoxicillin-clavulanic acid and cefuroxime,evidenced by resistance rate lower than 2.0％.Conclusions The emergence of antibiotic-resistant H.influenzae due to β-lactamase production poses a challenge for clinical anti-infective treatment.Therefore,it is very important to implement antibiotic resistance surveillance for H.influenzae and guide rational antibiotic use.All local clinical microbiology laboratories should actively improve antibiotic susceptibility testing and strengthen antibiotic resistance surveillance for H.influenzae.

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.

This paper provides a review on the concept, current status, assessment tools, influencing factors, and intervention strategies regarding the compliance of lymphedema prevention behaviors in postoperative breast cancer patients. The aim is to improve the compliance of lymphedema prevention behaviors in these patients, reduce the incidence of lymphedema, and provide a reference for future clinical intervention studies in this field.