1.Analysis of the current status and related factors of antiviral treatment for chronic hepatitis B virus infection in rural communities of Zhangqiu District, Jinan City
Xiaomeng ZHANG ; Bingyu YAN ; Jingjing LYU ; Yi FENG ; Xin MENG ; Chuanzhao CAO ; Li ZHANG
Chinese Journal of Preventive Medicine 2025;59(3):286-291
Objective:To investigate the current status and related factors of antiviral treatment for chronic hepatitis B virus (HBV) infection in rural communities in China.Methods:In 2023, 866 chronic HBV-infected individuals from rural communities in Zhangqiu District, Jinan City, were included in the study. Basic information, disease status and antiviral treatment conditions of the infected individuals were collected through questionnaires, specimen collection and laboratory tests. Univariate and multivariate logistic regression were used to analyze the related factors of the antiviral treatment rate of those who met the indications for hepatitis B antiviral treatment.Results:The median age ( Q1, Q3) of subjects was 56 (48, 66) years old, among which 436 (50.4%) were males. There were 712 (82.2%) individuals who met the indications for hepatitis B antiviral treatment, and 110 individuals received antiviral treatment with a rate of 15.5%. Multivariate logistic regression analysis showed that compared with males, families with an average monthly income per capita of <1 000 yuan, no alcohol consumption, no smoking, and a family history of HBV infection, females ( OR=4.66, 95% CI: 2.88-7.53), families with an average monthly income per capita of 1 000-1 999 yuan ( OR=1.64, 95% CI: 1.00-2.68) and ≥2 000 yuan ( OR=2.78, 95% CI: 1.54-5.03), alcohol consumption ( OR=6.42, 95% CI: 2.80-14.7), smoking ( OR=1.98, 95% CI: 1.04-3.77), and no family history of HBV infection ( OR=1.90, 95% CI: 1.16-3.09) had a lower antiviral treatment rate for chronic HBV infection. Conclusion:The antiviral treatment rate of chronic HBV-infected individuals in rural communities of Zhangqiu District, Jinan City is low, and the related factors are female, high monthly income per capita, alcohol consumption, smoking, and no family history of HBV infection.
2.Gut microbiota and Parkinson's disease.
Lin WANG ; Ying CUI ; Bingyu HAN ; Yitong DU ; Kenish Sirajbhai SALEWALA ; Shiya WANG ; Wenlu ZHAO ; Hongxin ZHANG ; Sichen WANG ; Xinran XU ; Jianpeng MA ; Yan ZHU ; Houzhen TUO
Chinese Medical Journal 2025;138(3):289-297
Emerging evidence suggests that dysbiosis of the gut microbiota is associated with the pathogenesis of Parkinson's disease (PD), a prevalent neurodegenerative disorder. The microbiota-gut-brain axis plays a crucial role in the development and progression of PD, and numerous studies have demonstrated the potential therapeutic benefits of modulations in the intestinal microbiota. This review provides insights into the characterization of the gut microbiota in patients with PD and highlights associations with clinical symptoms and underlying mechanisms. The discussion underscores the increased influence of the gut microbiota in the pathogenesis of PD. While the relationship is not fully elucidated, existing research demonstrates a strong correlation between changes in the composition of gut microbiota and disease development, and further investigation is warranted to explain the specific underlying mechanisms.
Humans
;
Parkinson Disease/microbiology*
;
Gastrointestinal Microbiome/physiology*
;
Dysbiosis/microbiology*
3.Comprehensive Application of AHP-CRITIC Hybrid Weighting Method, Grey Correlation Analysis and BP-ANN in Optimization of Extraction Process of Qizhi Prescription
Qun LAN ; Yi CHENG ; Zian LI ; Bingyu WU ; Jinyu WANG ; Dewen LIU ; Yan TONG
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(8):176-186
ObjectiveBased on analytic hierarchy process(AHP)-criteria importance through intercriteria correlation(CRITIC) hybrid weighting method, grey relational analysis and backpropagation artificial neural network(BP-ANN), to optimize the water extraction process of Qizhi prescription, so as to provide an experimental basis for optimization of the preparation process of this prescription and the establishment of quality standards. MethodsL9(34) orthogonal test was employed, and the AHP-CRITIC hybrid weighting method was utilized to determine the weight coefficients of the quality fractions of various components, including astragaloside Ⅳ, polygalaxanthone Ⅲ, calycosin-7-O-β-D-glucoside, tenuifolin, and 3,6′-disinapoylsucrose, as well as the dry extract yield. The comprehensive score of each factor level combination in the orthogonal test were calculated as evaluation indicator to select the optimal extraction process parameters. The effects of extraction times, extraction time, and solvent dosage on the aqueous extraction process of the formula were investigated through intuitive analysis, variance analysis, and grey relational analysis. Meanwhile, a BP-ANN model was established to reverse-predict the optimal extraction process parameters of Qizhi prescription, and the optimized process parameters were validated. ResultsThe weight coefficients of the five index components(astragaloside Ⅳ, tenuifolin, calycosin-7-O-β-D-glucoside, polygalaxanthone Ⅲ, and 3,6′-disinapoylsucrose) and dry extract yield were 25.7%, 20.82%, 16.41%, 12.45%, 15.96% and 8.67%, respectively. The optimized extraction process parameters were extracted 3 times with 8, 6, 6 times the amount of water, each time for 1 h. The network prediction results of BP-ANN test samples were consistent with the orthogonal test results, and the mean square error(MSE) of the predicted and measured values of the network was <1%. The water extraction process of Qizhi prescription analyzed and predicted by relevant mathematical models was stable and feasible, which could effectively improve the extraction efficiency of the active ingredients of Astragali Radix and Polygalae Radix, and the average comprehensive score of the validation test was 90.85 with the relative standard deviation(RSD) of 1.55%. ConclusionThis study establishes a water extraction process for compound Qizhi granules, and the optimized extraction process can effectively improve the extraction efficiency of active ingredients, which provides useful references for the optimization of preparation process and the establishment of quality standards for other clinical experience formulas.
4.Association between cardiometabolic multimorbidity and mild cognitive impairment among older adults in urban communities
Bingyu ZHANG ; Jingjing ZHANG ; Cheng CAI ; Juan ZHOU ; Jing LIU ; Xiaoyu LOU ; Yan ZENG ; Guirong CHENG ; Dan LIU
Chinese Journal of Geriatrics 2025;44(12):1757-1765
Objective:To explore the association between cardiometabolic multimorbidity(CMM), the number of cardiometabolic diseases(CMD)and mild cognitive impairment(MCI)among the older adults in urban communities.Methods:Based on the baseline data of the Hubei Memory and Aging Cohort Study(HMACS)from 2018 to 2023, CMM was defined as the coexistence of two or more CMDs(Type 2 diabetes, stroke and ischemic heart disease). Multivariate logistic regression was employed to examine the association between CMM, the number of CMDs and the prevalence of MCI, as well as subgroup heterogeneity.Results:This study included 6 113 urban participants aged ≥65 years(55.6% were female; mean age 71.9±5.7 years). The prevalence of MCI was 19.3%, with an increasing trend observed as the number of CMD increased(17.7%, 20.5%, 24.6%, 28.3%). After adjusting for all variables, a significant association was observed between CMM group and the prevalence of MCI( OR: 1.24, 95% CI: 1.01-1.52)compared with the non-CMM group.As the number of CMD increased, the prevalence of MCI increased( Ptrend=0.011), but the association was only significant in the group with two CMDs.Subgroup analyses revealed that in males( OR: 1.48, 95% CI: 1.10-2.00), those with more than 9 years of education( OR: 1.52, 95% CI: 1.15-2.02), and those with hypertension( OR: 1.33, 95% CI: 1.05-1.67), CMM was significantly associated with MCI, and the association with MCI increased significantly with the increase in the number of CMDs(all Pfor trend <0.05). Conclusions:Among urban community-dwelling older adults aged ≥65 years in China, CMM and the cumulative number of CMDs are significantly associated with an increase of MCI, particularly in males, those with higher education levels, and those with hypertension.In the future, the need for enhanced MCI screening for CMM patients should be strengthened, and targeted prevention and control of cognitive impairment should be implemented for high-risk populations.
5.Development and evaluation of a protection motivation questionnaire for frailty management in the elderly
Guanxiu TANG ; Jia LIU ; Yue HE ; Bingyu PENG ; Jiarong LI ; Pingping YAN
Chinese Journal of Geriatrics 2025;44(12):1772-1778
Objective:To develop a Protection Motivation Questionnaire(PMQ)for frailty management in the elderly based on the Protection Motivation Theory(PMT), and test its reliability and validity.Methods:Guided by PMT, the initial questionnaire items were formulated through literature review, semi-structured interviews, and Delphi expert consultation.A total of 551 elderly patients with frailty from a tertiary hospital in Changsha were investigated.Item screening was conducted via critical ratio method, Cronbach's α coefficient, correlation analysis, and factor analysis.The reliability was assessed through internal consistency and test-retest reliability, while validity was evaluated via content validity and structural validity.Results:The final PMQ comprised 25 items across five dimensions: severity, susceptibility, response efficacy, response cost, and self-efficacy.The overall Cronbach's α coefficient was 0.818, with subscale coefficients ranging from 0.701 to 0.821.The split-half reliability was 0.811, test-retest reliability was 0.929, and content validity indexwas 0.86.Exploratory factor analysis extracted five factors, accounting for 52.0% of the cumulative variance.Confirmatory factor analysis demonstrated good model fit( χ2/df=1.626, RMSEA=0.05, CFI =0.914). Conclusions:The developed questionnaire exhibits strong reliability and validity, serving as an effective tool to assess protection motivation for frailty management in the elderly.
6.Analysis of the current status and related factors of antiviral treatment for chronic hepatitis B virus infection in rural communities of Zhangqiu District, Jinan City
Xiaomeng ZHANG ; Bingyu YAN ; Jingjing LYU ; Yi FENG ; Xin MENG ; Chuanzhao CAO ; Li ZHANG
Chinese Journal of Preventive Medicine 2025;59(3):286-291
Objective:To investigate the current status and related factors of antiviral treatment for chronic hepatitis B virus (HBV) infection in rural communities in China.Methods:In 2023, 866 chronic HBV-infected individuals from rural communities in Zhangqiu District, Jinan City, were included in the study. Basic information, disease status and antiviral treatment conditions of the infected individuals were collected through questionnaires, specimen collection and laboratory tests. Univariate and multivariate logistic regression were used to analyze the related factors of the antiviral treatment rate of those who met the indications for hepatitis B antiviral treatment.Results:The median age ( Q1, Q3) of subjects was 56 (48, 66) years old, among which 436 (50.4%) were males. There were 712 (82.2%) individuals who met the indications for hepatitis B antiviral treatment, and 110 individuals received antiviral treatment with a rate of 15.5%. Multivariate logistic regression analysis showed that compared with males, families with an average monthly income per capita of <1 000 yuan, no alcohol consumption, no smoking, and a family history of HBV infection, females ( OR=4.66, 95% CI: 2.88-7.53), families with an average monthly income per capita of 1 000-1 999 yuan ( OR=1.64, 95% CI: 1.00-2.68) and ≥2 000 yuan ( OR=2.78, 95% CI: 1.54-5.03), alcohol consumption ( OR=6.42, 95% CI: 2.80-14.7), smoking ( OR=1.98, 95% CI: 1.04-3.77), and no family history of HBV infection ( OR=1.90, 95% CI: 1.16-3.09) had a lower antiviral treatment rate for chronic HBV infection. Conclusion:The antiviral treatment rate of chronic HBV-infected individuals in rural communities of Zhangqiu District, Jinan City is low, and the related factors are female, high monthly income per capita, alcohol consumption, smoking, and no family history of HBV infection.
7.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.
8.Association between cardiometabolic multimorbidity and mild cognitive impairment among older adults in urban communities
Bingyu ZHANG ; Jingjing ZHANG ; Cheng CAI ; Juan ZHOU ; Jing LIU ; Xiaoyu LOU ; Yan ZENG ; Guirong CHENG ; Dan LIU
Chinese Journal of Geriatrics 2025;44(12):1757-1765
Objective:To explore the association between cardiometabolic multimorbidity(CMM), the number of cardiometabolic diseases(CMD)and mild cognitive impairment(MCI)among the older adults in urban communities.Methods:Based on the baseline data of the Hubei Memory and Aging Cohort Study(HMACS)from 2018 to 2023, CMM was defined as the coexistence of two or more CMDs(Type 2 diabetes, stroke and ischemic heart disease). Multivariate logistic regression was employed to examine the association between CMM, the number of CMDs and the prevalence of MCI, as well as subgroup heterogeneity.Results:This study included 6 113 urban participants aged ≥65 years(55.6% were female; mean age 71.9±5.7 years). The prevalence of MCI was 19.3%, with an increasing trend observed as the number of CMD increased(17.7%, 20.5%, 24.6%, 28.3%). After adjusting for all variables, a significant association was observed between CMM group and the prevalence of MCI( OR: 1.24, 95% CI: 1.01-1.52)compared with the non-CMM group.As the number of CMD increased, the prevalence of MCI increased( Ptrend=0.011), but the association was only significant in the group with two CMDs.Subgroup analyses revealed that in males( OR: 1.48, 95% CI: 1.10-2.00), those with more than 9 years of education( OR: 1.52, 95% CI: 1.15-2.02), and those with hypertension( OR: 1.33, 95% CI: 1.05-1.67), CMM was significantly associated with MCI, and the association with MCI increased significantly with the increase in the number of CMDs(all Pfor trend <0.05). Conclusions:Among urban community-dwelling older adults aged ≥65 years in China, CMM and the cumulative number of CMDs are significantly associated with an increase of MCI, particularly in males, those with higher education levels, and those with hypertension.In the future, the need for enhanced MCI screening for CMM patients should be strengthened, and targeted prevention and control of cognitive impairment should be implemented for high-risk populations.
9.Development and evaluation of a protection motivation questionnaire for frailty management in the elderly
Guanxiu TANG ; Jia LIU ; Yue HE ; Bingyu PENG ; Jiarong LI ; Pingping YAN
Chinese Journal of Geriatrics 2025;44(12):1772-1778
Objective:To develop a Protection Motivation Questionnaire(PMQ)for frailty management in the elderly based on the Protection Motivation Theory(PMT), and test its reliability and validity.Methods:Guided by PMT, the initial questionnaire items were formulated through literature review, semi-structured interviews, and Delphi expert consultation.A total of 551 elderly patients with frailty from a tertiary hospital in Changsha were investigated.Item screening was conducted via critical ratio method, Cronbach's α coefficient, correlation analysis, and factor analysis.The reliability was assessed through internal consistency and test-retest reliability, while validity was evaluated via content validity and structural validity.Results:The final PMQ comprised 25 items across five dimensions: severity, susceptibility, response efficacy, response cost, and self-efficacy.The overall Cronbach's α coefficient was 0.818, with subscale coefficients ranging from 0.701 to 0.821.The split-half reliability was 0.811, test-retest reliability was 0.929, and content validity indexwas 0.86.Exploratory factor analysis extracted five factors, accounting for 52.0% of the cumulative variance.Confirmatory factor analysis demonstrated good model fit( χ2/df=1.626, RMSEA=0.05, CFI =0.914). Conclusions:The developed questionnaire exhibits strong reliability and validity, serving as an effective tool to assess protection motivation for frailty management in the elderly.
10.Analysis of Brain Absorption Components and Their Distribution of Tianyuan Zhitong Prescription Based on UPLC-Q-TOF-MS and DESI-MSI
Yi CHENG ; Qun LAN ; Bingyu WU ; Jinyu WANG ; Dewen LIU ; Yan TONG
Chinese Journal of Experimental Traditional Medical Formulae 2024;30(12):166-172
ObjectiveTo investigate the brain absorption components of Tianyuan Zhitong prescription and their distribution based on ultra-high performance liquid chromatography-quadrupole-time-of-flight mass spectrometry(UPLC-Q-TOF-MS), desorption electrospray ionization mass spectrometry imaging(DESI-MSI) and hyperspectral imaging techniques. MethodTen BALB/c mice were randomly divided into blank group(n=3) and administration group(n=7), the administration group was gavaged with 0.3 mL of Tianyuan Zhitong prescription liquid at a concentration of about 5 g·mL-1 of the raw material, and the blank group was gavaged with an equal volume of normal saline, and the whole brain of the mice were taken for the preparation of tissue homogenates and frozen sections, respectively. The tissue homogenates were qualitatively analyzed by UPLC-Q-TOF-MS for the brain absorption components in positive and negative ion modes, frozen sections were used for imaging to observe the distribution of these components in the brain. Cytoviva dark-field enhancement microscope was used to perform hyperspectral imaging scanning on the brain sections of mice from each group, and the scattered light data of at least 1 000 pixels in the visible-near-infrared(400-1 000 nm) band in the microscopic field of view were collected and average spectrum were created, which were used to compare the components in the brain tissues of mice from the blank and administration groups. ResultA total of 27 brain absorption components of Tianyuan Zhitong prescription were identified by UPLC-Q-TOF-MS, including 10 organic acids, 5 glycosides, 4 alkaloids, 1 phenol, 4 flavonoids, 2 phthalides and 1 other compound, which were mainly derived from Gastrodiae Rhizoma, Chuanxiong Rhizoma, vinegar-processed Corydalis Rhizoma, Ziziphi Spinosae Semen and processed Morindae Officinalis Radix. A total of 14 components were identified by mass spectrometry imaging, of which ferulic acid, tetrahydropalmatine and N-methyl dehydroberberine were mainly distributed in the cerebral cortex, vitamin B5, vemonoic acid and ricinoleic acid were mainly distributed in the hypothalamus, elemicin, octadecenic acid and octadecanoic acid were mainly distributed in the cortex and hypothalamus, while senkyunolide B, ligustilide, linoleic acid, 9,12-octadecadienoyl ethyl ester and spinosin were distributed in most regions of the brain tissues. Hyperspectral imaging showed that in the visible-near-infrared band range, the average spectrum of the brain tissues of mice in the administration group was significantly red-shifted, indicating that there were differences in the physical properties or contents of the chemical components in the brain between mice in the blank group and those in the administration group, and further verified the results of mass spectrometry imaging. ConclusionThrough the combination of UPLC-Q-TOF-MS and imaging techniques, the pharmacodynamic components of Tianyuan Zhitong prescription in the treatment of headache and the regional characteristics in brain tissue are clarified, which can provide reference for the selection of the index components of the research on the quality standard of this prescription and the research on the mechanism of the pharmacological effect.

Result Analysis
Print
Save
E-mail