1.Comprehensive Application of AHP-CRITIC Hybrid Weighting Method, Grey Correlation Analysis and BP-ANN in Optimization of Extraction Process of Qizhi Prescription
Qun LAN ; Yi CHENG ; Zian LI ; Bingyu WU ; Jinyu WANG ; Dewen LIU ; Yan TONG
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(8):176-186
ObjectiveBased on analytic hierarchy process(AHP)-criteria importance through intercriteria correlation(CRITIC) hybrid weighting method, grey relational analysis and backpropagation artificial neural network(BP-ANN), to optimize the water extraction process of Qizhi prescription, so as to provide an experimental basis for optimization of the preparation process of this prescription and the establishment of quality standards. MethodsL9(34) orthogonal test was employed, and the AHP-CRITIC hybrid weighting method was utilized to determine the weight coefficients of the quality fractions of various components, including astragaloside Ⅳ, polygalaxanthone Ⅲ, calycosin-7-O-β-D-glucoside, tenuifolin, and 3,6′-disinapoylsucrose, as well as the dry extract yield. The comprehensive score of each factor level combination in the orthogonal test were calculated as evaluation indicator to select the optimal extraction process parameters. The effects of extraction times, extraction time, and solvent dosage on the aqueous extraction process of the formula were investigated through intuitive analysis, variance analysis, and grey relational analysis. Meanwhile, a BP-ANN model was established to reverse-predict the optimal extraction process parameters of Qizhi prescription, and the optimized process parameters were validated. ResultsThe weight coefficients of the five index components(astragaloside Ⅳ, tenuifolin, calycosin-7-O-β-D-glucoside, polygalaxanthone Ⅲ, and 3,6′-disinapoylsucrose) and dry extract yield were 25.7%, 20.82%, 16.41%, 12.45%, 15.96% and 8.67%, respectively. The optimized extraction process parameters were extracted 3 times with 8, 6, 6 times the amount of water, each time for 1 h. The network prediction results of BP-ANN test samples were consistent with the orthogonal test results, and the mean square error(MSE) of the predicted and measured values of the network was <1%. The water extraction process of Qizhi prescription analyzed and predicted by relevant mathematical models was stable and feasible, which could effectively improve the extraction efficiency of the active ingredients of Astragali Radix and Polygalae Radix, and the average comprehensive score of the validation test was 90.85 with the relative standard deviation(RSD) of 1.55%. ConclusionThis study establishes a water extraction process for compound Qizhi granules, and the optimized extraction process can effectively improve the extraction efficiency of active ingredients, which provides useful references for the optimization of preparation process and the establishment of quality standards for other clinical experience formulas.
2.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.
3.Gut microbiota and Parkinson's disease.
Lin WANG ; Ying CUI ; Bingyu HAN ; Yitong DU ; Kenish Sirajbhai SALEWALA ; Shiya WANG ; Wenlu ZHAO ; Hongxin ZHANG ; Sichen WANG ; Xinran XU ; Jianpeng MA ; Yan ZHU ; Houzhen TUO
Chinese Medical Journal 2025;138(3):289-297
Emerging evidence suggests that dysbiosis of the gut microbiota is associated with the pathogenesis of Parkinson's disease (PD), a prevalent neurodegenerative disorder. The microbiota-gut-brain axis plays a crucial role in the development and progression of PD, and numerous studies have demonstrated the potential therapeutic benefits of modulations in the intestinal microbiota. This review provides insights into the characterization of the gut microbiota in patients with PD and highlights associations with clinical symptoms and underlying mechanisms. The discussion underscores the increased influence of the gut microbiota in the pathogenesis of PD. While the relationship is not fully elucidated, existing research demonstrates a strong correlation between changes in the composition of gut microbiota and disease development, and further investigation is warranted to explain the specific underlying mechanisms.
Humans
;
Parkinson Disease/microbiology*
;
Gastrointestinal Microbiome/physiology*
;
Dysbiosis/microbiology*
4.Analysis of Brain Absorption Components and Their Distribution of Tianyuan Zhitong Prescription Based on UPLC-Q-TOF-MS and DESI-MSI
Yi CHENG ; Qun LAN ; Bingyu WU ; Jinyu WANG ; Dewen LIU ; Yan TONG
Chinese Journal of Experimental Traditional Medical Formulae 2024;30(12):166-172
ObjectiveTo investigate the brain absorption components of Tianyuan Zhitong prescription and their distribution based on ultra-high performance liquid chromatography-quadrupole-time-of-flight mass spectrometry(UPLC-Q-TOF-MS), desorption electrospray ionization mass spectrometry imaging(DESI-MSI) and hyperspectral imaging techniques. MethodTen BALB/c mice were randomly divided into blank group(n=3) and administration group(n=7), the administration group was gavaged with 0.3 mL of Tianyuan Zhitong prescription liquid at a concentration of about 5 g·mL-1 of the raw material, and the blank group was gavaged with an equal volume of normal saline, and the whole brain of the mice were taken for the preparation of tissue homogenates and frozen sections, respectively. The tissue homogenates were qualitatively analyzed by UPLC-Q-TOF-MS for the brain absorption components in positive and negative ion modes, frozen sections were used for imaging to observe the distribution of these components in the brain. Cytoviva dark-field enhancement microscope was used to perform hyperspectral imaging scanning on the brain sections of mice from each group, and the scattered light data of at least 1 000 pixels in the visible-near-infrared(400-1 000 nm) band in the microscopic field of view were collected and average spectrum were created, which were used to compare the components in the brain tissues of mice from the blank and administration groups. ResultA total of 27 brain absorption components of Tianyuan Zhitong prescription were identified by UPLC-Q-TOF-MS, including 10 organic acids, 5 glycosides, 4 alkaloids, 1 phenol, 4 flavonoids, 2 phthalides and 1 other compound, which were mainly derived from Gastrodiae Rhizoma, Chuanxiong Rhizoma, vinegar-processed Corydalis Rhizoma, Ziziphi Spinosae Semen and processed Morindae Officinalis Radix. A total of 14 components were identified by mass spectrometry imaging, of which ferulic acid, tetrahydropalmatine and N-methyl dehydroberberine were mainly distributed in the cerebral cortex, vitamin B5, vemonoic acid and ricinoleic acid were mainly distributed in the hypothalamus, elemicin, octadecenic acid and octadecanoic acid were mainly distributed in the cortex and hypothalamus, while senkyunolide B, ligustilide, linoleic acid, 9,12-octadecadienoyl ethyl ester and spinosin were distributed in most regions of the brain tissues. Hyperspectral imaging showed that in the visible-near-infrared band range, the average spectrum of the brain tissues of mice in the administration group was significantly red-shifted, indicating that there were differences in the physical properties or contents of the chemical components in the brain between mice in the blank group and those in the administration group, and further verified the results of mass spectrometry imaging. ConclusionThrough the combination of UPLC-Q-TOF-MS and imaging techniques, the pharmacodynamic components of Tianyuan Zhitong prescription in the treatment of headache and the regional characteristics in brain tissue are clarified, which can provide reference for the selection of the index components of the research on the quality standard of this prescription and the research on the mechanism of the pharmacological effect.
5.Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients (version 2024)
Yao LU ; Yang LI ; Leiying ZHANG ; Hao TANG ; Huidan JING ; Yaoli WANG ; Xiangzhi JIA ; Li BA ; Maohong BIAN ; Dan CAI ; Hui CAI ; Xiaohong CAI ; Zhanshan ZHA ; Bingyu CHEN ; Daqing CHEN ; Feng CHEN ; Guoan CHEN ; Haiming CHEN ; Jing CHEN ; Min CHEN ; Qing CHEN ; Shu CHEN ; Xi CHEN ; Jinfeng CHENG ; Xiaoling CHU ; Hongwang CUI ; Xin CUI ; Zhen DA ; Ying DAI ; Surong DENG ; Weiqun DONG ; Weimin FAN ; Ke FENG ; Danhui FU ; Yongshui FU ; Qi FU ; Xuemei FU ; Jia GAN ; Xinyu GAN ; Wei GAO ; Huaizheng GONG ; Rong GUI ; Geng GUO ; Ning HAN ; Yiwen HAO ; Wubing HE ; Qiang HONG ; Ruiqin HOU ; Wei HOU ; Jie HU ; Peiyang HU ; Xi HU ; Xiaoyu HU ; Guangbin HUANG ; Jie HUANG ; Xiangyan HUANG ; Yuanshuai HUANG ; Shouyong HUN ; Xuebing JIANG ; Ping JIN ; Dong LAI ; Aiping LE ; Hongmei LI ; Bijuan LI ; Cuiying LI ; Daihong LI ; Haihong LI ; He LI ; Hui LI ; Jianping LI ; Ning LI ; Xiying LI ; Xiangmin LI ; Xiaofei LI ; Xiaojuan LI ; Zhiqiang LI ; Zhongjun LI ; Zunyan LI ; Huaqin LIANG ; Xiaohua LIANG ; Dongfa LIAO ; Qun LIAO ; Yan LIAO ; Jiajin LIN ; Chunxia LIU ; Fenghua LIU ; Peixian LIU ; Tiemei LIU ; Xiaoxin LIU ; Zhiwei LIU ; Zhongdi LIU ; Hua LU ; Jianfeng LUAN ; Jianjun LUO ; Qun LUO ; Dingfeng LYU ; Qi LYU ; Xianping LYU ; Aijun MA ; Liqiang MA ; Shuxuan MA ; Xainjun MA ; Xiaogang MA ; Xiaoli MA ; Guoqing MAO ; Shijie MU ; Shaolin NIE ; Shujuan OUYANG ; Xilin OUYANG ; Chunqiu PAN ; Jian PAN ; Xiaohua PAN ; Lei PENG ; Tao PENG ; Baohua QIAN ; Shu QIAO ; Li QIN ; Ying REN ; Zhaoqi REN ; Ruiming RONG ; Changshan SU ; Mingwei SUN ; Wenwu SUN ; Zhenwei SUN ; Haiping TANG ; Xiaofeng TANG ; Changjiu TANG ; Cuihua TAO ; Zhibin TIAN ; Juan WANG ; Baoyan WANG ; Chunyan WANG ; Gefei WANG ; Haiyan WANG ; Hongjie WANG ; Peng WANG ; Pengli WANG ; Qiushi WANG ; Xiaoning WANG ; Xinhua WANG ; Xuefeng WANG ; Yong WANG ; Yongjun WANG ; Yuanjie WANG ; Zhihua WANG ; Shaojun WEI ; Yaming WEI ; Jianbo WEN ; Jun WEN ; Jiang WU ; Jufeng WU ; Aijun XIA ; Fei XIA ; Rong XIA ; Jue XIE ; Yanchao XING ; Yan XIONG ; Feng XU ; Yongzhu XU ; Yongan XU ; Yonghe YAN ; Beizhan YAN ; Jiang YANG ; Jiangcun YANG ; Jun YANG ; Xinwen YANG ; Yongyi YANG ; Chunyan YAO ; Mingliang YE ; Changlin YIN ; Ming YIN ; Wen YIN ; Lianling YU ; Shuhong YU ; Zebo YU ; Yigang YU ; Anyong YU ; Hong YUAN ; Yi YUAN ; Chan ZHANG ; Jinjun ZHANG ; Jun ZHANG ; Kai ZHANG ; Leibing ZHANG ; Quan ZHANG ; Rongjiang ZHANG ; Sanming ZHANG ; Shengji ZHANG ; Shuo ZHANG ; Wei ZHANG ; Weidong ZHANG ; Xi ZHANG ; Xingwen ZHANG ; Guixi ZHANG ; Xiaojun ZHANG ; Guoqing ZHAO ; Jianpeng ZHAO ; Shuming ZHAO ; Beibei ZHENG ; Shangen ZHENG ; Huayou ZHOU ; Jicheng ZHOU ; Lihong ZHOU ; Mou ZHOU ; Xiaoyu ZHOU ; Xuelian ZHOU ; Yuan ZHOU ; Zheng ZHOU ; Zuhuang ZHOU ; Haiyan ZHU ; Peiyuan ZHU ; Changju ZHU ; Lili ZHU ; Zhengguo WANG ; Jianxin JIANG ; Deqing WANG ; Jiongcai LAN ; Quanli WANG ; Yang YU ; Lianyang ZHANG ; Aiqing WEN
Chinese Journal of Trauma 2024;40(10):865-881
Patients with severe trauma require an extremely timely treatment and transfusion plays an irreplaceable role in the emergency treatment of such patients. An increasing number of evidence-based medicinal evidences and clinical practices suggest that patients with severe traumatic bleeding benefit from early transfusion of low-titer group O whole blood or hemostatic resuscitation with red blood cells, plasma and platelet of a balanced ratio. However, the current domestic mode of blood supply cannot fully meet the requirements of timely and effective blood transfusion for emergency treatment of patients with severe trauma in clinical practice. In order to solve the key problems in blood supply and blood transfusion strategies for emergency treatment of severe trauma, Branch of Clinical Transfusion Medicine of Chinese Medical Association, Group for Trauma Emergency Care and Multiple Injuries of Trauma Branch of Chinese Medical Association, Young Scholar Group of Disaster Medicine Branch of Chinese Medical Association organized domestic experts of blood transfusion medicine and trauma treatment to jointly formulate Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients ( version 2024). Based on the evidence-based medical evidence and Delphi method of expert consultation and voting, 10 recommendations were put forward from two aspects of blood support mode and transfusion strategies, aiming to provide a reference for transfusion resuscitation in the emergency treatment of severe trauma and further improve the success rate of treatment of patients with severe trauma.
6.Anti-HBs persistence after primary vaccination with three doses of 5 μg recombinant hepatitis B vaccine among normal and high-responder infants: 10-year of follow-up
Xin MENG ; Jingjing LYU ; Yi FENG ; Xuan DOU ; Xue ZHAO ; Xiaofeng LIANG ; Fuzhen WANG ; Aiqiang XU ; Bingyu YAN ; Li ZHANG
Chinese Journal of Preventive Medicine 2022;56(6):794-799
Objective:Assess the 10-year Immune persistence and the predictors after primary vaccination hepatitis B vaccine (HepB) among normal and high-responder infants.Methods:A total of 1 838 Infants of 7-12 months old located in Jinan, Weifang, Yantai and Weihai of Shandong Province who were induced normal or high antibody response (anti-HBs titer ≥ 100 mIU/ml) after primary vaccination (three dose with 0-1-6 procedure) with 5 μg recombinant HepB among newborns were included in the study, in 2009. 3 ml of venous blood samples were collected at baseline survey (T 0) and antibodies against hepatitis B surface antigen (anti-HBs), antibody against hepatitis B core antigen (anti-HBc) and hepatitis B surface antigen (HBsAg) were detected using chemiluminescence microparticle immunoassay (CMIA) method. A self-designed questionnaire was used to collect information including the infant′s age, sex, birth weight, premature birth, birth number, delivery location and mother′s HBV infection status. In 2014 (followed up for 5 years) and in 2019 (followed up for 10 years) (T 1), 2 ml of venous blood samples were collected. Anti HBS and anti HBC were detected by CMIA method. Those with anti HBS<10 mIU/ml were detected by CMIA method. Multivariate unconditional logistic and linear regression models were used to analyze the influencing factors of anti-HBs positive rate and geometric mean concentration (GMC) at T 1. Results:After 10 years follow-up, 73.94% of the subjects (1 359/1 835) finished the follow-up. 51.15% of the subjects, a total of 625 were boys. The positive rate of anti-HBs was 100% at T 0 and decreased to 53.44% (95% CI: 50.59%-56.26%) at T 1. The average annual decline rate of anti-HBs positive rate from T 0 to T 1 was 6.07%. The GMC of anti-HBs decreased from 607.89 (95% CI: 579.01-642.62) mIU/ml to 16.44 (95% CI: 15.06-18.00) mIU/ml. The average annual decline rate of anti-HBs GMC in 10-year follow-up was 30.30%. Multivariate logistic analysis showed that the positive rate of anti-HBs at T 1 was lower in those who did not vaccinate the first dose in time ( OR=0.25, 95% CI:0.07-0.71). Compared with those with GMC<1 000 mIU/ml at T 0, those with GMC ≥ 1 000 mIU/ml had a higher positive rate of anti-HBs at T 1 ( OR=2.29, 95% CI:1.76-2.97). Multivariate regression analysis showed that the GMC of anti-HBs at T 1 was lower in those who did not vaccinate the first dose in time (β=-0.50, 95% CI:-1.24-0.24). Compared with those with GMC<1 000 mIU/ml at T 0, those with GMC ≥ 1 000 mIU/ml had a higher GMC of anti-HBs at T 1 (β=0.81, 95% CI: 0.62-1.05). Conclusion:Anti-HBs GMC decreased in 10 years after primary vaccination of 5 μg recombinant hepatitis B vaccine among normal and high-responders. The anti-HBs persistence was mainly associated with whether the first dose was vaccinated in time and the level of anti-HBs at the end of primary vaccination.
7.Anti-HBs persistence after primary vaccination with three doses of 5 μg recombinant hepatitis B vaccine among normal and high-responder infants: 10-year of follow-up
Xin MENG ; Jingjing LYU ; Yi FENG ; Xuan DOU ; Xue ZHAO ; Xiaofeng LIANG ; Fuzhen WANG ; Aiqiang XU ; Bingyu YAN ; Li ZHANG
Chinese Journal of Preventive Medicine 2022;56(6):794-799
Objective:Assess the 10-year Immune persistence and the predictors after primary vaccination hepatitis B vaccine (HepB) among normal and high-responder infants.Methods:A total of 1 838 Infants of 7-12 months old located in Jinan, Weifang, Yantai and Weihai of Shandong Province who were induced normal or high antibody response (anti-HBs titer ≥ 100 mIU/ml) after primary vaccination (three dose with 0-1-6 procedure) with 5 μg recombinant HepB among newborns were included in the study, in 2009. 3 ml of venous blood samples were collected at baseline survey (T 0) and antibodies against hepatitis B surface antigen (anti-HBs), antibody against hepatitis B core antigen (anti-HBc) and hepatitis B surface antigen (HBsAg) were detected using chemiluminescence microparticle immunoassay (CMIA) method. A self-designed questionnaire was used to collect information including the infant′s age, sex, birth weight, premature birth, birth number, delivery location and mother′s HBV infection status. In 2014 (followed up for 5 years) and in 2019 (followed up for 10 years) (T 1), 2 ml of venous blood samples were collected. Anti HBS and anti HBC were detected by CMIA method. Those with anti HBS<10 mIU/ml were detected by CMIA method. Multivariate unconditional logistic and linear regression models were used to analyze the influencing factors of anti-HBs positive rate and geometric mean concentration (GMC) at T 1. Results:After 10 years follow-up, 73.94% of the subjects (1 359/1 835) finished the follow-up. 51.15% of the subjects, a total of 625 were boys. The positive rate of anti-HBs was 100% at T 0 and decreased to 53.44% (95% CI: 50.59%-56.26%) at T 1. The average annual decline rate of anti-HBs positive rate from T 0 to T 1 was 6.07%. The GMC of anti-HBs decreased from 607.89 (95% CI: 579.01-642.62) mIU/ml to 16.44 (95% CI: 15.06-18.00) mIU/ml. The average annual decline rate of anti-HBs GMC in 10-year follow-up was 30.30%. Multivariate logistic analysis showed that the positive rate of anti-HBs at T 1 was lower in those who did not vaccinate the first dose in time ( OR=0.25, 95% CI:0.07-0.71). Compared with those with GMC<1 000 mIU/ml at T 0, those with GMC ≥ 1 000 mIU/ml had a higher positive rate of anti-HBs at T 1 ( OR=2.29, 95% CI:1.76-2.97). Multivariate regression analysis showed that the GMC of anti-HBs at T 1 was lower in those who did not vaccinate the first dose in time (β=-0.50, 95% CI:-1.24-0.24). Compared with those with GMC<1 000 mIU/ml at T 0, those with GMC ≥ 1 000 mIU/ml had a higher GMC of anti-HBs at T 1 (β=0.81, 95% CI: 0.62-1.05). Conclusion:Anti-HBs GMC decreased in 10 years after primary vaccination of 5 μg recombinant hepatitis B vaccine among normal and high-responders. The anti-HBs persistence was mainly associated with whether the first dose was vaccinated in time and the level of anti-HBs at the end of primary vaccination.
8.Genome mining combined metabolic shunting and OSMAC strategy of an endophytic fungus leads to the production of diverse natural products.
Qian WEI ; Jian BAI ; Daojiang YAN ; Xiuqi BAO ; Wenting LI ; Bingyu LIU ; Dan ZHANG ; Xiangbing QI ; Dequan YU ; Youcai HU
Acta Pharmaceutica Sinica B 2021;11(2):572-587
Endophytic fungi are promising producers of bioactive small molecules. Bioinformatic analysis of the genome of an endophytic fungus
9.Analysis of capability to pertussis etiology and serological diagnosis for GradeⅡ and Ⅲmedical institutions in Shandong Province in 2018
Xuan DOU ; Jingjing LYU ; Lei FENG ; Bingyu YAN ; Yi FENG ; Xue ZHAO ; Aiqiang XU ; Li ZHANG
Chinese Journal of Preventive Medicine 2021;55(6):727-731
Objective:Investigate and analyze the etiology and serological diagnosis capabilities of pertussis in medical institutions in Shandong Province in 2018.Methods:Using the census method, a questionnaire survey was conducted among 603 second and above level medical institutions in Shandong Province. The deadline for the survey was December 2018, and a total of 543 questionnaires have been recovered, and the validity rate of the questionnaires was 90%. Surveyed the pertussis etiology and serology test items (pertussis IgM and IgG, pertussis nucleic acid and pertussis bacterial culture) and the start time of each test item by questionnaire. The reported cases (confirmed cases and clinically diagnosed cases) between January 1, 2012 and December 31, 2018 were derived from the Chinese Disease Control and Prevention Information System according to the onset date. We used indicators such as fixed-base development speed, chain development speed, and chain growth speed for analysis. The chi test was used to analyze the differences in the composition ratio of medical institutions with detection ability in different levels and regions, and analyze the changes in the number of reported cases before and after the development of pertussis etiology and serology testing.Results:A total of 543 medical institutions accounted for 90.0% (543/603) of all secondary and above level medical institutions in the province, 356 secondary medical institutions (65.6%), and 187 tertiary medical institutions (34.4%). There were 10 medical institutions that carry out pertussis IgM, IgG and nucleic acid testing, accounting for 1.8% (10/543) of the surveyed medical institutions respectively. 2 medical institutions that carried out bacterial culture, accounting for 0.4% of the surveyed medical institutions (2/543). 20 medical institutions have carried out the above tests (8 secondary medical institutions and 12 tertiary medical institutions), accounting for 3.7% (20/543). The proportion of tertiary medical institutions with pertussis IgM, IgG detection and nucleic acid detection capabilities [6.42% (12/187)] was significantly higher than that of secondary medical institutions [2.25% (8/356)] ( χ2=6.01, P=0.014). From 2012 to 2018, the fixed base ratio development speed of reported cases was 3 834.69% in Shandong Province, among which medical institutions with etiology and serological testing capabilities reached 4 533.33%. In 13 medical institutions, the average annual number of reported cases after pertussis etiology and serological testing were higher than that of reported cases before testing. Conclusion:The ability of pertussis etiology and serology diagnosis of secondary and above medical institutions in Shandong Province needs to be improved.
10.Antibodies persistence after revaccination with three doses of hepatitis B vaccine in non-responsive adults: results from 8-year follow-up study
Bingyu YAN ; Jingjing LYU ; Yi FENG ; Chuanzhao CAO ; Xin MENG ; Xiaofeng LIANG ; Fuzhen WANG ; Aiqiang XU ; Li ZHANG
Chinese Journal of Epidemiology 2021;42(9):1546-1552
Objective:To evaluate the persistence of HBsAg-specific antibodies eight years after revaccination with hepatitis B vaccine (HepB) among adults who were non-responsive to primary immunization.Methods:From August to September 2009, rural communities in Zhangqiu district of Ji'nan city were selected as the study site. The subject's inclusion criteria were 18 to 49 years old, local resident population, without HBV infection history and HepB vaccination history, and good health status. Antibodies against hepatitis B surface antigen (anti-HBs) were detected in adults following the standard primary vaccination. Those who were non-responders (anti-HBs titer <10 mIU/ml) were revaccinated with three doses of HepB and included in the study. Blood samples were collected from all of them at one month (T 1), two years, four years, and eight years after revaccination. The three indexes of anti-HBs, hepatitis B surface antigen (HBsAg), together with antibody against hepatitis B core antigen (anti-HBc), were measured by chemiluminescence microparticle immunoassay (CMIA). Results:The proportion of subjects with anti-HBs titers ≥10 mIU/ml was 85.12% (549/645) at T 1, 60.60% (283/467) at two years, 55.90% (199/356) at four years and 55.09% (222/403) at eight years after revaccination. The first two years' annual decline rates, three to four years and five to eight years, were 15.62%, 3.96%, and 0.36%. The GMC of anti-HBs was 153.92 mIU/ml at T 1, 21.43 mIU/ml at two years, 15.02 mIU/ml at four years, and 13.68 mIU/ml at eight years. In the first two years, three to four years and five to eight years, the annual decline rate of GMC was 62.69%,16.28%, and 2.31%, respectively. Multivariable analysis showed that the titer of anti-HBs at T 1 was independently associated with the persistence of anti-HBs at eight years after revaccination. Compared with anti-HBs titer <100 mIU/ml , those whose anti-HBs titers were 100-mIU/ml and ≥1 000 mIU/ml at T 1 had a higher positive rate of anti-HBs ( OR=14.13, P<0.001; OR= 62.91, P<0.001) and a higher probability of anti-HBs titer ( β=1.88, P<0.001; β=3.24, P<0.001) at 8 years after revaccination. Nobody was found seroconversion of HBsAg, and the anti-HBc positive rate was 14.14% (57/403). Conclusions:Following revaccination with three doses of HepB in adults who were non-responsive to primary immunization, anti-HBs titers declined rapidly within the first four years. They then maintained a stable level after the fifth year. More than half still kept anti-HBs protective titer at eight years after revaccination. The immunity persistence was associated with anti-HBs titer at one month after revaccination.

Result Analysis
Print
Save
E-mail