Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Emerging evidence suggests that dysbiosis of the gut microbiota is associated with the pathogenesis of Parkinson's disease (PD), a prevalent neurodegenerative disorder. The microbiota-gut-brain axis plays a crucial role in the development and progression of PD, and numerous studies have demonstrated the potential therapeutic benefits of modulations in the intestinal microbiota. This review provides insights into the characterization of the gut microbiota in patients with PD and highlights associations with clinical symptoms and underlying mechanisms. The discussion underscores the increased influence of the gut microbiota in the pathogenesis of PD. While the relationship is not fully elucidated, existing research demonstrates a strong correlation between changes in the composition of gut microbiota and disease development, and further investigation is warranted to explain the specific underlying mechanisms.
Humans ; Parkinson Disease/microbiology* ; Gastrointestinal Microbiome/physiology* ; Dysbiosis/microbiology*

OBJECTIVE: To investigate the value of difference between hematocrit (HCT) and albumin (Alb) in predicting the prognosis of patients with sepsis. METHODS: A retrospective study was conducted on the septic patients hospitalized at the First Affiliated Hospital of Guangxi Medical University from January to October in 2024. Clinical data including gender, age, body mass index (BMI), history of hypertension or diabetes, vital signs on admission, and sequential organ failure assessment (SOFA) score, acute physiology and chronic health evaluation II (APACHE II) score, blood lactic acid (Lac), oxygenation index (PaO₂/FiO₂), hemoglobin (Hb), white blood cell count (WBC), platelet count (PLT), lymphocyte count (LYM), HCT, Alb, difference between HCT and Alb, bilirubin, scrum creatinine (SCr), and fibrinogen (Fib) within 48 hours of admission were collected. The 28-day prognosis of patients was also recorded. Binary multivariate Logistic regression analysis was used to identify risk factors for 28-day death in patients with sepsis. The predictive efficacy of the difference between HCT and Alb on 28-day death was evaluated using the receiver operator characteristic curve (ROC curve). RESULTS: Among 180 enrolled septic patients, 140 survived and 40 died on 28 days. Compared with the survival group, the patients in the death group was significantly older (years old: 64±16 vs. 55±15, P < 0.05), and had higher SOFA score, APACHE II score, and SCr [SOFA score: 6 (4, 9) vs. 3 (2, 5), APACHE II score: 13 (10, 18) vs. 8 (6, 11), SCr (μmol/L): 136 (70, 416) vs. 77 (58, 126), all P < 0.05] as well as lower Hb, PLT, HCT, difference between HCT and Alb, and Fib within 48 hours of admission [Hb (g/L): 90±30 vs. 106±79, PLT (×10⁹/L): 158 (57, 240) vs. 215 (110, 315), HCT: 0.258±0.081 vs. 0.333±0.077, difference between HCT and Alb: -6.52±7.40 vs. 1.07±7.63, Fib (g/L): 3.72±1.57 vs. 4.59±1.55, all P < 0.05]. No significant difference in gender, BMI, history of hypertension or diabetes, vital signs on admission, or other laboratory indicators was found between the two groups. Binary multivariate Logistic regression analysis revealed that age [odds ratio (OR) = 1.040, 95% confidence interval (95%CI) was 1.004-1.078, P = 0.030], APACHE II score (OR = 1.218, 95%CI was 1.038-1.430, P = 0.016), Hb (OR = 1.040, 95%CI was 1.014-1.068, P = 0.003), and difference between HCT and Alb (OR = 0.804, 95%CI was 0.727-0.889, P < 0.001) were independent risk factors for 28-day death of septic patients. ROC curve analysis showed that the area under the ROC curve (AUC) of difference between HCT and Alb for predicting 28-day death of septic patients was 0.764 (95%CI was 0.679-0.849, P < 0.001). A cut-off value of difference between HCT and Alb ≤ -5.35 yielded a sensitivity of 80.7% and specificity of 65.0%. CONCLUSIONS The difference between HCT and Alb at early admission is a valuable predictor of prognosis in septic patients. A difference ≤ -5.35 indicates an increased death risk of septic patients.
Humans ; Prognosis ; Sepsis/blood* ; Retrospective Studies ; Hematocrit ; Serum Albumin/analysis* ; Male ; Female ; Middle Aged ; Aged ; APACHE

OBJECTIVE: To compare the efficacy and safety of intravenous colistin sulfate combined with nebulized inhalation versus intravenous monotherapy for pulmonary infections caused by carbapenem-resistant organism (CRO). METHODS: A multicenter retrospective cohort study was conducted. Clinical data were collected from patients admitted to the intensive care unit (ICU) of 10 tertiary class-A hospitals in Henan Province between July 2021 and May 2023, who received colistin sulfate for CRO pulmonary infections. Data included baseline characteristics, inflammatory markers [white blood cell count (WBC), neutrophil count (NEU), procalcitonin (PCT), C-reactive protein (CRP)], renal function indicators [serum creatinine (SCr), blood urea nitrogen (BUN)], life support measures, anti-infection regimens, clinical efficacy, microbiological clearance rate, and prognostic outcomes. Patients were divided into two groups: intravenous group (colistin sulfate monotherapy via intravenous infusion) and combination group ((intravenous infusion combined with nebulized inhalation of colistin sulfate). Changes in parameters before and after treatment were analyzed. RESULTS: A total of 137 patients with CRO pulmonary infections were enrolled, including 89 in the intravenous group and 48 in the combination group. Baseline characteristics, life support measures, daily colistin dose, and combination regimens (most commonly colistin sulfate plus carbapenems in both groups) showed no significant differences between two groups. The combination group exhibited higher clinical efficacy [77.1% (37/48) vs. 59.6% (52/89)] and microbiological clearance rate [60.4% (29/48) vs. 39.3% (35/89)], both P < 0.05. Pre-treatment inflammatory and renal parameters showed no significant differences between two groups. Post-treatment, the combination group showed significantly lower WBC and CRP [WBC (×10⁹/L): 8.2±0.5 vs. 10.9±0.6, CRP (mg/L): 14.0 (5.7, 26.6) vs. 52.1 (24.4, 109.6), both P < 0.05], whereas NEU, PCT, SCr, and BUN levels showed no significant between two groups. ICU length of stay was shorter in the combination group [days: 16 (10, 25) vs. 21 (14, 29), P < 0.05], although mechanical ventilation duration and total hospitalization showed no significant differences between two groups. CONCLUSIONS Intravenous colistin sulfate combined with nebulized inhalation improved clinical efficacy and microbiological clearance in CRO pulmonary infections with an acceptable safety profile.
Humans ; Colistin/therapeutic use* ; Retrospective Studies ; Administration, Inhalation ; Anti-Bacterial Agents/therapeutic use* ; Carbapenems/pharmacology* ; Male ; Female ; Middle Aged ; Gram-Negative Bacteria/drug effects* ; Aged ; Treatment Outcome ; Respiratory Tract Infections/drug therapy*

Objective: To comprehensively evaluate and analyze the transfusion outcomes of patients with acute upper gastrointestinal bleeding (UGIB). Methods: The transfusion management system and hospital information system (HIS) were used to retrospectively collect clinical data of 230 patients with UGIB admitted to Zhejiang Provincial People's Hospital and its branches from June 2018 to June 2021. 101 cases were screened and categorized into transfusion group (n=56) and non-transfusion group (n=45) based on transfusion outcomes. The cohort comprised 68 males and 33 females. A univariate model based on the AIMS65 score, a logistic multiple regression model, and multivariate transfusion models using machine learning methods (including Random Forest, Support Vector Machine, and Artificial Neural Network) were established. The sensitivity, specificity, accuracy, and receiver operating characteristic (ROC) curves of each model were compared. Results: For the univariate model based on the AIMS65 scoring, the optimal threshold was 1.5. This model demonstrated a sensitivity of 0.446, a specificity of 0.822, an AUC of 0.67, an accuracy (ACC) of 0.614, a Kappa value of 0.256, and an F1-score of 0.655. For logistics regression model (optimal critical probability: 0.459), the sensitivity was 0.929, specificity was 0.889, AUC was 0.96, ACC was 0.911, Kappa was 0.819, and F1-score was 0.899. For the Random Forest model (optimal critical probability: 0.458), the sensitivity was 0.964, specificity was 0.956, AUC was 0.99, ACC was 0.960, Kappa was 0.920, and F1-score was 0.956. For the Support Vector Machine model (optimal critical probability: 0.474), the sensitivity was 0.875, specificity was 0.933, AUC was 0.94, ACC was 0.901, Kappa was 0.801, and F1-score was 0.894. For the Artificial Neural Network model (optimal critical probability: 0.797), the sensitivity was 0.804, specificity was 0.956, AUC was 0.96, ACC was 0.871, Kappa was 0.745, and F1-score was 0.869. Ten-fold cross validation also confirmed the reliability of the results. Conclusion: Based on integrated various clinical test indicators of patients, we could establish logistic regression model and multiple machine learning models. These models hold significant value for predicting the need for blood transfusion in patients, indicating a promising application prospect for machine learning algorithms in transfusion prediction.

Objective:To evaluate the changes in brain network function indicators in premature infants with language developmental disorders by resting state functional magnetic resonance imaging (rs-fMRI).Methods:Premature infants admitted to Changzhou Children's Hospital Affiliated to Nantong University from January 2021 to December 2023 were selected as the study subjects to evaluate language development. Language development assessment was conducted using the Gesell developmental scales during follow-up until 12 months of corrected gestational age. According to the evaluation results, the subjects were divided into language development disorders group (31 cases) and normal language development group (19 cases). rs-fMRI was performed on all premature infants with corrected gestational age of 40-42 weeks. The amplitude of low frequency fluctuation (ALFF) and regional homogeneity (ReHo) analysis were performed on MRI data. Regions of interest (ROI) were obtained as seed points based on previous literature, then functional connectivity (FC) was extracted between these ROIs for inter-group comparison. Independent sample t-test, non parametric test, chi-square test, and Fisher's exact test were performed on the data using SPSS 23.0 software. Results:(1)There were statistically significant differences in birth weight, gestational age, moderate to severe respiratory distress syndrome, sepsis, and maternal education level between the two groups of premature infants (all P<0.05).(2)The FC values of left temporal gyrus-left angular gyrus (1.220±0.155, 1.139±0.118), left insula-left trigone (0.520±0.199, 0.411±0.152), and left angular gyrus-left marginal gyrus (1.588±0.333, 1.330±0.437) in language development disorders group were higher than those in normal language development group ( t=-2.089, -2.186, -2.359, all P<0.05). There was no statistically significant difference in the FC values of ROI-ROI between the two groups in the right hemisphere of the brain (all P>0.05). The FC values of left superior temporal gyrus-right insula (0.588±0.257, 0.398±0.305) and left superior temporal gyrus-right marginal gyrus (1.550±0.393, 1.374±0.213) in language development disorders group were higher than those in the normal language development group ( t=-2.363, 2.057, both P<0.05). Conclusions:Functional connectivity between local brain regions in preterm infants with language development is significantly enhanced. The change of local brain network functional connectivity has certain predictive value for the language developmental outcome of preterm infants.

Objective:To evaluate the changes in brain network function indicators in premature infants with language developmental disorders by resting state functional magnetic resonance imaging (rs-fMRI).Methods:Premature infants admitted to Changzhou Children's Hospital Affiliated to Nantong University from January 2021 to December 2023 were selected as the study subjects to evaluate language development. Language development assessment was conducted using the Gesell developmental scales during follow-up until 12 months of corrected gestational age. According to the evaluation results, the subjects were divided into language development disorders group (31 cases) and normal language development group (19 cases). rs-fMRI was performed on all premature infants with corrected gestational age of 40-42 weeks. The amplitude of low frequency fluctuation (ALFF) and regional homogeneity (ReHo) analysis were performed on MRI data. Regions of interest (ROI) were obtained as seed points based on previous literature, then functional connectivity (FC) was extracted between these ROIs for inter-group comparison. Independent sample t-test, non parametric test, chi-square test, and Fisher's exact test were performed on the data using SPSS 23.0 software. Results:(1)There were statistically significant differences in birth weight, gestational age, moderate to severe respiratory distress syndrome, sepsis, and maternal education level between the two groups of premature infants (all P<0.05).(2)The FC values of left temporal gyrus-left angular gyrus (1.220±0.155, 1.139±0.118), left insula-left trigone (0.520±0.199, 0.411±0.152), and left angular gyrus-left marginal gyrus (1.588±0.333, 1.330±0.437) in language development disorders group were higher than those in normal language development group ( t=-2.089, -2.186, -2.359, all P<0.05). There was no statistically significant difference in the FC values of ROI-ROI between the two groups in the right hemisphere of the brain (all P>0.05). The FC values of left superior temporal gyrus-right insula (0.588±0.257, 0.398±0.305) and left superior temporal gyrus-right marginal gyrus (1.550±0.393, 1.374±0.213) in language development disorders group were higher than those in the normal language development group ( t=-2.363, 2.057, both P<0.05). Conclusions:Functional connectivity between local brain regions in preterm infants with language development is significantly enhanced. The change of local brain network functional connectivity has certain predictive value for the language developmental outcome of preterm infants.

Objective:To investigate the long-term safety and effectiveness of stent implantation for residual pulmonary artery stenosis after complicated congenital heart disease.Methods:The symptoms, signs, echocardiography, cardiac CT, cardiac catheterization, six-minute walking distance, and BNP of 41 patients diagnosed from January 1996 to January 2020. In this group, 41 patients, 30 males and 11 females, aged 1.3-14.5 years old, mean (6.1±3.6) years old, and weighed 8-43 kg, mean (18.9±9.4)kg, compared the diameter of the target vessel, pressure difference across stenosis, cardiac function before and postoperative follow-up, and evaluated the long-term effect of stent implantation in the treatment of pulmonary artery stenosis.Results:All 41 patients were not lost to follow-up, no death, and there were no serious adverse events such as stent fracture, artery dissection and pulmonary embolism during follow-up. The median follow-up time was 7.1 years (3.1 to 13.8 years). As of January 2023, the echocardiographic results showed that the diameter of the target vessels in 41 patients increased from preoperative (3.9±1.5) mm to (6.0±1.5) mm ( P<0.05), the pressure difference across the stenosis decreased from preoperative (51.4±19.1) mmHg to (33.1±19.7) mmHg (1 mmHg=0.133 kPa, P<0.05); Heart spiral CT showed that the ratio of target vessel diameter to distal vessel diameter increased from preoperative 0.4±0.2 to 0.9±0.3( P<0.05). All patients had no slow growth and development, no recurrent lung infection, 39 patients (95.1%) had gradeⅠcardiac function, and 2 patients (4.9%) had gradeⅡcardiac function.As children in school age, the walking distance of 6 min was 462 to 633 m, mean( 529.9±57.1)m, the respiratory score was 0.5-1, and the lower limb force score was 6-12. There were 5 long-term adverse events, including 4 cases of target vessel restenosis (9.7%), and 1 case (2.4%), two of the patients with restenosis with repeated target vessel stenosis and lateral pulmonary hypertension were surgically intervention: stent removing and pumonary expanding, after 4, 13 years of stent implantation.And the others were still in follow-up, and no further intervention was made. The Cox multivariate survival analysis suggested that right ventricular systolic blood pressure was a risk factor for endpoint events before stent implantation ( P<0.05). Conclusion:The treatment of residual pulmonary artery stenosis after complicated congenital heart disease after percutaneous stent implantation can effectively relieve the right heart pressure overload, improve pulmonary blood flow, stabilize cardiac function, improve the long-term prognosis of patients with complicated congenital heart disease, reduce the chest opening rate of reoperation, and have stable long-term curative effect.

Objective:To summarize the clinical treatment of complete left bundle branch block (CLBBB) after the transcatheter closure of ventricular septal defect (VSD).Methods:A case series study was conducted on the treatments and outcomes of 25 children with CLBBB after transcatheter VSD closure in Guangdong Provincial People′s Hospital from January 2010 to December 2023.Paired sample t test was used to evaluate the effect of occlude removal. Results:Among the 25 patients, 12 were males (48%), and 13 were females (52%).The age at surgery was 3.18 (2.51-3.86) years, the height before surgery was 95.0 (90.0-97.5) cm, and the weight before surgery was 13 (12-15) kg.Fourteen children were early-onset cases (≤ 1 month), while the other 11 were late-onset cases (> 1 month).The mean follow-up time was (6.63±3.93) years.Of the 14 early-onset cases, 6 children underwent occluder removal within 1 month and restored normal heart rhythm or incomplete right bundle branch block; 4 children underwent occluder removal after 1 month, of whom 2 recovered, 1 remained CLBBB, and 1 had complete atrioventricular block (CAVB); the other 4 children received drug treatment, of whom 2 had normal heart rhythm, 1 had left anterior fascicular block, and 1 died of cardiac shock and heart failure.All the 11 late-onset cases were first treated by drugs, of whom 3 recovered, and the other 8 remained CLBBB.One of the 8 cases received occluder removal at 8 months after surgery and recovered, 1 had CAVB, and the other 6 remained CLBBB.Conclusions:For patients with CLBBB after transcatheter closure of VSD, drug therapy is not always effective, and CLBBB is easy to recur.Therefore, occluder removal is recommended to be done immediately after CLBBB is discovered.Patients with persistent CLBBB should be followed up regularly, and pacemaker implantation may be performed if necessary.

Objective:To investigate the value of early tight junction protein Claudin-5 levels in predicting the severity of acute pancreatitis (AP).Methods:A prospective observational study was conducted, including patients diagnosed with AP and admitted to the Northern Jiangsu People's Hospital from December 1, 2021 to November 30, 2022. Eligible healthy volunteers were randomly selected to serve as healthy controls during the same period. Patients were classified into mild acute pancreatitis (MAP) group, moderate-severe acute pancreatitis (MSAP) group, and severe acute pancreatitis (SAP) group based on the 2012 Atlanta classification criteria. Patients with SAP were then divided into three subgroups of 1, 3, and 7 days based on the duration of hospitalization. Baseline data, such as gender, age, underlying disease, and probable etiology, was collected from all enrolled individuals. The enzyme-linked immunosorbent assay (ELISA) was employed to detect serum Claudin-5 levels in each cohort of enrollees. Data on additional serologic indicators, including hematocrit (HCT), albumin (Alb), serum Ca 2+, C-reactive protein (CRP), and procalcitonin (PCT) levels, were obtained via the in-hospital test query system in each group of patients with AP. The modified Marshall score (mMarshall), modified CT severity index (mCTSI) score, bedside severity index of severity in acute pancreatitis (BISAP) score, and acute physiology and chronic health evaluation Ⅱ(APACHEⅡ) were recorded for each group of patients with AP. Differences in the above indicators between groups were analyzed and compared. Spearman's correlation method was employed to examine the relationship between Claudin-5 levels and each influential factor. The receiver operator characteristic curve (ROC curve) was plotted to analyze the predictive value of each influencing factor on SAP. Ridge regression was used to screen for independent risk factors for SAP. Results:A total of 109 patients with AP were enrolled, comprising 66 in the MAP group, 15 in the MSAP group, and 28 in the SAP group. Additionally, 27 healthy volunteers were enrolled as the healthy control group. No statistically significant differences were observed in gender and age among the enrolled groups, and no statistically significant differences were identified among the three groups of patients with AP in terms of underlying disease and etiologic composition. As the disease progressed, serum Claudin-5 levels exhibited a notable increase across all AP patient groups, and they were all significantly higher than those in the healthy control group [ng/L: 888.58 (574.52, 1 141.59), 3 749.02 (2 784.93, 5 789.92), 4 667.81 (3 935.21, 7 315.66) vs. 291.13 (250.19, 314.75), all P < 0.05]. Subgroup analyses showed that as the disease duration prolonged, patients in the SAP group exhibited a notable decline in Claudin-5 levels at 3 days post-admission, compared with those at 1 day post-admission [ng/L: 2 052.59 (1 089.43, 4 006.47) vs. 4 667.81 (3 935.21, 7 315.66), P < 0.05]. Spearman correlation analysis showed that serum Claudin-5 levels in patients with AP were significantly positively correlated with CRP, PCT, HCT, and mMarshall, mCTSI, and BISAP scores ( r values were 0.570, 0.525, 0.323, 0.774, 0.670, 0.652, all P < 0.001), and significantly negatively correlated with Alb ( r = -0.394, P < 0.001). A significant trend was observed in patients with AP, with an increase of HCT levels and a decrease of Alb levels as the disease progressed (both P < 0.05). An improvement of aforementioned phenomena was observed in patients with SAP following treatment, indirectly indicating that serum Claudin-5 level was a positive indicator of vascular leakage. ROC curve analysis showed that serum Claudin-5 levels in patients with AP exhibited the highest accuracy for early prediction of SAP, with the area under the ROC curve (AUC) of 0.948. When serum Claudin-5 levels ≥2 997 ng/L, the sensitivity for early screening for SAP was 100% and the specificity was 88.89%. Multifactorial ridge regression analysis showed that serum Claudin-5 level, PCT and APACHEⅡscore could be used as independent risk factors for early prediction of SAP (all P < 0.05). Conclusion:Serum Claudin-5 levels facilitate early prediction of SAP and are strongly associated with inflammatory response and vascular leakage.