Circadian rhythm(CR)is an intrinsic biological clock mechanism within organisms that regulates physiological and biochemical processes, enabling synchronization with periodic fluctuations in the external environment. This rhythmicity not only influences the sleep-wake cycle but also encompasses various physiological functions, including metabolism, hormone secretion, cell proliferation, and immune responses. Age-related macular degeneration(ARMD), a prevalent retinal disease, has been significantly associated with disruptions in CR. ARMD is among the leading causes of vision loss in the elderly, with a complex pathogenesis involving multiple factors such as genetics, environmental influences, and lifestyle choices. This article will focus on the molecular mechanisms linking CR and ARMD, analyzing how disruptions in CR affect the physiological state and metabolic processes of retinal cells, ultimately contributing to the onset and progression of ARMD. Additionally, this article will elucidate the interactions effects of CR on ARMD in relation to oxidative stress, regulation of Aβ, inflammatory pathways, and mitochondrial homeostasis. By deepening our understanding of the relationship between CR and ARMD, we aim to provide new insights and directions for future clinical interventions and treatments.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

Chronic obstructive pulmonary disease （COPD）， as one of the three major causes of death， is a complex systemic disease with high prevalence， high mortality， high disability， frequent acute exacerbations， and a variety of pulmonary complications. The pathogenesis is complex. Western medicine has no effective specificity scheme for a complete cure. However， multiple-component and multiple-target characteristics of traditional Chinese medicine （TCM） demonstrate significant advantages in COPD treatment through multi-link， multi-pathway， and multi-mechanism intervention. Therefore， exploring the essence of COPD pathogenesis and discovering effective TCM treatment drugs through the application of TCM principles and prescriptions is a key focus of modern research. Animal models are of paramount importance in medical research. It is the first consideration to select appropriate animals， adopt reasonable modeling methods to replicate stable animal models that closely resemble the clinical manifestations and pathophysiological characteristics of COPD， and use appropriate evaluation methods to determine the success of COPD animal models in experimental research. The core of experimental research lies in observing the intervention effect of TCM on COPD animal models， exploring the specific pathways and regulatory mechanisms of TCM on COPD disease， and finding TCM monomers， single herbs， and TCM formulas with definite curative effects. At present， animal model research on COPD mainly involves model establishment， model evaluation， efficacy observation， mechanism exploration， and other aspects. In recent years， there has been no systematic organization， update， and reflection on the relevant research on TCM intervention in COPD animal models. This study reviewed the selection of animals for the COPD model， methods for establishing COPD animal models， model evaluation methods， and the intervention effects of TCM on COPD animal models. It aims to grasp the current research status and identify existing problems for further improvement， in order to provide evidence and support for scientific research and clinical treatment of COPD.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

Chronic obstructive pulmonary disease （COPD）， as one of the three major causes of death， is a complex systemic disease with high prevalence， high mortality， high disability， frequent acute exacerbations， and a variety of pulmonary complications. The pathogenesis is complex. Western medicine has no effective specificity scheme for a complete cure. However， multiple-component and multiple-target characteristics of traditional Chinese medicine （TCM） demonstrate significant advantages in COPD treatment through multi-link， multi-pathway， and multi-mechanism intervention. Therefore， exploring the essence of COPD pathogenesis and discovering effective TCM treatment drugs through the application of TCM principles and prescriptions is a key focus of modern research. Animal models are of paramount importance in medical research. It is the first consideration to select appropriate animals， adopt reasonable modeling methods to replicate stable animal models that closely resemble the clinical manifestations and pathophysiological characteristics of COPD， and use appropriate evaluation methods to determine the success of COPD animal models in experimental research. The core of experimental research lies in observing the intervention effect of TCM on COPD animal models， exploring the specific pathways and regulatory mechanisms of TCM on COPD disease， and finding TCM monomers， single herbs， and TCM formulas with definite curative effects. At present， animal model research on COPD mainly involves model establishment， model evaluation， efficacy observation， mechanism exploration， and other aspects. In recent years， there has been no systematic organization， update， and reflection on the relevant research on TCM intervention in COPD animal models. This study reviewed the selection of animals for the COPD model， methods for establishing COPD animal models， model evaluation methods， and the intervention effects of TCM on COPD animal models. It aims to grasp the current research status and identify existing problems for further improvement， in order to provide evidence and support for scientific research and clinical treatment of COPD.

Objective To elucidate the molecular mechanism of sirtuin-3 (SIRT3) in regulating mitochondrial biogenesis in human renal tubular epithelial cells. Methods Cells were stimulated with different concentrations of H₂O₂ and divided into four groups: control (NC), 50 μmol/L H₂O₂, 110 μmol/L H₂O₂ and 150 μmol/L H₂O₂. SIRT3 protein expression was then measured. SIRT3 was knocked down with siRNA, and cells were further assigned to five groups: control (NC), negative-control siRNA (NCsi), SIRT3-siRNA (siSIRT3), NCsi+H₂O₂, and siSIRT3+H₂O₂. After 24 h, cellular adenosine triphosphate (ATP) and mitochondrial superoxide anion (O₂•⁻) levels were determined, together with mitochondrial expression of SIRT3, peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α), nuclear respiratory factor 1 (NRF1), mitochondrial transcription factor A (TFAM), superoxide dismutase 2 (SOD2), acetylated-SOD2 and adenosine monophosphate activated protein kinase α1 (AMPKα1). Results The 110 and 150 μmol/L H₂O₂ decreased SIRT3 protein (both P<0.05). ATP and mitochondrial O₂•⁻ did not differ between NC and NCsi groups (both P>0.05). Compared to the NCsi group, the siSIRT3 group exhibited elevated O₂•⁻ level, decreased SIRT3 protein and increased expression levels of SOD2 and acetylated SOD2 protein (all P<0.05). Compared to the NCsi group, the NCsi+H₂O₂ group exhibited decreased cellular ATP levels, elevated mitochondrial O₂•⁻ levels, and reduced protein expression levels of SIRT3, SOD2, TFAM, AMPKα1, PGC-1α and NRF1 (all P<0.05). Compared with the siSIRT3 group, the siSIRT3+H₂O₂ group showed a decrease in cellular ATP levels, an increase in mitochondrial O₂•⁻ levels, a decrease in SIRT3, SOD2, TFAM, AMPKα1, PGC-1α and NRF1 protein expression levels and a decrease in acetylated SOD2 protein expression levels (all P<0.05). Compared with the NCsi+H₂O₂ group, the siSIRT3+H₂O₂ group showed a decrease in cellular ATP levels, an increase in mitochondrial O₂•⁻ levels, a decrease in SIRT3, AMPKα1, PGC-1α and NRF1, TFAM protein expression levels, and an increase in SOD2 and acetylated SOD2 protein expression levels (all P<0.05). Conclusions SIRT3 promotes mitochondrial biogenesis in tubular epithelial cells via the AMPK/PGC-1α/NRF1/TFAM axis, representing a key mechanism through which SIRT3 ameliorates oxidative stress-induced mitochondrial dysfunction.

Functional constipation （FC） is a common functional disorder of the intestines， mainly characterized by reduced bowel movement frequency， difficulty in defecation， a sensation of incomplete evacuation， and hard stools， which severely affect patients’ quality of life. Research indicates that the pathogenesis of FC is closely related to gut microbiota dysbiosis and abnormal bile acid secretion. Bile acids， as endogenous natural laxatives， promote bowel movements by enhancing colonic secretion and regulating intestinal motility； meanwhile， gut microbiota influence colonic transit function by regulating the enteric nervous system， immune system， and their metabolic products. Based on an overview of the relationship between gut microbiota and bile acid metabolism， this article systematically reviews the current research status on the mechanisms of traditional Chinese medicine （TCM） in treating FC by regulating the balance of the gut microbiota-bile acid axis. It is found that single Chinese medicinal herbs （such as Atractylodes macrocephala）， isolated compounds （such as Platycodon grandiflorum polysaccharides）， herbal formulas （such as Shanger huang pill）， acupuncture， and moxibustion can up-regulate the abundance of beneficial bacteria， reshape the microbial structure， correct bile acid metabolism， and activate the Takeda G-protein receptor 5/farnesoid X receptor pathway to treat FC.

OBJECTIVE: To investigate the clinical manifestations and genetic etiology of a fetus with Neurodevelopmental disorders with deformed facial features and distal skeletal abnormalities (NEDDFSA). METHODS: Clinical data of a NEDDFSA fetus diagnosed at the Affiliated Women and Children's Hospital Affiliated to Ningbo University in March 2025 was selected as the study subject. Whole-exome sequencing (WES) was carried out on the amniotic fluid and parental peripheral blood samples, and candidate variants was verified by Sanger sequencing. The pathogenicity of candidate variant was rated based on guidelines from the American College of Medical Genetics and Genomics (ACMG). This study was approved by the Medical Ethics Committee of the hospital (Ethics No.: EC2023-094). RESULTS: At 30 weeks of gestation, the fetus was found to have microcephaly, short femur and intrauterine growth restriction. WES revealed that the fetus harbored a de novo heterozygous frameshift variant c.2633dup (p.Gly879ArgfsTer22) of the ZMIZ1 gene, which was rated as pathogenic (PM2_Supporting+PS2_Supporting+PVS1). Combined with 25 cases from the literature, the main manifestations of patients have included intellectual disability, growth retardation and cranio-limb skeletal dysplasia, albeit without clear genotype-phenotype correlation. CONCLUSION The de novo variant c.2633dup (p.Gly879ArgfsTer22) of the ZMIZ1 gene probably underlay the NEDDFSA in this fetus. Genetic testing has enabled accurate prenatal diagnosis and provided evidence for genetic counseling and reproductive guidance of this family.
Humans ; Female ; Pregnancy ; Neurodevelopmental Disorders/genetics* ; Transcription Factors/genetics* ; Fetus/abnormalities* ; Exome Sequencing ; Prenatal Diagnosis

ObjectiveTo investigate the mechanisms by which Jianpi Yangzheng Xiaozheng prescription （JPYZXZ） treats poorly cohesive gastric carcinoma （PC-GC） through regulation of ubiquitin-specific peptidase 51 （USP51）. MethodsIn vitro experiments： Cell viability and proliferation of PC-GC cell lines （MKN-45 and HGC-27） treated with different concentrations of JPYZXZ （2， 4， 6 g·L^-1） were assessed using Cell Counting Kit-8 （CCK-8） and colony formation assays. Cell migration was evaluated by wound healing （scratch） and Transwell assays. The mRNA and protein expression levels of USP51， zinc finger E-box-binding homeobox 1 （ZEB1）， and epithelial-mesenchymal transition （EMT）-related markers （e.g.， E-cadherin） were detected by quantitative real-time PCR （Real-time PCR） and Western blot， respectively. Subsequently， stable MKN-45 and HGC-27 cell lines with USP51 knockdown （sh-USP51） and overexpression （oe-USP51） were constructed. Their migration ability and EMT-related protein expression were further evaluated by scratch assay， Transwell assay， and Western blot. In vivo experiments： A subcutaneous xenograft model of MKN-45 human gastric cancer was established in BALB/c nude mice. Thirty mice were randomly divided into six groups （NC， NC + JPYZXZ， sh-USP51， sh-USP51 + JPYZXZ， oe-USP51， and oe-USP51 + JPYZXZ）， with five mice in each group. After successful modeling， mice in the treatment groups were administered JPYZXZ （30 g·kg^-1） by gavage for 28 days. Body weight and tumor volume were monitored during the experiment. The expression levels of USP51 and EMT-related proteins in tumor tissues were detected by Western blot and immunohistochemistry （IHC）. ResultsCompared with the blank group， the colony formation rate， wound healing rate， and number of migrated cells in MKN-45 and HGC-27 cells were significantly reduced in all JPYZXZ groups and the 5-fluorouracil （5-FU） group （P<0.05）. The mRNA and protein expression levels of USP51 were decreased （P<0.05）. The expression of ZEB1 and mesenchymal phenotype proteins （e.g.， N-cadherin and vimentin） was reduced （P<0.05）， whereas the expression of the epithelial marker E-cadherin was increased （P<0.05）. Compared with the control group， USP51 expression was decreased in the sh-USP51 group and increased in the oe-USP51 group （P<0.05）. Compared with the NC group， USP51 knockdown significantly reduced the migration and proliferation of gastric cancer cells （P<0.01）， decreased the expression of ZEB1 and EMT-related proteins， and increased E-cadherin expression （P<0.05）. In vivo results showed that JPYZXZ significantly inhibited the growth of xenograft tumors in nude mice （P<0.05） and markedly reversed the abnormal expression of EMT-related proteins in tumor tissues （P<0.05）. ConclusionThe therapeutic mechanisms of JPYZXZ in PC-GC may be associated with inhibition of the EMT process via regulation of the USP51-ZEB1 signaling pathway.