ObjectiveQi deficiency and phlegm dampness syndrome is a common type of clinical traditional Chinese medicine（TCM） syndrome. However， there is no standard， scientific， and accurate report on the construction of animal models of Qi deficiency and phlegm dampness syndrome. This study aims to construct a mouse model of Qi deficiency and phlegm dampness syndrome by using a multi-factor composite modeling method and to evaluate the model. MethodsTwenty-one C57BL/6 mice were randomly divided into three groups with seven mice in each group， which were the normal group， model group， and Shenling Baizhusan （SLBZ） group. The control group was fed with ordinary diet and kept in a normal environment. The model group and SLBZ group were fed with a high-fat diet in a high-humidity environment. Swimming with heavy weights until exhaustion and gavage with cold water or lard were used to establish the mouse model of Qi deficiency and phlegm dampness syndrome. In order to test the syndrome by prescription， mice in the SLBZ group were treated with SLBZ for 14 days after model construction. The exhaustive swimming time， body weight， serum lipid levels， tongue changes， "Qi deficiency and phlegm dampness" assessment scale score， and cecal index of mice in each group were measured. The feces of each group of mice were sent for metagenomics and metabolome sequencing， and the changes in intestinal flora and metabolites were analyzed. ResultsAfter the modeling of Qi deficiency and phlegm dampness syndrome， the exhaustive swimming time of mice was obviously shortened （P<0.01）. The serum total cholesterol， low density lipoprotein cholesterol， and non-high density lipoprotein cholesterol of mice were significantly increased （all P<0.01）. The tongue of mice was significantly different from that of the normal group， and the score of the assessment scale was significantly higher than that of the control group （P<0.01）. Cecal index decreased significantly （P<0.01）. The serum lipid level， tongue image， assessment scale score， and cecal index were reversed in the SLBZ group. Metagenomic and metabolome sequencing results showed that intestinal flora and fecal metabolites were significantly changed in mice with Qi deficiency and phlegm dampness syndrome. Akkermansia_muciniphila， Faecalibaculum_rodentium， Eubacterium_plexicaudatum， Eubacterium sp 14_2， Candida glabrata， Romboutsia_ilealis， Turicibacter sp TS3， and other bacteria had significant changes， and the expressions of intestinal metabolites such as chenodeoxycholic acid， choline， L-phenylalanine betaine， and 2-phenylbutyric acid were significantly changed. Related metabolic pathways such as linoleic acid metabolism， primary bile acid biosynthesis， lysine degradation， arginine biosynthesis， and alpha-linolenic acid metabolism were affected. ConclusionThe Qi deficiency and phlegm dampness model of mice can be constructed by the multi-factor composite modeling method of high-fat diet feeding， high-humidity environment feeding， exhaustive swimming with heavy weight， and intragastric administration with cold water or lard. The blood lipid level， tongue change， score of "Qi deficiency and phlegm dampness assessment scale"， cecal index， and changes in related intestinal flora and metabolites of mice can be used as key indicators for model evaluation.

OBJECTIVE To establish a Chinese drug-related problem （DRP） classification system applicable to pharmacist-led pharmaceutical care in China， providing pharmacists with an effective and practical tool for pharmaceutical care. METHODS A multi-stage process was employed to construct the DRP classification system， including literature review and analysis， comparison of existing classification systems， refinement of classification items and framework development， two rounds of standard case validation， expert discussion， and system revision. The Fleiss′ kappa test was used to calculate the consistency coefficient κ， assessing the reliability of pharmacists participating in evaluating the classification system. An electronic questionnaire comprising six items was employed to evaluate the system’s applicability. RESULTS The constructed Chinese DRP classification system comprised six sections [problem（including potential problems）， DRP evaluation， cause （including possible causes of potential problems）， intervention， acceptance of intervention and DRP status]， with 24 primary codes and 96 secondary codes. In the first round of case validation， κ values exceeded 0.4 for all sections except “intervention” and “DRP status”. In the second round， κ values exceeded 0.4 for all sections. In the applicability evaluation of the classification system， positive ratings （“strongly agree” or “agree”） exceeded 85% for all items. Specifically， positive ratings for“the classification system can provide appropriate category selection”，“ the classification system is comprehensive”，“ the classification system is convenient to use” and “the classification system is highly satisfactory” exceeded 92%. CONCLUSIONS The Chinese DRP classification system developed demonstrates both high reliability and applicability， providing an effective and practical classification tool for pharmacists in China to conduct pharmaceutical care.

Objective To analyze the clinical manifestations of patients over 60 years old with acute respiratory infection in Pudong New Area of Shanghai and the risk factors of positive detection of novel coronavirus, and to provide reference for improving prevention and control strategies and measures. Methods General conditions, clinical features, basic complications and respiratory samples of inpatients over 60 years old with acute respiratory infection from eight hospitals in Pudong New Area of Shanghai from January to October 2023 were collected, and SARS-CoV-2 detection was carried out. Chi-square test and binary logistics regression were used for data analysis. Results A total of 604 patients over 60 years old were collected, including 356 (58.945) males with a median age of 77 (IQR:70-85) years. Of the 604 cases, 264 were detected positive for SARS-CoV-2, with a positive detection rate of 43.71%. The results of univariate analysis showed that there were significant differences in the detection rates of SARS-CoV-2 among different age groups (χ²=10.60, P=0.01) and different months (χ²=87.15, P=0.00), and among those with cough (χ²=5.28, P=0.02), sputum (χ²=4.19, P=0.04), sore throat (χ²=3.93, P=0.04), and hypertension (χ²=7.63, P=0.01). In the binary logistics regression analysis, month (P=0.00, OR=2.93, 95% CI=1.49-5.78) and age (P=0.00, OR=2.60, 95% CI=1.55-4.37) were independent risk factors for positive detection of SARS-CoV-2. Conclusion The majority of hospitalized cases of acute respiratory infection over 60 years old are male, and the risk factors for positive detection of novel coronavirus are age 80~89 years old and time between May and June.

Objective To establish an ELISA method for the determination of porcine trypsin residues in reassortant rotavirus vaccine, live, oral, hexavalent(Vero cell) and verify the method, so as to control the quality of the products more comprehensively.Methods The absorbance values of standard and test solutions were determined at 450 nm. The concentration value of standard was used as independent variable X and the mean value of the absorbance value was used as dependent variable Y to establish a four-parameter linear regression equation. The porcine trypsin content of the test solution was calculated using the linear regression equation. The method was verified for linear range and detection limit, accuracy, precision,robustness and specificity. Results Porcine trypsin concentration showed good linearity in the range of 1. 56-100 ng/mL(R~2> 0. 99). The coefficients of variation(CVs) of single virus harvest solution and monovalent bulk solution in repeatability verification was 5% and 8%, and the CVs of single virus harvest solution and monovalent bulk solution in intermediate precision verification was 5% and 6%, respectively. In detection limit verification, the recovery rate was 102%-112% at the porcine trypsin concentration of 1. 56 ng/mL, with the CV of 4% and the quantification limit of 1. 56 ng/mL. In specificity verification, the recovery rates of the test solution diluted with bovine serum albumin(BSA) were 101%-102%, and the recovery rates of the test solution diluted with sucrose-phosphate-glutamate(SPG) buffer and DMEM were 90%-101%,indicating the excipients had no interference with the detection. The CVs of the results at different color development time and temperatures for robustness verification were less than 15%. In accuracy verification, the recovery rates of single virus harvest solution and monovalent bulk solution were within 86%-105% and 109%-117%, respectively.Conclusion The linear range and detection limit, accuracy, precision, robustness and specificity of the established ELISA method were all in line with the acceptance criteria and were suitable for the determination and quality control of the residual amount of porcine trypsin in reassortant rotavirus vaccine, live, oral, hexavalent(Vero cell).

Circadian rhythm(CR)is an intrinsic biological clock mechanism within organisms that regulates physiological and biochemical processes, enabling synchronization with periodic fluctuations in the external environment. This rhythmicity not only influences the sleep-wake cycle but also encompasses various physiological functions, including metabolism, hormone secretion, cell proliferation, and immune responses. Age-related macular degeneration(ARMD), a prevalent retinal disease, has been significantly associated with disruptions in CR. ARMD is among the leading causes of vision loss in the elderly, with a complex pathogenesis involving multiple factors such as genetics, environmental influences, and lifestyle choices. This article will focus on the molecular mechanisms linking CR and ARMD, analyzing how disruptions in CR affect the physiological state and metabolic processes of retinal cells, ultimately contributing to the onset and progression of ARMD. Additionally, this article will elucidate the interactions effects of CR on ARMD in relation to oxidative stress, regulation of Aβ, inflammatory pathways, and mitochondrial homeostasis. By deepening our understanding of the relationship between CR and ARMD, we aim to provide new insights and directions for future clinical interventions and treatments.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

BACKGROUND:Choline kinase alpha is a key enzyme in phospholipid metabolism,involved in the synthesis of phosphatidylcholine,and plays an important role in maintaining cell membrane integrity and signal transduction.Research has shown that choline kinase alpha is highly expressed in various tumors and is closely related to cell proliferation,metabolic reprogramming,and tumor progression.As a potential therapeutic target,the role of choline kinase alpha in tumor metabolism and mitochondrial function still needs further exploration.OBJECTIVE:To evaluate the effects and the underlying mechanisms of choline kinase alpha on the proliferation and apoptosis of glioma U87MG and U251 cells.METHODS:Short hairpin RNA of choline kinase alpha and its empty vector control were transfected into U87MG and U251 glioma cells.Mitochondrial morphology was observed by transmission electron microscopy.Mitochondrial structure and functional protein levels were assessed by western blot assay.Reactive oxygen species levels in cells were measured using a reactive oxygen species fluorescent probe.Mitochondrial membrane potential was assessed with a JC-1 assay.Intracellular adenosine triphosphate levels were measured by chemiluminescence.Cell proliferation was evaluated using a CCK-8 assay.Apoptosis levels were analyzed by flow cytometry.The mitochondrial fission inhibitor Mdivi-1 was used to protect the mitochondrial function of the choline kinase α-silenced lentiviral cells.Finally,U87MG cells were subcutaneously injected to construct a subcutaneous tumor model in nude mice.The tumor growth in nude mice was observed before and after choline kinase alpha silencing and after the use of the mitochondrial fission inhibitor Mdivi-1.RESULTS AND CONCLUSION:(1)Compared with the empty control group,the mitochondria of U87MG and U251 cells in the choline kinase alpha silencing lentivirus group exhibited significant structural abnormalities in mitochondria,such as vacuolization and cristae disruption.The expressions of mitochondrial structure and function-related proteins TOM20,ACO2,and ATP5A were significantly decreased(P＜0.01,P＜0.001),the expression of SOD2 was significantly increased(P＜0.01,P＜0.000 1),the fluorescence intensity of reactive oxygen species was significantly increased(P＜0.01),the mitochondrial membrane potential and adenosine triphosphate level were significantly decreased(P＜0.01,P＜0.001),the cell proliferation ability was reduced(P＜0.01),and the apoptosis level was increased(P＜0.001).(2)Following Mdivi-1 treatment,the fluorescence intensity of reactive oxygen species in U87MG and U251 cells decreased(P＜0.05,P＜0.01),mitochondrial membrane potential and adenosine triphosphate levels were significantly restored(P＜0.05,P＜0.01,P＜0.001),cell proliferation ability was improved(P＜0.05,P＜0.01),and apoptosis level was decreased(P＜0.05).(3)In addition,the in vitro subcutaneous tumor formation experiment of nude mice showed that compared with the empty control group,the mass and growth rate of subcutaneous tumors formed by U87MG cells in the choline kinase alpha silencing lentivirus group were significantly reduced(P＜0.000 1).After Mdivi-1 treatment,the mass and growth rate of tumors were significantly increased(P＜0.000 1).(4)The results show that choline kinase alpha silencing affects the proliferation and apoptosis of glioma cells by inducing mitochondrial dysfunction.

BACKGROUND:Triptolide,a bioactive component of the traditional Chinese medicine Tripterygium wilfordii,has a certain protective effect on neurons.OBJECTIVE:To investigate the effect of triptolide on cerebral ischemia/reperfusion injury.METHODS:(1)Cell experiment:Hippocampal neurons(HT22 cells)were randomly divided into control group,glucose oxygen deprivation/reoxygenation(OGD/R)group,OGD/R+triptolide group,OGD/R+triptolide+si-TIGAR group,OGD/R+si-TIGAR group,and OGD/R+triptolide+rapamycin group.HT22 cell viability was detected by cell counting kit 8.Tp53-induced glycolysis and apoptosis factors,glutathione peroxidase 4,7 members of the solsolic vector family 11,sphingosine kinase 1(SPHK1)and(mTOR)were detected by western blot assay.Glutathione,malondialdehyde and iron level were detected using the biochemical kit.(2)Animal experiment:Rats were randomly divided into sham surgery group,model group,and triptolide group.Cerebral artery occlusion/reperfusion rat models were prepared in the latter two groups.Rats in the triptolide group were orally administered 50 mg/kg triptolide for 7 days.Twenty-four hours after administration,LONGA method was used to evaluate the neurological impairment of rats,TTC method was used to observe the conditions of cerebral infarction,TUNEL staining was used to detect cell apoptosis,and western blot was performed to detect the expression level of related proteins.RESULTS AND CONCLUSION:(1)At the cellular level,triptolide promoted cell viability and inhibited apoptosis in HT22 cells treated with OGD/R.Triptolide also increased the expression levels of Tp53-induced glycolysis and apoptosis factors,glutathione peroxidase 4,and 7 members of the solsolic vector family 11,activated the SPHK1/mTOR pathway,increased glutathione content,inhibited malondialdehyde content and iron levels.Rapamycin treatment counteracted the protective effect of triptolide on HT22 cells.(2)At the animal level,triptolide significantly reduced neurological deficits,infarct volume,and cell apoptosis,and inhibited neuronal ferroptosis in brain tissue of rats.To conclude,triptolide can inhibit ferroptosis by upregulating the expression level of Tp53-induced glycolysis and apoptosis factors and activating the SPHK1/mTOR signaling,and thereby reduced cerebral ischemia/reperfusion injury.These findings suggest that triptolide may be a candidate drug for the treatment of cerebral ischemia/reperfusion injury.

BACKGROUND:Pulmonary arterial hypertension is a destructive cardiopulmonary disease for which there is no cure.An association between plasma proteins and pulmonary arterial hypertension has been suggested,but the causal relationship has not been specifically elucidated.OBJECTIVE:To elucidate the causal relationship between plasma proteome and pulmonary arterial hypertension using a two-sample Mendelian randomization method,thereby searching for potential therapeutic targets for pulmonary arterial hypertension.METHODS:Plasma Protein Gene-Wide Association Analysis Statistics for 4 907 Aptamer Measurements in 35 559 Icelanders from the Icelandic Database;Genome-wide association analysis statistics for pulmonary arterial hypertension were obtained from the Finn Gen database,version R9,including 234 cases and 265 626 controls.Analyses were performed using Mendelian randomization and Bayesian co-localization analysis,the findings were examined using sensitivity analyses,and protein-protein interaction network maps were constructed to explore the causal relationship between plasma proteins and pulmonary arterial hypertension.RESULTS AND CONCLUSION:(1)The results of inverse variance weighting,maximum likelihood and Wald ratio methods showed 19 proteins causally associated with pulmonary arterial hypertension(P＜0.05).Among them,10 plasma proteins,including Beta-1,3-N-acetylglucosaminyltransferase manic fringe(odds ratio[OR]=0.12,95％confidence interval[CI]0.02-0.61,P=0.01)and interferon alpha/beta receptor 1(OR=0.45,95％CI 0.24-0.84,P=0.012),might be associated with a reduced risk of pulmonary arterial hypertension.In contrast,nine plasma proteins,such as glucoside xylosyltransferase 1(OR=3.48,95％CI 1.51-8.00,P=0.003)and plasminogen(OR=42.78,95％CI 2.49-734.31,P=0.01),might be associated with an increased risk of pulmonary arterial hypertension.After the false discovery rate was corrected,19 proteins remained significantly associated with pulmonary arterial hypertension.(2)Multiple sensitivity analyses such as the MR-Egger intercept test and leave-one-out method showed no horizontal multiplicity or heterogeneity in the results of the study,indicating the stability of the study's results.(3)Bayesian co-localization analysis showed that six plasma proteins,including plasminogen(PPH4=1.0)and glucoside xylosyltransferase 1(PPH4=0.94),had PPH4＞0.8,suggesting that plasma proteins and the genome-wide association study of pulmonary arterial hypertension had similar causal variance in terms of genetic association.(4)By constructing a protein-protein interaction network map,plasminogen,Annexin A1,fibrinogen gamma chain and matrix metalloproteinase 7 were found to be core proteins.(5)The article used Mendelian randomization analysis to reveal a potential causal association between 4 907 plasma proteins and pulmonary arterial hypertension,suggesting that plasma proteins may be potential therapeutic targets for pulmonary arterial hypertension.The core proteins identified in the study also provide a theoretical basis for further in-depth study of the pathophysiological mechanisms of pulmonary arterial hypertension.Secondly,analyses using the large-scale international databases of Iceland and FinnGen provide new research directions and treatment ideas for pulmonary arterial hypertension in specific populations and environments,as well as ideas and methods that can be used to prevent and treat pulmonary arterial hypertension in China.

ObjectiveTo construct a stable monoclonal human embryonic kidney 293 （HEK293） cell line expressing recombinant human coagulation factor Ⅶ （rhFⅦ） and evaluate the expression level and procoagulant bioactivity of rhFⅦ. MethodsThe plasmid pCDNA3.1-EGFP-FⅦ was transfected into HEK293 cells to verify the effectiveness of the transfection system. The plasmid pCDNA3.1-FⅦ was transfected into HEK293 cells， and monoclonal stable transfected cell lines were selected using geneticin （G418）. The transcription of the FⅦ gene was identified by reverse transcription polymerase chain reaction （RT-PCR）. The expression level of rhFⅦ in the supernatant of the monoclonal stable transfected cell line was detected by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blot. The concentration of rhFⅦ was determined by enzyme-linked immunosorbent assay （ELISA）， and the procoagulant activity of rhFⅦ was measured by human coagulation factor Ⅶ potency assay. ResultsHEK293 cells transfected with pcDNA3.1-EGFP-FⅦ showed green fluorescence， indicating that rhFⅦ was successfully expressed in the supernatant of HEK293 cells after transient transfection with pcDNA3.1-FⅦ. The monoclonal stable transfected cell line was obtained by G418 screening. RT-PCR identified that the FⅦ gene was integrated into the genome of the monoclonal stable transfected cell line. The cell viability was good as detected by Cell Counting Kit-8， and a single band of rhFⅦ was obtained by purification of the cell supernatant. The highest rhFⅦ expression was （1.27±0.09） mg/L， and the highest procoagulant activity was （380.29±13.80）%. ConclusionThe monoclonal HEK293 cell lines which can express rhFⅦ protein efficiently and stably with excellent procoagulant bioactivity is successfully screened.