Circadian rhythm(CR)is an intrinsic biological clock mechanism within organisms that regulates physiological and biochemical processes, enabling synchronization with periodic fluctuations in the external environment. This rhythmicity not only influences the sleep-wake cycle but also encompasses various physiological functions, including metabolism, hormone secretion, cell proliferation, and immune responses. Age-related macular degeneration(ARMD), a prevalent retinal disease, has been significantly associated with disruptions in CR. ARMD is among the leading causes of vision loss in the elderly, with a complex pathogenesis involving multiple factors such as genetics, environmental influences, and lifestyle choices. This article will focus on the molecular mechanisms linking CR and ARMD, analyzing how disruptions in CR affect the physiological state and metabolic processes of retinal cells, ultimately contributing to the onset and progression of ARMD. Additionally, this article will elucidate the interactions effects of CR on ARMD in relation to oxidative stress, regulation of Aβ, inflammatory pathways, and mitochondrial homeostasis. By deepening our understanding of the relationship between CR and ARMD, we aim to provide new insights and directions for future clinical interventions and treatments.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

Chronic obstructive pulmonary disease （COPD）， as one of the three major causes of death， is a complex systemic disease with high prevalence， high mortality， high disability， frequent acute exacerbations， and a variety of pulmonary complications. The pathogenesis is complex. Western medicine has no effective specificity scheme for a complete cure. However， multiple-component and multiple-target characteristics of traditional Chinese medicine （TCM） demonstrate significant advantages in COPD treatment through multi-link， multi-pathway， and multi-mechanism intervention. Therefore， exploring the essence of COPD pathogenesis and discovering effective TCM treatment drugs through the application of TCM principles and prescriptions is a key focus of modern research. Animal models are of paramount importance in medical research. It is the first consideration to select appropriate animals， adopt reasonable modeling methods to replicate stable animal models that closely resemble the clinical manifestations and pathophysiological characteristics of COPD， and use appropriate evaluation methods to determine the success of COPD animal models in experimental research. The core of experimental research lies in observing the intervention effect of TCM on COPD animal models， exploring the specific pathways and regulatory mechanisms of TCM on COPD disease， and finding TCM monomers， single herbs， and TCM formulas with definite curative effects. At present， animal model research on COPD mainly involves model establishment， model evaluation， efficacy observation， mechanism exploration， and other aspects. In recent years， there has been no systematic organization， update， and reflection on the relevant research on TCM intervention in COPD animal models. This study reviewed the selection of animals for the COPD model， methods for establishing COPD animal models， model evaluation methods， and the intervention effects of TCM on COPD animal models. It aims to grasp the current research status and identify existing problems for further improvement， in order to provide evidence and support for scientific research and clinical treatment of COPD.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

Chronic obstructive pulmonary disease （COPD）， as one of the three major causes of death， is a complex systemic disease with high prevalence， high mortality， high disability， frequent acute exacerbations， and a variety of pulmonary complications. The pathogenesis is complex. Western medicine has no effective specificity scheme for a complete cure. However， multiple-component and multiple-target characteristics of traditional Chinese medicine （TCM） demonstrate significant advantages in COPD treatment through multi-link， multi-pathway， and multi-mechanism intervention. Therefore， exploring the essence of COPD pathogenesis and discovering effective TCM treatment drugs through the application of TCM principles and prescriptions is a key focus of modern research. Animal models are of paramount importance in medical research. It is the first consideration to select appropriate animals， adopt reasonable modeling methods to replicate stable animal models that closely resemble the clinical manifestations and pathophysiological characteristics of COPD， and use appropriate evaluation methods to determine the success of COPD animal models in experimental research. The core of experimental research lies in observing the intervention effect of TCM on COPD animal models， exploring the specific pathways and regulatory mechanisms of TCM on COPD disease， and finding TCM monomers， single herbs， and TCM formulas with definite curative effects. At present， animal model research on COPD mainly involves model establishment， model evaluation， efficacy observation， mechanism exploration， and other aspects. In recent years， there has been no systematic organization， update， and reflection on the relevant research on TCM intervention in COPD animal models. This study reviewed the selection of animals for the COPD model， methods for establishing COPD animal models， model evaluation methods， and the intervention effects of TCM on COPD animal models. It aims to grasp the current research status and identify existing problems for further improvement， in order to provide evidence and support for scientific research and clinical treatment of COPD.

Objective To elucidate the molecular mechanism of sirtuin-3 (SIRT3) in regulating mitochondrial biogenesis in human renal tubular epithelial cells. Methods Cells were stimulated with different concentrations of H₂O₂ and divided into four groups: control (NC), 50 μmol/L H₂O₂, 110 μmol/L H₂O₂ and 150 μmol/L H₂O₂. SIRT3 protein expression was then measured. SIRT3 was knocked down with siRNA, and cells were further assigned to five groups: control (NC), negative-control siRNA (NCsi), SIRT3-siRNA (siSIRT3), NCsi+H₂O₂, and siSIRT3+H₂O₂. After 24 h, cellular adenosine triphosphate (ATP) and mitochondrial superoxide anion (O₂•⁻) levels were determined, together with mitochondrial expression of SIRT3, peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α), nuclear respiratory factor 1 (NRF1), mitochondrial transcription factor A (TFAM), superoxide dismutase 2 (SOD2), acetylated-SOD2 and adenosine monophosphate activated protein kinase α1 (AMPKα1). Results The 110 and 150 μmol/L H₂O₂ decreased SIRT3 protein (both P<0.05). ATP and mitochondrial O₂•⁻ did not differ between NC and NCsi groups (both P>0.05). Compared to the NCsi group, the siSIRT3 group exhibited elevated O₂•⁻ level, decreased SIRT3 protein and increased expression levels of SOD2 and acetylated SOD2 protein (all P<0.05). Compared to the NCsi group, the NCsi+H₂O₂ group exhibited decreased cellular ATP levels, elevated mitochondrial O₂•⁻ levels, and reduced protein expression levels of SIRT3, SOD2, TFAM, AMPKα1, PGC-1α and NRF1 (all P<0.05). Compared with the siSIRT3 group, the siSIRT3+H₂O₂ group showed a decrease in cellular ATP levels, an increase in mitochondrial O₂•⁻ levels, a decrease in SIRT3, SOD2, TFAM, AMPKα1, PGC-1α and NRF1 protein expression levels and a decrease in acetylated SOD2 protein expression levels (all P<0.05). Compared with the NCsi+H₂O₂ group, the siSIRT3+H₂O₂ group showed a decrease in cellular ATP levels, an increase in mitochondrial O₂•⁻ levels, a decrease in SIRT3, AMPKα1, PGC-1α and NRF1, TFAM protein expression levels, and an increase in SOD2 and acetylated SOD2 protein expression levels (all P<0.05). Conclusions SIRT3 promotes mitochondrial biogenesis in tubular epithelial cells via the AMPK/PGC-1α/NRF1/TFAM axis, representing a key mechanism through which SIRT3 ameliorates oxidative stress-induced mitochondrial dysfunction.

ObjectiveTo explore the effect of serum containing Zhenwutang on myocardial mast cell apoptosis induced by angiotensin Ⅱ （AngⅡ） and the mechanism of the correlation between apoptosis and mitochondrial autophagy. MethodsIn this experiment， AngⅡ and serum containing Zhenwutang with different concentrations were used to interfere with H9C2 cardiomyocytes for 24 h， and the survival rate of H9C2 cardiomyocytes was detected by cell counting kit-8 （CCK-8） to screen the optimal concentration for the experiment. Enzyme-linked immunosorbent assay （ELISA） was used to detect the content of B-type natriuretic peptide （BNP） in cell culture supernatant， and immunofluorescence was used to detect the cell surface area to verify the construction of the myocardial mast cell model. Subsequently， the experiment was divided into a blank group （20% blank serum）， a model group （20% blank serum + 5×10^-5 mol·L^-1 AngⅡ）， low-， medium-， and high-dose （5%， 10% and 20%） serum containing Zhenwutang groups， an autophagy inhibitor group （1×10^-4 mol·L^-1 3-MA）， and autophagy inducer group （1×10^-7 mol·L^-1 rapamycin）. The apoptosis level of H9C2 cells and the changes of mitochondrial membrane potential were detected by flow cytometry. The lysosomal probe （Lyso Tracker） and mitochondrial probe （Mito Tracker） co-localization was employed to detect autophagy. Real-time fluorescence quantitative polymerase chain reaction （Real-time PCR） was used to detect Caspase-3， Caspase-9， B-cell lymphoma 2 （Bcl-2）， Bcl-2-related X protein （Bax）， and cytochrome C （Cyt C） in apoptosis-related pathways and the relative mRNA expression of ubiquitin ligase （Parkin）， phosphatase and tensin homolog （PTEN）-induced kinase 1 （PINK1）， and p62 protein in mitochondrial autophagy-related pathways. Western blot was used to detect cleaved Caspase-3， cleaved Caspase-9， Bax， Bcl-2， and Cyt C in apoptosis-related pathways， phosphorylated ubiquitin ligase （p-Parkin）， phosphorylated PTEN-induced kinase 1 （p-PINK1）， p62， and Bcl-2 homology domain protein Beclin1 in mitochondrial autophagy-related pathways， and the change of microtubule-associated protein 1 light chain 3 （LC3） Ⅱ/Ⅰ ratio. ResultsCCK-8 showed that when the concentration of AngⅡ was 5×10^-5 mol·L^-1， the cell activity was the lowest， and there was no cytotoxicity. At this concentration， the surface area of cardiomyocytes was significantly increased （P<0.01）， and the content of BNP in the supernatant of culture medium was significantly increased （P<0.05）. Therefore， AngⅡ with a concentration of 5×10^-5 mol·L^-1 was selected for the subsequent modeling of myocardial mast cells. Compared with the blank group， the model group and the autophagy inhibitor 3-MA group had a significantly increased apoptosis rate （P<0.01） and significantly decreased mitochondrial membrane potential （P<0.01）. The results of immunofluorescence co-localization showed that compared with the blank group， the model group had a significantly decreased number of red and green fluorescence spots. The results of Real-time PCR showed that compared with that in the blank group， the relative mRNA expression of Bax， Caspase-3， Caspase-9， Cyt C， and p62 in the model group was significantly up-regulated （P<0.01）， while the relative mRNA expression of Bcl-2， Parkin， and PINK1 was significantly down-regulated （P<0.01）. In addition， the relative protein expression of Bax， cleaved Caspase-3， cleaved Caspase-9， Cyt C， and p62 was significantly up-regulated （P<0.01）. The LC3Ⅱ/Ⅰ was significantly decreased， and the relative protein expression of Bcl-2， p-Parkin， p-PINK1， and Beclin1 was significantly down-regulated （P<0.01）. Compared with the model group， the serum containing Zhenwutang groups and the autophagy inducer group had significantly decreased apoptosis rate （P<0.01）， and the decrease ratio of mitochondrial membrane potential is significantly lowered （P<0.01） in a dose-dependent manner. Additionally， both red and green fluorescence spots became more in these groups. In the 3-MA group， the number of red and green fluorescence spots decreased significantly. The relative mRNA expression of Bax， Caspase-3， Caspase-9， Cyt C， and p62 was significantly down-regulated （P<0.05， P<0.01）， while that of Bcl-2， Parkin， and PINK1 was significantly up-regulated （P<0.01）. In the serum containing Zhenwutang groups， the relative protein expression levels of Bax， cleaved Caspase-3， cleaved Caspase-9， Cyt C， and p62 were significantly down-regulated （P<0.05，P<0.01）. The LC3Ⅱ/Ⅰ was significantly increased， and the relative protein expression levels of Bcl-2， p-Parkin， p-PINK1， and Beclin1 were significantly up-regulated （P<0.01）. ConclusionThe serum containing Zhenwutang can reduce the apoptosis of myocardial mast cells and increase mitochondrial autophagy. This is related to the inhibition of intracellular Bax/Bcl-2/Caspase-3 apoptosis pathway and regulation of Parkin/PINK1 mitochondrial autophagy pathway.

As a patented characteristic medicine of Yi ethnic minority， Pingxuan capsules have the effects of nourishing the liver and kidney， pacifying the liver， and subduing Yang. With the main indications of dizziness， headache， palpitations， tinnitus， insomnia， dreaminess， waist and knee soreness caused by liver-kidney deficiency and liver Yang upward disturbance， Pingxuan capsules are widely used in the treatment of posterior circulation ischemic vertigo， vestibular migraine， benign paroxysmal positional vertigo. However， the current knowledge is limited regarding the efficacy， syndrome differentiation， and safety of this medicine. On the basis of summarizing the experience of clinicians and the existing evidence， this study invites clinical experts of traditional Chinese and Western medicine， pharmaceutical experts， and methodological experts from relevant fields across China to conduct evidence-based evaluation of Pingxuan capsules. The evaluation follows the Specifications for the Development of Clinical Expert Consensus on Chinese Patent Medicines issued by the Standardization Office of the China Association of Chinese Medicine， and reaches 5 recommendations and 16 consensus suggestions. The consensus clarifies the clinical applications， efficacy， dose， course of treatment， combination of medicines， precautions， and contraindications of Pingxuan capsules in the treatment of vertigo and explains the safety of clinical application. This consensus is applicable to clinicians （traditional Chinese medicine， Western medicine， and integrated traditional Chinese and Western medicine） and pharmacists in tertiary hospitals， secondary hospitals， and community-level medical and health institutions across China， providing a reference for the rational use of Pingxuan capsules in the treatment of vertigo. It is hoped that the promotion of this consensus can facilitate the rational use of drugs in clinical practice， reduce the risk of drug use， and give full play to the advantages of Pingxuan capsules in the treatment of vertigo diseases. This consensus has been reviewed and published by the China Association of Chinese Medicine， with the number GS/CACM330-2023.

Chronic obstructive pulmonary disease （COPD）， as a chronic respiratory disease that can be prevented and intervened but cannot be completely cured， has increasing incidence and mortality rates year by year， often complicated by one or more comorbidities. However， there is currently no specific treatment available. Therefore， the healthcare issues related to COPD are urgent and prominent. Traditional Chinese medicine （TCM） delays the progression of COPD through multiple mechanisms， pathways， and targets. As a result， exploring the pathogenesis of COPD and identifying TCM treatment approaches and effective prescriptions are key issues that urgently need to be addressed in clinical practice. In TCM， COPD is categorized into syndromes such as "cough"， "asthma"， and "lung distension". It is believed that the deficiency in the origin runs through the entire disease. When external pathogens invade， Qi becomes disordered， and phlegm and blood stasis begin to accumulate， leading to an excess condition in the manifestation. Modern medicine research on the pathogenesis of COPD mainly involves aspects such as inflammatory response， oxidative stress， autophagy imbalance， and aging. Studies have found that Chinese medicine monomers， single herbs， and compound prescriptions can improve COPD by inhibiting inflammation， reducing oxidative damage， correcting autophagy， and delaying aging. However， there is no study that intuitively organizes the various pathogenesis mechanisms of COPD and their interrelationships. At the same time， research on the therapeutic effects of TCM on COPD primarily focuses on exploring a single mechanism or pathway， without integrating multiple mechanisms， pathways， and targets. Additionally， there are very few studies that summarize the corresponding relationships between the various pathogenesis mechanisms of COPD and the regulatory effects and signaling pathways of Chinese medicine. This study， for the first time， combines the latest literature in China and abroad to explain the various pathogenesis mechanisms of COPD and their interrelationships using a combination of graphs， text， and tables. It also outlines the signaling pathways， targets， and mechanisms of Chinese medicine monomers， single herbs， and compound prescriptions in regulating COPD， in order to provide new ideas and strategies for the in-depth research and systematic treatment of COPD with TCM.