Experimental & Molecular Medicine 2003;35(5):412-420
High efficiency transduction of human VEGF(165)into human skeletal myoblasts: in vitro studies.
Lei YE 1 ; Husnain Kh HAIDER ; Shujia JIANG ; Ruowen GE ; Peter K LAW ; Eugene KW SIM
Affiliations
Country
Republic of Korea
Language
English
Abstract
We report the transduction of human VEGF(165)gene into human myoblast and characterization of the transduced myoblasts for transduction and expression efficiency. Human myoblasts were assessed by immunostaining for desmin expression. A replication incompetent adenoviral vector carrying human VEGF(165)was constructed and used for transduction of myoblasts. Immunostaining of transduced myoblasts was used to determine transduction efficiency. Expression efficiency was confirmed by immunoblotting, ELISA and reverse transcription (RT)-PCR analysis using human VEGF(165)specific primers (5'-3' = 5'ATGAACTTTCTGCTGTCTTGGGTG and 3'-5' = ACACCGCCTCGGCTTGTCACA3'. Biological activity of the secreted VEGF(165)was determined by human umbilical vein endothelial cell proliferation and [H(3)] thymidine incorporation assays. Human myoblast preparation was >95% pure with 99% viability after transduction. Immunostaining showed >95% VEGF(165)positive myoblasts. Western blotting and ELISA revealed high VEGF(165)expression in the transduced myoblasts. Maximum transduction efficiency was achieved by 8 h exposure of myoblasts to virus at 1:1,000 ratio on three consecutive days. Concentration of VEGF(165)released in the culture medium peaked (37+/-3 ng/ml) at 8 days post-transduction. Cell proliferation assay on human umbilical vein endothelial cells using supernatant from VEGF(165)transduced myoblasts revealed extensive proliferation of cells which was suppressed in the presence of anti-human VEGF(165)antibody in culture medium and was further confirmed by thymidine incorporation assay. The untransduced myoblasts secreted VEGF165 in vitro (300+/-50 pg/ml) that is enhanced many folds (37+/-3 ng/ml) in VEGF(165)transduced myoblast as determined by ELISA. These studies suggest that human myoblast are potential carriers of human VEGF(165)to achieve concurrent angiomyogenesis for cardiac repair.
备案号: 11010502037788, 京ICP备10218182号-8)