Journal Detail Information

1

Cite

Share

Assessment of trans-fatty acids intake via bakery food among above three-year-old population in Beijing and Guangzhou city

Jianwen LI ; Aidong LIU ; Lei ZHANG ; Zhaoping LIU ; Ning LI

Chinese Journal of Pharmacology and Toxicology.2014;(2):283-289. doi:10.3867/j.issn.1000-3002.2014.02.024

OBJECTIVE To investigate trans-fatty acids (TFA)contents in bakery food and assess TFA intake via bakery food and its energy contribution in Beijing and Guangzhou city.METHODS Bak-ery food sa mples were collected in 201 1 ,standard GC-method were used to determine TFA content,da-ta of TFA content were analyzed by t-test to evaluate for statistically significant differences.Si mple distri-bution model(determinative risk assess ment)of TFA intake was used to calculate individual TFA intake per day(g·d -1 ,% of total energy)in different populations(grouped by ages).RESULTS Average TFA content was ranging fro m 0.01 to 0.83 g /100 g sa mple in various kinds of bakery food.TFA con-tents were equal to or lower than 0.3 g /100 g in 77.1 % of biscuits,71 .8% of bread,67.0% of pas-tries.Wafer biscuit,sandwich biscuit,puff,cake,and croissants had higher TFA contents than others, and the level was 0.65 -0.83 g /100 g sa mple.TFA content in sandwich biscuit and pie decreased sig-nificantly after 2007.Average TFA intake via bakery food was 0.049 g·d -1 in Beijing and Guangzhou city,energy contribution was 0.027% which was far below the WHO reco mmended level (1 %). Population that are 3 to 6 years old had highest TFA intake and the TFA energy contribution was 0.041 %.CONCLUSION Most of bakery products in China contained low levels of TFA;consequently, health risk caused by TFA intake in Beijing and Guangzhou was unlikely to be a concerned.However, so me type of bakery foods had higher TFA contents which could be of greater concerned for risk management.

2

Cite

Share

Probabilistic risk assessment of the dietary exposure of Chinese population to acephate using margin of exposure

Nannan YI ; Hui WU ; Xinya YAO ; Minxian ZHAO ; Zhengying CAO ; Cannan WANG

Chinese Journal of Pharmacology and Toxicology.2014;(2):279-282. doi:10.3867/j.issn.1000-3002.2014.02.023

OBJECTIVE Calculate the dietary exposure and exposure risk of Chinese consumers to acephate,using the margin of exposure method.METHODS Determine the bench mark dose of acephate by 21 -day gavage experiment of rats.According to the data from the 2002 National Diet and Nutrition Survey,the 2000 -2006 national food conta mination monitoring program,the 2005 -2006 export monitoring data of customs,calculate the dietary exposure of Chinese consumers to acephate by probabilistic assessment.Estimate the exposure risk by co mparing the margin of exposure with 100. RESULTS The bench mark dose of acephate was 0.75 mg·kg -1 ,the BMDL was 0.51 mg·kg -1 .The exposure of children was higher than that of adults.The proportion at risk of group 1 -6 y,7 -17 y and 18 y or higher was 5%,1 % and 0.1 %,respectively.CONCLUSION So me consumers was of dietary exposure risk to acephate.The high exposure of children should be of great concern.

3

Cite

Share

Biomarkers in rats for kidney damage characteristics of arsenism due to coal burning and benchmark dose analysis

Yuyan XU ; Aihua ZHANG ; Jun LI ; Liyuan CHEN ; Maolin YAO ; Chun YU ; Qibing ZENG ; Jiang HE

Chinese Journal of Pharmacology and Toxicology.2014;(2):243-247. doi:10.3867/j.issn.1000-3002.2014.02.017

OBJECTIVE Study the kidney toxic effects caused by burning coal endemic arsenism in rats,application bench mark dose (BMD) method to investigate the bench mark dose of urinary arsenic (UAs)and the changes in bio markers of renal function.METHODS Wistar rats were fed for 90 d with arsenic 0,25,50,100 mg·kg -1 conta minated feed.Urinary arsenic,kidney arsenic and renal function indicators were determined,and routine pathological and fibrosis of kidney were exa mined.UAs as the exposure bio marker,Uβ2-MG,UNAG and UALB for the effect bio markers,application bench mark dose method to calculate the BMD and BMDL of UAs for each effect bio markers.RESULTS UAs,KAs, Uβ2-MG,UNAG,UALB levels of rats in arsenic 100 mg·kg -1 group were increased than normal group (P <0.05);In light microscope,the results of HE staining of rat kidney in all arsenic dose groups showed infla mmatory cell infiltration,renal tubular epithelial cell swelling,renal interstitial capillary dila-tion,congestion and other varying degrees pathological changes,and the results of masson staining showed varying degrees of tubulointerstitial fibrosis;UAs as the exposure bio marker,Uβ2-MG,UNAG, UALB for the effects of mark,the BMD and BMDL of UAs for Uβ2-MG,UNAG,UALB were calculated, the BMD values were 998.9,1213.5,1386.9 μg·g -1 Cr,the BMDL values were 660.5,803.6 and 909. 4 μg·g -1 Cr,respectively.CONCLUSION Burning coal arsenic pollution can cause kidney da mage in rats,mini mal change nephropathy may be the pri mary pathological in the coal arsenic conta mination of kidney da mage.The BMD and BMDL of UAs were 998.9,660.5 μg·g -1 Cr,the early changes of renal function of burning coal arsenism in rats;it is reco mmended to use the more sensitive bio markers Uβ2-MG to calculate the biological exposure li mits on renal injury caused by arsenic.

4

Cite

Share

Effect of aerobic exercise on enteric nervous injury in rats exposed to malathion

Haishan LI ; Lingfang KONG ; Songtao WANG ; Erlei ZHANG ; Wenchao AI ; Wenping XIE ; Huiming CHEN

Chinese Journal of Pharmacology and Toxicology.2014;(2):238-242. doi:10.3867/j.issn.1000-3002.2014.02.016

OBJECTIVE To investigate the effects of aerobic exercise on enteric nervous injury in rats exposed to malathion.METHODS Adult male Wistar rats were treated with non-load swi mming every other day,three ti mes a week,each one hour,for six weeks.Before exercise,the rats were trea-ted with malathion 100 mg·kg -1·d -1 by oral gavage,six days a week,for six weeks.The activities of seru m acetylcholinesterase(AChE)and butyrocholinesterase(BuChE)were determined.In addition,the s mall intestinal propulsion indexes were measured.Also,the distribution of nerve plexus in ileu m was observed.The i mmunohistoche mical method was used to measure the levels of protein gene-related petide 9.5 (PGP9.5),substance P (SP),and vasoactive intestinal peptide (VIP).RESULTS Co m-pared with normal control,malathion exposure decreased the activities of seru m AChE and BuChE (P<0.01 ),increased the s mall intestinal propulsion indexes (P <0.05).In addition,the levels of PGP9.5 decreased (P<0.05).At the sa me ti me,the levels of SP increased,and the levels of VIP decreased (P<0.05).Aerobic exercise did not change the activites of cholinesterases,but decreased s mall intes-tinal propulsion indexes,increased the levels of PGP9.5,decreased the levels of SP,and increased the levels of VIP.Co mpared with the malathion exposure only,the rats in malathion ad ministration co mbined with aerobic exercise group de monstrated much lower activites of cholinesterase (P <0.01 ),and the s mall intestinal propulsion indexes decreased fro m (89 ±4)% to (79 ±5)%(P <0.01 ).Moreover,the levels of PGP9.5 increased fro m 0.012 ±0.003 to 0.029 ±0.015 (P <0.01 ).At the sa me ti me,the levels of SP decreased fro m0.174 ±0.067 to 0.1 10 ±0.057(P<0.05),and the levels of VIP increased fro m 0.0076 ±0.0029 to 0.01 1 1 ±0.0047 (P <0.05).The levels of above para meters were sa me or close to those of the normal control.CONCLUSION Malathion exposure induced disorders of enteric nervous syste m in rats,and the aerobic exercise abated the toxic response in enteric nervous syste m of malathion exposure rats.However,these effects were not mediated through recovery of cholinesterases inhibition.

5

Cite

Share

Establishment of a multiplex real time quantitative PCR method for CMV promoter nucleic acid sequences detection

Yufa MIAO ; Sanlong WANG ; Xiaobing ZHOU ; Yan HUO ; Xingchao GENG ; Jianjun LYU ; Jufeng WANG ; Bo LI

Chinese Journal of Pharmacology and Toxicology.2014;(2):296-301. doi:10.3867/j.issn.1000-3002.2014.02.026

OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.

6

Cite

Share

Assessment of 22 tumor promotion marker genes for predicting tumor promotion potential of chemicals in Bhas42 cells

Zheng SONG ; Junsong HAN ; Xijie WANG ; Jing MA

Chinese Journal of Pharmacology and Toxicology.2014;(2):274-278. doi:10.3867/j.issn.1000-3002.2014.02.022

OBJECTIVE To evaluate whether the tumor promoting activity syste m based on the ex-pression of 22 tumor pro motion marker genes in Bhas 42 cell transformation assay can be developed to be a new screening technique for predicting tumor promoting potential of che mical.METHODS Chose the 12-O-tetradecanoylphorbol-13-acetate (TPA)as positive che mical and use the Bhas 42 cell lines as test syste m.Define the day of seeding cells as d 0.On d 4,medium in each well was changed with the medium DF5F containing 0.05 mg·L -1 TPA or 0.5 %DMSO,after treat for 24,48 and 72 hrs,collect the cell samples.Extract the RNA fro m the cell samples and detect the expression of Ccnb1 ,Rif1 , Mc m3,Chek1 ,Jun,Fosl1 ,Hells,Vegfa,St mn1 ,Prl2c3,Scarb1 ,Phex,Orm1 ,Orm2,Nup54, Slc2a1 ,Il1 rl1 ,Rad51 ap1 ,Tfrc,Ab1 ,Car13 and Pik3r5 at different ti mepoints by RT-PCR.RESULTS Co mpared to the negative group,the expression of 3 genes was increased after treat with TPA for 24 hr which are Vegfa,Il1 rl1 and Pik3r5;the expression of 12 genes was increased after treat with TPA for 48 hr which are Chek1 ,Hells,Mc m3,Rad51 ap1 ,Vegfa,Il1 rl1 ,Prl2c3,Slc2a1 ,Tfrc,Ab1 ,St mn1 and Rif1 ;the expression of 10 genes was increased after treat with TPA for 72 hr which are Chek1 ,Hells, Rad51 ap1 ,Vegfa,Il1 rl1 ,Prl2c3,Slc2a1 ,Tfrc,St mn1 and Ccnb1 .CONCLUSION The 22 tumor pro-motion marker genes showed different sensitivity to the positive control che mical at different ti mepoints after treat with TPA.The result was consistent with the pro motion activity of TPA.The 22 tumor pro motion marker genes combined with the Bhas 42 cell transformation assay can be developed to be a new screening technique for predicting tumor promoting potential of che mical.

7

Cite

Share

Developmental toxicity of muscone on zebrafish embryos

Yijun CHEN ; Yuxu ZHONG ; Wu DONG ; Chunjie LI ; Lixing WANG ; Yunzhu PU ; Yannan SHANG ; Baoquan ZHAO ; Ping LIU

Chinese Journal of Pharmacology and Toxicology.2014;(2):267-273. doi:10.3867/j.issn.1000-3002.2014.02.021

OBJECTIVE To investigate the develop mental toxicity of muscone to embryos. METHODS With zebrafish embryos as a model,The 3 h post fertilization (hpf)embryos were exposed to muscone at 5,10,20,40,80 and 160 μmol·L -1 culture solutions for 96 h and inspected daily with mi-croscopy for larval morphology.The drug solution was replaced every 24 h.Spontaneous move ments were checked at 24 hpf.Heart rate at 48 hpf,hatching rate,e mbryo deformity rate and mortality rate were evaluated.The expression of sepn1 was determined with real-ti me quantitative PCR technique at 96 hpf.RESULTS The 24 hpf spontaneous move ments showed no significant difference.At 48 hpf, spine curvature,pericardial ede ma,yolk sac ede ma,and abnormal swi mming were observed.In addition, the 48 hpf heart beats(10 s)was decreased fro m 26.5 ±1 .0 to 18.0 ±1 .9(P <0.01 ).At 48 hpf , hatching rate of 5 ~40 μmol·L -1 decreased(P <0.05),while of 160 μmol·L -1 increased (P <0.05) co mpared with muscone 0 μmol·L -1 .Muscone had little effect on hatching rate at other ti me points;Mal-formation rate and mortality rate at higher concentrations were up to 100%.The sepn1 gene expression at 96 hpf in the exposure groups decreased co mpared with that of control group(P <0.01 ).CONCLU-SION Muscone had toxic effects on the develop ment of zebrafish embryos,including spine curvature, abnormal swi mming,and pericardial ede ma.These effects may be related to the inhibition of sepn1 gene expression by muscone.

8

Cite

Share

Antagonism of obidoxime on sarin induced miosis and visual impairment in rabbits

Feng CHENG ; Wanhua LI ; Yuan LUO ; Jun YANG ; Zhiyong NIE ; Xin SUI ; Yanqing LIU ; Yanping XUE ; Yongan WANG

Chinese Journal of Pharmacology and Toxicology.2014;(2):262-266. doi:10.3867/j.issn.1000-3002.2014.02.020

OBJECTIVE The antagonism of obidoxi me on sarin induced miosis and visual impair-ment was evaluated and its antagonistic mechanism was investigated.METHODS ① 30 min after sarin (2 μg /0.1 mL per eye)was given as an eyedrop,the ability of the 2.5%,5.0%,7.5% obidoxi me and 1 .0% atropine to reverse effects of sarin on pupil dia meter and light reflex were evaluated at different ti mes.② Another 36 rabbits received sarin and at 30 min afer sarin exposure,the drugs above were ad-ministrated and their effects on pupillary light reflex,as well as the AChE activity of cornea,iris and reti-na were recorded 4h after the treatment.RESULTS ① Miosis and impaired pupillary light reflex oc-curred soon after sarin exposure but the abnormal pupil width and pupillary light reflex had disappeared by 48 h after sarin exposure;Subcequent to 1 .0% atropine treatment,the pupil dilatedinstead while the impaired light reflex did not i mprove significantly;unlike atropine,soon after ad ministration of 2.5%, 5.0%,7.5% obidoxi me,the pupil dia meter and light reflex were significantly increased(P <0.01 )and then had beco me normal totally by 24 h post-dose,much faster than those of the control and atropine treatment group.However,there was no significant difference in the recovery ti me between the different dose groups of obidoxi me.② 4h after treatment,the AChE activity in cornea and irisof sarin-treated group were (42 ±4)%,(26 ±2)%,respectively;the AChE activity in cornea of 2.5%,5.0%,7.5%obidoxi me were (74 ±1 1 )%,(81 ±10)% and (74 ±7)%,respectively,and the AChE activity in iris were(39 ±10)%,(43 ±8)% and (43 ±8)%,respectively ,co mpared with sarin-treated group,AChE activities of cornea and iris as well as light reflex of the obidoxi me-treated group were significantly increased(P<0.01 ).But there was no difference in light reflex and AChE activity between the sarin-treated and atropine-treated groups.CONCLUSION Obidoxi me showed better antagonism of sarin-induced ocular effects than that of the commonly used drug,atropine;the antagonistic mechanism is likely closely related to its rapid reactivation of the inhibited AChE in the cornea and iris.

9

Cite

Share

Reactivation of nanoparticulated HI-6 on acetylcholinesterase activity in soman poisoned mice

Feijian WANG ; Jun YANG ; Feng CHENG ; Wanhua LI ; Zhiyong NIE ; Yuan LUO ; Xin SUI ; Zhao WEI ; Zhibing ZHENG ; Yongan WANG ; Tongyu FANG

Chinese Journal of Pharmacology and Toxicology.2014;(2):255-261. doi:10.3867/j.issn.1000-3002.2014.02.019

OBJECTIVE Based on different drug loading models,three types of nanoparticulated HI-6 were prepared and their reactivations on inhibited acetylcholinesterase (AChE)in peripheral and central nervous syste ms were evaluated and compared in so man-intoxicated mice.METHODS Three kinds of nano-reactivators including HI-6 loaded human serum albunin nanoparticle (HSA-HI-6 NP),HI-6 absorptive mesoporous silica nanoparticle(MSN-HI-6),polylactico-glycolic acid nanoparticle coated HI-6 (PLGA-HI-6 NP)were prepared.The characteristic of all blank nanocarriers was observed through elec-tron microscope.HI-6 release rate of nano-reactivators was also determined in vitro.Then the reactiva-tion rate of nano-reactivators at a constant HI-6 dosage(22 mg·kg -1 )on so man-inhabited AChE both in blood and brain was assessed the so man intoxicated mice(120 μg·kg -1 ,sc).RESULTS All the syn-thetic nanocarriers met the de mand for nanodrug use in vivo.The rate of HI-6 release of nano-reactiva-tors was HI-6 >HSA-HI-6 NPs >MSN-HI-6 >PLGA-HI-6 NP in vitro.On the reactivations of so man-inhibited mice blood AChE,the free HI-6 and HSA-HI-6 NPs,as well as MSN-HI-6 showed co mparable reactivation rates(20% -30%)but were greater than that of PLGA-HI-6 NPs (6.2%)(P <0.01 ). However on the reactivations of so man-inhibited mice brain AChE,the reactivation rate of HSA-HI-6 NP (15.3%)was significantly higher than that of PLGA-HI-6 NP(3.3%)and free HI-6(6.3)(P<0.01 ).In addition,MSN-HI-6 group had a significant reactivation rate compared to PLGA-HI-6 NPs(P <0.01 ). But there was no statistic difference between MSN-HI-6 and free HI-6.CONCLUSION The reactivation potency changed obviously with different drug loading models and HSA-HI-6 NPs had the most potent reactivation on so man-inhibited AChE in both blood and brain.

10

Cite

Share

Urine biomarkers after acute kidney injury in rats induced by gentamycin

Yunliang QIU ; Min HONG ; Xin FU ; Huanxia HUANG ; Jing MA

Chinese Journal of Pharmacology and Toxicology.2014;(2):248-254. doi:10.3867/j.issn.1000-3002.2014.02.018

OBJECTIVE To investigate the time and dose relation of new urine bio markers in rat model of acute kidney injury induced by genta mycin (GM)to search for more sensitive,noninvasive and specific markers than traditional approaches to monitor nephrotoxicity.METHODS SD Rats were im treated with GM5,20,80 mg·kg -1 or saline once daily.Rats were randomly divided into 20 subgroups:treated for 1 ,3,7,14 d and 14 d followed with 28 d recovery period.Ten rats per group (5 rats per sex)were scarified at 24 h after the last dosing or the end of recovery period.Blood sa mples were col-lected for blood urea nitrogen (BUN)and creatinine(CRE)analysis.Urine was collected at each nec-ropsy for urine protein by dry che mistry method,for kidney injury molecule-1 (KIM-1 )analysis by ELISA, and for β2-microglobulin (β2-MG)analysis by ELISA.Kidneys were obtained for histological exa mination after HE stains.RESULTS Positive protein(3 +)was noted for several fe male animals treated for 7 or 14 d at 80 mg·kg -1 and the tendency of recovery were noted at the end of recovery period.Co mpared with those in saline control group treated for 7 d,the seru m BUN and CRE levels for fe males and the CRE level for males were significantly increased at 80 mg·kg -1 (P <0.05),and the BUN level showed the tendency of increase for males at 80 mg·kg -1 (P >0.05).When treated for 14 d,the seru m BUN and CRE levels for fe males and males at 80 mg·kg -1 and the seru m CRE level for fe males at 20 mg·kg -1 were significantly increased when compared with those in saline control group(P <0.05). The seru m BUN and CRE recovered to base line for all animals treated for 14 d followed by a 28 d recov-ery period.Histopathological observation of kidney tissues indicated that focal tubule dilatation was noted for animals treated for 3 d at 20 and 80 mg·kg -1 ,infla mmatory cell infiltration and focal tubule dilatation were noted at 20 mg·kg -1 and focal renal tubular epithelial cell degeneration,infla mmatory cell infiltra-tion,focal casts (lightly)were noted at 80 mg·kg -1 for animals treated for 7 or 14 d.For animals treated for 14 d followed by a 28 d recovery period,only basophilic tubules and renal casts were noted at 80 mg·kg -1 .New urine bio markers determination indicated that KIM-1 level was significantly increased at 20 and 80 mg·kg -1 for animals treated for 3,7 or 14 d when compared with that in saline control group (P<0.05).For animals treated for 14 d followed by a 28 d recovery period,the KIM-1 level was still significantly higher than saline control group for males and fe males at 80 mg·kg -1 and males at 20 mg·kg -1 (P <0.05 ),but there was evidence for reversal.The β2-MG level was significantly increased at 80 mg·kg -1 for animals treated for 3 d(P<0.05),at 20 or 80 mg·kg -1 for animals treated for 7 or 14 d(P<0.05 or P<0.01 ),when compared with that in the saline control group.For animals treated for 14 d followed by a 28 d recovery period,the β2-MG level was still significantly higher than saline control group for males and fe males at 80 mg·kg -1 and fe males at 20 mg·kg -1 (P <0.05),but there was also evidence for reversal.CONCLUSION Urine KIM-1 and β2-GM are more sensitive and specific markers for early diagnosis of kidney injury induced by GM when compared with the traditional approaches to monitor nephrotoxicity.

DISPLAY OPTIONS

Cite

Share

Cite

Share

Cite

Share

Cite

Share

Cite

Share

Cite

Share

Cite

Share

Cite

Share

Cite

Share

Cite

Share