3.Expression of USP15, TβR-I and Smad7 in psoriasis.
Ai-Ping, FENG ; Yi-Min, HE ; Xin-Xin, LIU ; Jia-Wen, LI ; Ya-Ting, TU ; Feng, HU ; Shan-Juan, CHEN
Journal of Huazhong University of Science and Technology (Medical Sciences) 2014;34(3):415-9
The deubiquitinating enzyme ubiquitin specific peptidase 15 (USP15) is regarded as a regulator of TGFβ signaling pathway. This process depends on Smad7, the inhibitory factor of the TGFβ signal, and type I TGFβ receptor (TβR-I), one of the receptors of TGFβ. The expression level of USP15 seems to play vital roles in the pathogenesis of many neoplasms, but so far there has been no report about USP15 in psoriasis. In this study, immunohistochemical staining of USP15, TβR-I and Smad7 was performed in 30 paraffin-embedded psoriasis specimens and 10 normal specimens to investigate the expression of USP15, TβR-I and Smad7 in psoriasis and to explore the relevance among them. And USP15 small interfering RNA (USP15 siRNA) was used to transfect Hacat cells to detect the mRNA expression of TβR-I and Smad7. Of 30 cases of psoriasis in active stage, 28, 24 and 26 cases were positive for USP15, TβR-I and Smad7 staining, respectively. The positive rates of USP15 and Smad7 were significantly higher in psoriasis specimens than in normal skin specimens (44.1%±26.0% vs. 6.1%±6.6%, 47.2%±27.1% vs. 6.6%±7.1%), and positive rate of TβR-I (20.3%±22.2%) in psoriasis was lower than that in normal skin specimens (46.7%±18.2%). There was a significant positive correlation between USP15 and Smad7 expression, and significant negative correlations between USP15 and TβR-expression, an I d between TβR- and Smad7 expression I in psoriasis. After transfection of USP15 siRNA in Hacat cells, the expression of TβR-mRNA was up I -regulated and that of Smad7 was down-regulated. It is concluded that USP15 may play a role in the pathogenesis of psoriasis through regulating the TβR-I/Smad7 pathway and there may be other cell signaling pathways interacting with USP15 to take part in the development of psoriasis.
4.Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis
Zhu JI-TING ; Lin HAN ; Wu XUAN ; Li ZHI-WEN ; Lin AI-YU
Chinese Medical Journal 2019;132(23):2827-2834
Background: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATITA-GAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOV A)in R software.Results: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each <1.41%).ITS genotype was 4efined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P = 0.0014)between infectious group and control group was observed.Conclusions: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.
5.Isolation and identification of Sclerotinia stem rot causal pathogen in Arabidopsis thaliana.
Ai-Rong WANG ; Wen-Wei LIN ; Xiao-Ting CHEN ; Guo-Dong LU ; Jie ZHOU ; Zong-Hua WANG
Journal of Zhejiang University. Science. B 2008;9(10):818-822
A new stem rot disease is found to occur naturally on Arabidopsis plants in greenhouses of Fuzhou, China. In order to identify its pathogen, we conducted a series of fungal isolation and purification, plant reinoculation, and ascus and ascospore induction from the sclerotia. The isolate caused typical water-soaked lesions after reinoculation and produced sclerotia both on Arabidopsis plants and culture medium plates, and the sclerotia could be induced to produce discal apothecia and 8 binucleate ascospores per ascus. These disease symptom and fungal morphology data revealed that the fungus Sclerotinia sclerotiorum (Lib.) de Bary was the pathogen for Arabidopsis stem rot. To confirm this, we further amplified its large subunit ribosomal DNA (LSU rDNA) by polymerase chain reaction (PCR), and compared the sequence with the known LSU rDNA sequences in GenBank. The results show that the sequence shares the highest identities with the LSU rDNAs of different S. sclerotiorum strains. Taking all these data together, we concluded that the fungus that caused the Arabidopsis stem rot is S. sclerotiorum (Lib.) de Bary. This is the first report that Arabidopsis is naturally infected by S. sclerotiorum.
Arabidopsis
;
microbiology
;
Ascomycota
;
classification
;
genetics
;
isolation & purification
;
pathogenicity
;
Base Sequence
;
China
;
DNA, Fungal
;
genetics
;
DNA, Ribosomal
;
genetics
;
Phylogeny
;
Plant Diseases
;
microbiology
;
Plant Stems
;
microbiology
6.Chemical constituents from marine fungus Penicillium thomii.
Ting JIANG ; Li TIAN ; Ai-hua GUO ; Hong-zheng FU ; Yue-hu PEI ; Wen-han LIN
Acta Pharmaceutica Sinica 2002;37(4):271-274
AIMTo investigate the bioactive constituents from the mycelium of Penicillium thomii. Which isolated from Anemone collected in Qingdao beach.
METHODSThe constituents were separated by using various chromatography and the structures were identified on the basis of extensive spectral analysis.
RESULTSFive compounds, namely penicillixanthone A (I), p-methylbenzolic acid (II), 1-O-hexadecanoyl-2-O-(9-octadecenoyl)-3-O-(9, 12-octadecadienoyl) glycerol (III), 5 alpha, 8 alpha-epidioxy-24 zeta-methylcholesta-6, 22-dien-3 beta-ol (IV) and 1, 6, 8-trihydroxyl-3-methyl-9, 10-anthracenedione (V), were isolated from the mycelium of Penicillium thomii.
CONCLUSIONPenicillixanthone A is a new compound, while the others are isolated from Penicillium thomii for the first time.
Animals ; Molecular Conformation ; Molecular Structure ; Penicillium ; chemistry ; isolation & purification ; Sea Anemones ; microbiology ; Xanthones ; chemistry ; isolation & purification
7.Clinical Significance of Serum Level of Cyclopropaneoctanoic Acid 2-Hexyl in Patients with Hypertriglyceridemia-Related Disorders
ting Wen AI ; Jie DU ; jun Xin CHEN ; zhou Bao JIANG ; hong Xiu LI
Journal of Modern Laboratory Medicine 2017;32(5):19-23
Objective To observe the serum level of cyclopropaneoctanoic acid 2-hexyl (CPOA2H) in patients with hypertrilyceridemia-related disorders,and investigate its clinical significance.Methods 53 obese patients (Obese group),62 obese patients after a 3 month low calorie diet (Obese patients after low calorie diet group),46 patients with chronic kidney disease (CKD group),and 60 healthy controls (Control group) were collected from Mar 2013 to Dec 2015 in Shaanxi Provincial People's Hospital.Gas chromatography-mass spectrometry (GC-MS) were used to detect the serum fatty acid and CPOA2H level in four groups.Results Ages,body mass index (BMI),C-reaction protein (CRP),total cholesterol (TC),triacylglycerols (TAG) among four groups had significant difference (F=6.85 ~ 25.36,P<0.05).Most saturated fatty acid (14 ∶ 0,16 ∶ 0) and monounsaturated fatty acid (14 ∶ 1,16 ∶ 1,18 ∶ 1,20 ∶ 1) in obese group were higher than controls (F=3.251~7.351,P<0.05).The polyunsaturated fatty acid (18 ∶ 2n-6,20 ∶ 4n-6) in CKD group were lower than controls (F=4.351 ~6.251,P<0.05).There existed significant difference of serum levels of CPOA2H among four group (F=19.95,P=0.005).Serum level of CPOA2H in control (r=0.63,P=0.033) and CKD group (r=0.61,P=0.044) were positively related with TAG.Serum level of CPOA2H in obese group and obese patients after low calorie diet group were positively related with TC (r=0.70,P=0.011;r=0.48,P=0.021) and TAG (r=0.75,P=0.024;r=0.72,P=0.018).Conclusion Hypertrilyceridemia-related disorders,such as obesity and CKD,presented with elevated serum levels of CPOA2H,it suggested that serum level of CPOA2H is positively related to serum TAG concentration rather than BMI.
8.Differentiation of mesenchymal stem cells into cardiomyocytes induced by cardiomyocytes.
Ting-Zhong WANG ; Ai-Qun MA ; Zheng-Yun XU ; Wen-Hui JIANG ; Yuan DU
Journal of Central South University(Medical Sciences) 2005;30(3):270-275
OBJECTIVE:
To investigate the role of adult cardiomyocytes in the differentiation of mesenchymal stem cells (MSCs) into cardiomyocytes.
METHODS:
Rat MSCs were isolated by a Percoll's gradient solution and cultured in low-glucose Dulbecco' s modified Eagle' s medium (DMEM). After 2 passages, cell-surface antigen CD34, CD71 and CD90 for rat MSCs were determined by flow cytometry, and these MSCs were transfected with pEGFP-N3 by Lipofectamine2000. Then those MSCs labeled with GFP, were cultured in contacted, nocontacted and conditioned with adult rat myocardiocytes. Immunofluorescence staining against alpha-actin, desmin, and troponin-T were performed after 1 week.
RESULTS:
Immunofluorescence staining was positive against alpha-actin, desmin, and troponin-T on MSCs in contacted culture group. In contrast, no alpha-actin, desmin, and troponin-T expression on MSCs were observed in the noncontacted culture group and the conditioned culture group.
CONCLUSION
Direct cell-to-cell contact between MSCs and adult cardiomyocytes may induce differentiation of MSCs into cardiomyocytes.
Animals
;
Antigens, CD34
;
analysis
;
Bone Marrow Cells
;
cytology
;
Cell Communication
;
Cell Differentiation
;
physiology
;
Cell Separation
;
Cells, Cultured
;
Coculture Techniques
;
Female
;
Male
;
Mesenchymal Stem Cells
;
cytology
;
Myocytes, Cardiac
;
cytology
;
Rats
;
Rats, Sprague-Dawley
;
Thy-1 Antigens
;
analysis
9.Research progress in role of myeloid cells in tumor microenvironment and its mechanisms
Jia-Wei WU ; Yu-Zhu CAO ; Su-Yun YU ; Ting-Ting ZHANG ; Yu YANG ; Wen-Xing CHEN ; Ai-Yun WANG ; Yin LU
Chinese Pharmacological Bulletin 2018;34(2):149-153
In recent years,a large number of studies have shown that myeloid cells in tumor microenvironment play an important role in tumorigenesis and tumor progression.On one hand,myeloid cells can regulate human immune system;on the other hand,myeloid cells can influence tumor progression,metastasis and clinical treatments.In this review,we summarize the interaction between myeloid cells and tumors,discuss the effects of myeloid cells after recruited to tumor sites and its mechanisms,try to put forward clinical therapy targeting myeloid cells and provide references for the following research and clinical treatments.
10.Morroniside inhibits H2O2-induced apoptosis in cultured nerve cells.
Hou-Xi AI ; Wen WANG ; Fang-Lin SUN ; Wen-Ting HUANG ; Yi AN ; Lin LI
China Journal of Chinese Materia Medica 2008;33(18):2109-2112
OBJECTIVETo investigate the effects of morroniside on H2O2-induced apoptosis in nerve cells.
METHODHuman neuroblastoma cell line SH-SY5Y cells were pre-incubaed with morroniside (1, 10, and 100 micromol x L(-1)) for 24 h prior to exposure to H2O2 (500 micromol x L(-1)) for 18 h. The activity of reactive SOD was measured by a biochemical assay. The expression of caspase-3, caspase-9, Bcl-2 and Bax was determined by Wastern blotting method.
RESULTPretreatment of the cells with morroniside (10 and 100 micromol x L(-1)) increasd SOD activity by 14% (P<0.01) and 11% (P<0.05) in comparison with cells exposed only to H2O2. Morroniside (1, 10, 100 micromol x L(-1)) lowered caspase-3 level by 31% (P<0.01), 103% (P<0.001) and 95% (P<0.001), decreased caspase-9 content by 71% (P<0.001), 132% (P<0.001) and 37% (P<0.05), and increasd Bcl-1 level by 88% (P<0.01), 121% (P<0.001) and 60% (P<0.01) respectively but no significant change occurred in Bax level in comparison with cells exposed only to H2O2.
CONCLUSIONMorroniside has neuroprotection effect against H2O2-induced oxidation injury in nerve cell.
Animals ; Apoptosis ; drug effects ; Blotting, Western ; Caspase 3 ; metabolism ; Caspase 9 ; metabolism ; Cell Line, Tumor ; Enzyme Activation ; drug effects ; Glycosides ; pharmacology ; Humans ; Hydrogen Peroxide ; pharmacology ; Mice ; Neurons ; cytology ; drug effects ; metabolism ; Oxidants ; pharmacology ; Proto-Oncogene Proteins c-bcl-2 ; metabolism ; Reverse Transcriptase Polymerase Chain Reaction ; Superoxide Dismutase ; metabolism