Toll signaling pathway may play a curcial role in induction of inflammation-associated gene activation. Originally, the Toll/spaetzle/Cactus-Dorsal signaling pathway is established in the Drosophila embryonic development. Recently, the Toll signaling pathway in adult Drosophila has been established in the induction of antimicrobial peptide expression. Five human Toll-like receptor genes (h Tlr l-5 ) and one mouse Toll-like receptor gene (m Tlr-4 ) have been isolated. Toll and Toll-like receptor genes encoded molecules are transmembrane proteins with an extracellular leucine repeat domain and a cytoplasmic domain homologous to IL-1 receptors. The intracellular signaling cascade involves Tube, Pelle, and Cactus-Dorsal complex in Drosophila, and MyD88, IRAK, TRAF 6, NIK, ??-I ?B kinase, and I ?B -NF?B complex in mammals. Dorsal and NF?B are transcription factors, while Cactus and I?B are their inhibitors. When the inhibitors phosphorylated, the nuclear factors are released and move into nucleus, leading to immune gene activation. It has been shown from in vitro system that Tlr -4 mediated LPS signaling in human monocytes for expression of IL-1, IL-6, IL-8, and costimulator B7-1 which provides second signal for T cell response. Tlr -2 can also mediate LPS signaling in human monocytes, leading to the production of proinflammatory mediators. Microbial lipoproteins are potent stimulators of IL-12 production through Tlr -2 signaling by human macrophages, and can stimulate Tlr 2-dependent transcription of inducible nitric oxide synthase and the production of nitric oxide, a powerful microbicidal pathway. Findings of a point mutation of Tlr-4 in LPS tolerant C3H/HeJ mouse strain and a deletion of Tlr-4 in LPS resistant C57BL/10ScCr mice provide an in vivo evidence strongly supporting the crucial role of Tlrs in LPS mediated inflammation. It is proposed that targeting Tlrs would develop new remedies for treatment of inflammatory disorders and for immunotherapy of mucosal infections and cancer, etc.

Aged ; Antigens, CD20 ; metabolism ; Brain Neoplasms ; metabolism ; pathology ; Humans ; Immunohistochemistry ; Leukocyte Common Antigens ; metabolism ; Lymphoma, Large B-Cell, Diffuse ; metabolism ; pathology ; Male ; Vascular Neoplasms ; metabolism ; pathology

Objective To probe the changes of CT values in liver parenchyma in order to evaluate the therapeutic effect of acute pancreatitis.Methods 104 patients with acute pancreatitis which were diagnosed and treated by department of gastroenterology.Ac-cording to pathological results,the patients were divided into mild acute pancreatitis (MAP)group and severe acute pancreatitis (SAP)one.The CT values of liver parenchyma were measured before and after treatment,and the correlations between CT values changes and the amylase in blood and urine were analyzed.Results The CT values of liver parenchyma showed a negative correlation with the pathological severity of acute pancreatitis (r=-0.089,P <0.05).The accuracy using the changes of CT values to evaluate the therapeutic effect was significantly different between the MAP and the SAP group with different sensitivity of 92.2% and 85.7%and specificity of 33.3% and 94.1% respectively.In addition,the changed trend of CT values in liver parenchyma showed negative correlations with triglycerides and blood amylase.Conclusion CT scan is a useful imaging method in evaluating the liver damage and the therapeutic effect in patients with acute pancreatitis in emergency.

AIM: To study the regulation of rat ?-defensin-2 gene expression by bacteria.METHODS: E.coli ML-35 p and pseudomonas aeruginosa were injected into rat trachea. Total RNA was isolated from lung tissue after 24 h inoculation. RT-PCR and Northern blot were performed to detect ?-defensin-2 ( rBD-2 ) mRNA expression.RESULTS: The expression of rBD-2 gene was inhibited in the lung tissue by E.coli infection, but not by pseudomonas aeruginosa. CONCLUSION: These results indicated that E.coli infection could down-regulate rBD-2 gene expression in the rat lung tissues.

AIM: To investigate the developmental regulation of β-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P1: TTCAGTCATGAGGATCCATT AC; P2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS： Rat β-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION： The rat β-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that β-defensin-2 may play a role in the lung innate defense against infection.

AIM: To determine tissue distribution of rat ?-defensin rBD-1 gene expression.METHODS: Total RNA was isolated from 10 kinds of rat tissues. RT-PCR were performed with primers (R 1 5′→3′ ACTCTGGACCCTGACTTCACCG; R 2 5′→3′ CCCTTGCTTGTCCTTTATGTCC). The RT-PCR products around 272 bp in size were cloned into pGEM-T easy vector and the recombinant clones were analyzed by digestion with restriction endonucleases and DNA sequencing.RESULTS: Rat ?-defensin rBD-1 transcripts were found in the kidney and skin, whereas its mRNA was not detected in trachea, uterus, bladder, small intestine, spleen, skeletal muscle, bone marrow and parotid. Sequence analysis confirmed that the RT-PCR product is rBD-1 cDNA. CONCLUSION: These data suggested that ?-defensin rBD-1 may participate not only in the kidney but also in the skin natural defense against infections.

AIM: To investigate the developmental regulation of ?-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P 1: TTCAGTCATGAGGATCCATT AC; P 2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS: Rat ?-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION: The rat ?-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that ?-defensin-2 may play a role in the lung innate defense against infection.

As a kind of additive in feed of monogastric animals, the application of natural phytase is limited due to its disadvantages. In this paper, the strategies of phytse reform was introduced. Furthermore, the research and progress on protein engineering of feed phytase was reviewed, including phytase over-expression, phytase thermostability, catalytic efficiency and optimum pH.

Objective To detect the expression of DNA damage response genes induced by radiation in human peripheral blood lymphocyte,and to explore the new biomarkers of radiation.Methods The human peripheral blood cells were irradiated to X-rays at different doses of 0,1,2,3,4,and 5 Gy.The quantitative real.time qPCR wag used to detect the expressions of cyclin-dependent kinase inhibitor l a gene(Cdknl a)and growth arrest and DNA damage inducible gene(Gadd45a)in lymphoeytes at 4 and 24 h post-irradiation,respectively.The method of CB mieronucleus was used to determine the change of micronucleus ratio.Results The expression of Cdknl a in peripheral blood lymphocytes wag increased significantly at 4 and 24 h post-irradiation to 0-5 Gy.reached the peak at 4 Gy and began to decrease at 5 Gy,which showed a dose-dependent manner(r=0.946,0.975,P<0.05).Similarly,the expression of Gadd45α in human peripheral blood lymphocytes was also increased significantly at 4 and 24 h post-irradiation to 0-5 Gy in a dose-dependent manner,while the expression of Gadd45a at 4 h wag higher than that at 24 h(r=0.936,0.797,P<0.05).The ratio of micronuclei wag increased significantly at 4 and 24 h post-irradiation to 0-5 Gy(r=0.990,0.984,P<0.05).Conciusions Cdknl a and Gadd45α expression could be increaged significandy at 4 and 24 h post-irradiation to 0-5 Gy,showing a good linear relationship.which might be candidate for radiation biological dosimeter.

Arthritis, Juvenile ; diagnosis ; pathology ; Biomarkers, Tumor ; blood ; Biopsy ; Bone Neoplasms ; diagnosis ; pathology ; Child, Preschool ; Diagnostic Errors ; Female ; Hip Joint ; diagnostic imaging ; pathology ; Humans ; Ilium ; diagnostic imaging ; pathology ; Magnetic Resonance Imaging ; Radiography ; Sarcoma, Ewing ; diagnosis ; pathology