1.Analysis on the diagnosis and medication treatment of granulomatosis with polyangiitis
Jian SHEN ; Ji-Ping ZHU ; Ting-Ting YAN
The Chinese Journal of Clinical Pharmacology 2015;(13):1309-1311
Objective To investigate the role of clinical pharmacists in the diagnosis and treatment of granulomatosis with polyangiitis ( GPA). Methods The effect of anti-infection treatment was not so good in the early days, so the clinical pharmacist proposed to increase the doses of vancomycin to achieve the effective antibacterial blood concentration .Af-ter the GPA diagnosis was confirmed , the clinical pharmacist formulated therapeutic regimens with the physicians through searching literatures . Results and Conclusion The clinical pharmacist successfully assisted the physicians in the diagnosis and treatment of such difficult disease . The clinical pharmacist , as a member of the health care team in the diag-nosis and treatment of difficult cases , could do well by their pharmaceuti-cal expertise and continuous learning .
2.Study on effects of puerariae radix flavones on the proliferation of multiple myeloma cell lines U266 and RPMI 8226
Xiaodu XU ; Qun SHEN ; Jianmin JI ; Ou JI ; Yueyan YANG ; Guangrong ZHU ; Yu WU ; Ting CHEN ; Yanli LI
Journal of Leukemia & Lymphoma 2013;22(1):42-46
Objective To investigate the effects on proliferation of multiple myeloma cell lines U266 and RPMI 8226 induced by puerariae radix flavones (PRF) in vitro and its possible mechanism.Methods Exposed to 0,10,30,50,100 μg/ml PRF for 48 h and 72 h,the U266 and RPMI 8226 cells proliferation inhibitory rates were detected by MTT assay,cell cycles by flow cytometry (FCM),morphologic changes of U266 cells by Wright' s staining,and early-stage apoptotic rates of U266 cells by FITC-Annexin V/PI staining with FCM.Analysis of DNA fragment was made to test characteristic apoptosis DNA ladder in U266 cells.Results 0,10,30,50,100 μg/ml PRF could inhibit the proliferation of U266 and RPMI 8226 cells in a dose-dependent manner (U266 > RPMI 8226).Cell cycle analyses in U266 and RPMI 8226 cells showed that sub-diploid peaks,but cell cycles changed minor.Wright's staining of U266 cells showed hardly any apoptostic character istic.Annexin V/PI double staining indicated that early-stage apoptotic rates of U266 cells exposed to 0,10,30,50,100 μg/ml PRF for 48 h were mildly increased in a dose-dependent manner.They were (3.20±0.36) %,(5.20±0.92) %,(7.30±1.22) %,(8.10±0.53) % and (10.80±0.90) %,respectively.The group differences had statistical significance (P < 0.05).Analysis of DNA fragment barely exhibited the characteristic DNA ladder in U266 cells.Conclusion A certain concentrations of PRF could inhibit the proliferation of U266 and RPMI 8226 cells significantly.It is suggested that apoptosis related to the proliferative inhibition mechanism induced by PRF in U266 cell line,but not main.Other pathways such as necrosis and autophagy whether or not involved need further investigation.
3.Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis
Zhu JI-TING ; Lin HAN ; Wu XUAN ; Li ZHI-WEN ; Lin AI-YU
Chinese Medical Journal 2019;132(23):2827-2834
Background: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATITA-GAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOV A)in R software.Results: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each <1.41%).ITS genotype was 4efined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P = 0.0014)between infectious group and control group was observed.Conclusions: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.
4.Inhibitory effect of dutasteride on the expressions of epididymal Claudin1 and β-catenin in male rats.
Shu-wu XIE ; Li-juan QU ; Xian-ying ZHOU ; Jie-yun ZHOU ; Guo-ting LI ; Ji-hong BI ; Xiang-jie GUO ; Zhao LI ; Lin CAO ; Yan ZHU
National Journal of Andrology 2015;21(1):17-22
OBJECTIVETo explore the molecular mechanism of dutasteride inhibiting fertility by studying its effects on the expressions of the epididymal epithelial junction proteins Claudin1 and β-catenin in rats.
METHODSSixteen 3-month-old SD male rats were equally divided into an experimental and a negative control group to be treated intragastrically with dutasteride at 40 mg/kg per day and the same dose of solvent, respectively, for 14 consecutive days. Then, the sperm motility and morphology of the rats were detected by computer-assisted sperm analysis, the serum levels of testosterone (T) and dihydrotestosterone (DHT) measured by ELISA, changes in the tight junction of epididymal cells observed under the transmission electron microscope, the protein and gene expressions of Claudin1 and β-catenin determined by RT-PCR and immunohistochemistry, and the conception rate of the mated female rats calculated.
RESULTSDutasteride significantly suppressed the serum DHT level, sperm motility, and fertility of the rats (P <0.05). Interspaces between epididymal epithelial cell tight junctions were observed, the volume of epididymal fluid obviously increased, and the expressions of Claudin1 and β-catenin gene and protein remarkably downregulated in the experimental rats (P <0.05).
CONCLUSIONDutasteride can significantly inhibit the fertility of male rats by reducing the serum DHT level, suppressing Claudin1 and β-catenin expressions, and damaging epididymal epithelial cell junctions.
Animals ; Azasteroids ; pharmacology ; Claudin-1 ; metabolism ; Dihydrotestosterone ; blood ; Dutasteride ; Epididymis ; drug effects ; metabolism ; Female ; Fertility ; drug effects ; Humans ; Intercellular Junctions ; drug effects ; Male ; Rats ; Rats, Sprague-Dawley ; Sperm Motility ; drug effects ; Testosterone ; blood ; Urological Agents ; pharmacology ; beta Catenin ; metabolism
5. The clinical application value of ultrasound-guided percutaneous lung biopsy in the diagnosis of peripheral lung lesions of silicosis
Decai ZENG ; Ji WU ; Linping ZHU ; Hui CHEN ; Ting ZHANG ; Ying TAN ; Xueyu CHE
Chinese Journal of Ultrasonography 2018;27(6):524-528
Objective:
To determine the clinical application value of percutaneous lung biopsy guided by ultrasound in the diagnosis of peripheral lung lesions of silicosis.
Methods:
Experimental silicosis was produced in rabbits by the intratracheal administration of silica with non-exposure method. Imaging changes were observed in 36 rabbits on 60 days after intratracheal instillation of silica. To contrast with CT results, percutaneous lung biopsy of peripheral lesions was guided by ultrasound. The success rate of sufficient material, the diagnosis rate of coincidence between biopsy and pathology, and the incidence of complications were calculated. The biopsy with sufficient material, biopsy findings coincided with pathological results and no complications were defined as strictly success of the puncture. The baseline data and monitoring index were compared between successful biopsy group and unsuccessful biopsy group. Each rabbit was intravenously administrated by 10 000 U of heparin for the antiocoagulation and sacrificed by fast injection of 10% KCl through jugular vein catheterization. Specimens from lung tissue were collected and stained with hematoxylin-eosin. Pathological changes of lung tissue were observed through an optical microscope.
Results:
Of 36 silicosis rabbits, peripheral lung lesions of silicosis were observed in 30 rabbits. Biopsy procedures were performed with ultrasound guidance in 30 rabbits. The total success rate of biopsy was 70% (21/30). The success rate of sufficient material was 93% (28/30), the diagnosis rate of coincidence between biopsy and pathology 86%(24/28), and the incidence of complications was 10% (3/30) respectively. Compared with failure group, peripheral lesions in successful biopsy group were bigger in size, closer to the chest wall, and lower respiratory rate, the difference was statistically significant (
6.Castleman Tumor in Association with Paraneopiastic Pemphigus-A Report of 10 Cases
Xuejun ZHU ; Jing WANG ; Xixue CHEN ; Rengui WANG ; Lanbo ZHANG ; Ting LI ; Aiping WANG ; Shuxia YANG ; Ping TU ; Ruoyu LI ; Yan WU ; Haizhen YANG ; Suzhen JI
Chinese Journal of Dermatology 2003;0(12):-
Objective To obtain a better understaning of the clinical features of Castleman tumor associated paraneoplastic pemphigus. Methods The clinical features and therapy of 10 cases of this disease, diagnosed in the Department of Dermatology of Peking University First Hospital were analyzed. Results Castleman tumor was shown to be the most common neoplasm associated with paraneoplastic pemphigus in China. The clinical presentations, histopathologic characteristics, CT scan findings, and immunologic features were all unique. The early diagnosis and removal of the Castleman tumor are crucial for the treatment of this tumor-associated autoimmune disease. Conclusions Because Castleman tumor is directly related to the induction of autoimmunity, early diagnosis and prompt removal of the tumor are essential to the management of this disease.
7.Preparation of mesoporous silica nanoparticles with different sizes and study on the correlation between size and toxicity
Xiao-wei XIE ; Meng-ying CHENG ; Wei-xiang FANG ; Xue LIN ; Wen-ting GU ; Kai-ling YU ; Ting-xian YE ; Wei-yi CHENG ; Li HE ; Hang-sheng ZHENG ; Ying-hui WEI ; Ji-gang PIAO ; Fan-zhu LI
Acta Pharmaceutica Sinica 2023;58(8):2512-2521
To investigate the crucial role of particle size in the biological effects of nanoparticles, a series of mesoporous silica nanoparticles (MSNs) were prepared with particle size gradients (50, 100, 150, 200 nm) with the traditional Stober method and adjusting the type and ratio of the silica source. The correlation between toxicity and size-caused biological effects were then further examined both
8.Regulatory effect of miR-29b on OPN/TGF-β pathway and the change of this pathway in a high glucose environment in a renal cell co-culture system
Juan LIU ; Ming-Zheng YANG ; Xiao-Ying LI ; Ting-Ting JI ; Xiao-Yan XIONG ; Ying-Chun ZHU ; Shou-Jun BAI
Fudan University Journal of Medical Sciences 2024;51(6):921-930
Objective To establish a renal cell co-culture system to simulate the renal barrier system,and to test its responsiveness to different glucose concentrations,and to investigate the regulatory effect of miR-29b-3p on osteopontin(OPN)/transforming growth factor β(TGF-β)pathway and the changes of this pathway under high glucose condition.Methods The three-cell co-culture system consisting of human renal podocytes,human glomerular mesangial cells and human renal tubular epithelial cells was established to test the cell viability and glucose consumption value at glucose concentrations of 5,8,12 and 16 mmol/L.The content of TGF-β and OPN in cell supernatant was measured.The recombinant plasmid and siRNA of OPN were transfected,and the expressions of TGF-β and OPN were detected by Q-PCR and Western blot.Results The mRNA expressions of OPN,TGF-β and miR-29b were significantly increased at 12 mmol/L glucose conditions.Western blot results showed that the protein expression of OPN increased in high glucose conditions,while the protein expression of TGF-β did not change significantly.After adding miR-29b-3p activator,the mRNA levels of OPN and TGF-β in the cell supernatant were significantly increased.After adding miR-29b-3p inhibitor,the mRNA levels of OPN and TGF-β in the cell supernatant were significantly decreased.Western blot results showed that compared with 5 mmol/L glucose,the protein expressions of OPN and TGF-β were increased by miR-29b-3p activator,and the protein expressions of OPN and TGF-β were decreased by miR-29b-3p inhibitor.After transfection with OPN recombinant plasmid,the content of TGF-β in the cell supernatant was significantly increased,and the mRNA expressions of OPN and TGF-β in the cells were significantly increased.After transfection with OPN siRNA,the content of TGF-β in the cell supernatant was decreased,and the expression of OPN mRNA in the cells was significantly decreased,but the expression of TGF-β mRNA was not significantly increased.Conclusion The renal cell co-culture system can mimic the complex renal environment in vivo.When induced by high glucose,cell proliferation is inhibited,glucose consumption is increased,and the content of TGF-β in the cell supernatant is increased,and miR-29b-3p has a regulatory effect on OPN/TGF-β signaling pathway in the co-culture system.
9.Effect of recombinant adenovirus vector mediated human interleukin-24 gene transfection on pancreatic carcinoma growth.
Xin-ting PAN ; Qing-yun ZHU ; De-chun LI ; Ji-cheng YANG ; Zi-xiang ZHANG ; Xing-guo ZHU ; Hua ZHAO
Chinese Medical Journal 2008;121(20):2031-2036
BACKGROUNDPancreatic cancer is a highly malignant tumor affecting an ever increasing number of patients with a mean 5-year survival rate below 4%. Therefore, gene therapy for cancer has become a potential novel therapeutic modality. In this study we sought to determine the inhibitory effects of adenovirus-mediated human interleukin-24 (AdhIL-24) on pancreatic cancer.
METHODSHuman interleukin-24 gene was cloned into replication-defective adenovirus specific for patu8988 tumor cells by virus recombination technology. Reverse transcription-polymerase chain reaction and Western blotting analysis were used to determine the expression of human interleukin-24 mRNA in patu8988 cells in vitro. Induction of apoptosis by overexpression of human interleukin-24 in patu8988 cells was determined by flow cytometry. In vivo efficacy of adenoviral delivery of human interleukin-24 was assessed in nude mice (n = 10 for each group) bearing patu8988 pancreatic cancer cell lines by determining inhibition of tumor growth, endothelial growth factor and CD34 expression, and intratumoral microvessel density (MVD).
RESULTSThe recombinant adenovirus vector AdVGFP/IL-24 was constructed with a packaged recombinant retrovirus titer of 1.0 x 10(10) pfu/ml and successfully expressed of both mRNA and protein in patu8988 cells. The AdVGFP/IL-24 induced apoptosis of patu8988 tumor cells in vitro and significantly inhibited tumor growth in vivo (P < 0.05). The intratumoral MVD decreased significantly in the treated tumors (P < 0.05).
CONCLUSIONThe recombinant adenovirus AdGFP/IL-24 can effectively express biologically active human interleukin-24, which results in inhibition of pancreatic cancer growth.
Adenoviridae ; genetics ; Animals ; Antigens, CD34 ; analysis ; Blotting, Western ; Flow Cytometry ; Genetic Therapy ; Genetic Vectors ; Humans ; Interleukins ; genetics ; Male ; Mice ; Mice, Inbred BALB C ; Pancreatic Neoplasms ; pathology ; therapy ; Transfection ; Vascular Endothelial Growth Factor A ; analysis
10.Reinforcement precision medication in clinical pharmacy education
Xin-Gang LI ; Ke-Fu YU ; Ji-Ping HUO ; Yue-Ting ZHU ; Bin ZHU ; Zhi-Gang ZHAO
The Chinese Journal of Clinical Pharmacology 2017;33(4):369-371
Precision medicine is one of the most important development in the future.In our study,the main contents of precision medication education were presented,and we aimed to provide a reference for clinical pharmacy educators.There are many factors affecting drug efficacy,and the factors could be divided into two categories of genetic and non-genetic factors.Genetic factors include genetic mutations,epigenetic modification,gene expression,miRNA etc.and non-genetic factors can be subdivided into drug-drug interaction,physiological factor,pathological factor,and other factors.Multiple knowledge was related to Precision medicine,such as pharmacogenetics,genetic testing,bioinformatics pharmacogenetics,therapeutic drug monitoring,pharmacometrics and so on.Take warfarin for example,we explained each factor effecting warfarin anticoagulant therapy.The commonly used databases for precise medication were also summarized.Related basic knowledge is the basis of precision medicine.In clinic,specific drug should be analyzed specifically.In order to constantly update knowledge,we should learn to use the common databases.