1.Construction of site-directed mutant variants of ATP7B in vitro and their expression
Zhiying WU ; Ning WANG ; Shenxing MURONG
Chinese Journal of Neurology 2000;0(05):-
Objective To study the expression of normal and variant ATP7B proteins, in order to further find the mechanism of Wilson disease. Methods Normal ATP7BcDNA/pcDNA3 was made and mutant variants Arg778Leu/pcDNA3, Gln914Ter/pcDNA3 and Thr935Met/pcDNA3 were constructed by using Quik-Change TM Site-directed Mutagenesis Kit in vitro. A good quality rabbit polyclonal antibody against the N-terminal functional domains of ATP7B was produced and purified, being named rabbit anti-human ATP7Bn33-629 polyclonal antibody. Normal and variant expression plasmids constructed above were transfected into Chinese hamster ovary (CHO) cells. After a 36-hour incubation at 37℃, the transfected CHO cells were collected. Expression of normal and variant ATP7B protein were detected and compared by Western blot analysis of cell lysates using ATP7Bn33-629 antibody. Results Expression of ATP7B normal protein in transfected CHO cells was the same as that of ATP7B variant proteins Arg778Leu and Thr935Met.Gln914Ter variant shortened ATP7B protein to 100 kd and increased the level of expression. Conclusion The mechanism under disorder of copper transport caused by the missense mutations should be not related to the level of expression. The increased level of expression caused by Gln914Ter might be associated with the shortened ATP7B protein that needs less time for translation.
2.Detection and analysis of mutations in Chinese patients with Wilson disease
Zhiying WU ; Ning WANG ; Minting LIN
Chinese Journal of Neurology 2001;0(03):-
Objective To study and report 7 novel mutations and 5 novel polymorphisms of Wilson disease (WD) geneIn combination with the mutations and polymorphisms previously reported, mutation characteristics of WD gene in Chinese were further analysed. Methods Genomic DNA of 60 normal controls and 84 WD patients from 64 families were extracted from peripheral blood leukocytesThe mutations of WD gene (exon1~21) in these subjects were screened by PCR-single strand conformation polymorphism (SSCP) and further confirmed by sequencing. Results 18 different mutations and 17 polymorphisms have been found, in which 7 mutations and 5 polymorphisms are novel, respectivelyOf them, Arg778Leu and Thr935Met reaching a mutation frequency of 37.7% and 10% of in WD chromosomes may be the hotspots of mutation in Chinese population.Ile1148Thr, previously defined as a possible disease-causing mutation may be a polymorphism which has not yet been detected in normal chromosomes. Conclusion In Chinese, WD seems resulting from a few relatively common and a large number more rare mutations
3.Diagnosis of facioscapulohumeral muscular dystrophy using double enzyme digestion associated Southern blotting method
Chaodong WANG ; Zhiying WU ; Ning WANG
Chinese Journal of Neurology 1999;0(06):-
Objective To develop an operational gene diagnosis method for Chinese Facioscapulohumeral muscular dystrophy (FSHD) patients Methods Genomic DNAwas double digested with restriction enzymes EcoRⅠ/HindⅢ and EcoRI/BlnI,respectively The digested fragments were separated on a 0 6% agarose gel After transferred to a Nytran SuperCharge Membrane, the fragmented DNAs were hybridized with the probe p13E 11 The hybridizing fragments were analyzed by the software ImageMaster Total Lab v1 11 and the size of each band was then given Results Only a 4q35 EcoRI+HindIII/P13E 11 fragment larger than 33 kb was detected in each of the controls Two fragments were detected in each of the 33 FSHD patients, one of which was smaller than 33 kb Although there was also presence of two small alleles in the 3 other FSHD cases, either of them turned out to be 10q26 derived owing to its BlnI sensitivity Interestingly, we found a sporadic patient who carried three 4q35 type fragments and, strikingly, two of them were smaller than 33 kb In the analysis of FSHD family members, a 9 year old boy with no clinical signs was found to share the small fragment with his affected father, indicating that he may be a pre symptomatic patient Conclusion The double digestion associated Southern blotting method we developed can be applied to both the diagnosis of FSHD patients and the prediction of pre symptomatic patients Furthermore, by the gene detection using this method, we first got the evidence of translocation between 4q and 10q in Chinese FSHD patients, which may be helpful to the elucidation of the pathogenesis of FSHD
4.The reliability of cloning-sequencing to detect the number of trinucleotide repeats
Qiaojuan ZHENG ; Shirui GAN ; Ning WANG ; Zhiying WU
Chinese Journal of Neurology 2010;43(9):659-663
Objective Cloning-sequencing is a common method to detect the number of trinucleotide repeats.The aim of the present study is to discuss its reliability.Methods One clinically diagnosed SCA1 patient was recruited in the study.The numbers of CAG repeats in ATXN1 gene were estimated via polymerase chain reaction (PCR) and denaturing polyacrylamide gel electrophoresis (DPAGE).To verify accuracy of CAG numbers estimated, the PCR products were electrophoresed on a 2.5% agarose ge] and separated bands were excised for direct sequencing.Also, the longer separated band underwent cloning-sequencing using a TA cloning kit.Results The patient was identified as SCA1 by DPAGE.After direct sequencing, the numbers of CAG repeats were 26 and 47 in the shorter and longer bands, respectively.However, after cloning-sequencing of the longer band, there are 10 different numbers of CAG repeats, including 50, 47, 46, 41,32, 28, 27, 26, 25 and 24.Furthermore, there are other kinds of trinucleotide repeats, such as CCG, CGG, CTG, CAA and TAT scattered among the CAG repeats.Conclusions It is not reliable to identify the number of trinucleotide repeats by cloning-sequencing alone.To improve the reliability, it is better to combine cloning-sequencing with other methods.
5.The clinical and genetic features of familial paroxysmal kinesigenic dyskinesia:the three families reports
Yu LIN ; Zhiying WU ; Ning WANG ; Shenxing MURONG
Chinese Journal of Neurology 2005;0(11):-
Objective To study the clinical and genetic features of familial paroxysmal kinesigenic dyskinesias (PKD). Methods The clinical information of PKD patients from 3 Han families was analyzed and the pedigrees were further investigated. Results There were 25 PKD cases in 3 families, including 16 males and 9 females. The onset age ranged from 1 to 10 years. The attacks were provoked by voluntary movements and each attack lasted less than 30 seconds with no loss of consciousness. No neurological signs and abnormal examination were detected during the intermittent period. There were 10 to 50 attacks per day, but the frequency commonly decreased with the increase of age. The attacks can be controlled by carbamazepine. The disease was inherited in an autosomal dominant mode. Males were affected more severely than females. Conclusions The main inheritance mode of familial PKD is autosomal dominant. There may be clinic or genetic heterogeneity.
6.Long-term adherence to chemoprevention agents among women at high risk of breast cancer
Ning MA ; Chongzhu HU ; Enqing WANG ; Ruixue YUE ; Huan LI ; Hui ZHANG ; Wenjuan ZHANG ; Zhiying BIAN
Chinese Journal of General Practitioners 2017;16(4):300-303
One hundred and eighty three women with high risk of breast cancer identified in Baoding First Central Hospital from June 2007 to June 2014,were enrolled in the study.In these 183 cases,41 received preventive therapy (22.4%),142 did not.Factors associated with acceptance of chemoprevention included older age,menopause,comorbidities,lower level education,being married,higher BMI,having high level hyperplasia of ductal epthelia and counseling to breast specialists (P < O.05);whilenot informed by doctors was the main reason for failed taking preventive agents(95.1%,135/142).Thirteen of 41 women receiving chemoprevention discontinued the therapy (31.7%);no-insurance,no side-effects and higher BMI were related to the discontinuing (P < 0.05).The 1-,2-,3-,and 5-year adherence rates of chemoprevention was 86.1% (31/36),65.4% (17/26),59.1% (13/22),8/13 and 5/10,respectively.The results show that chemoprevention rate is low among Chinese women at high risk of breast cancer,and the long-term adherence to preventive therapy is poor.Corresponding measures should be taken to strengthen the chemoprevention of breast cancer.
7.Detection of duplication mutation and carriers of Duchenne/Becker muscular dystrophy by multiplex ligation-dependent probe amplification quantitative
Qifang LIN ; Wanjin CHEN ; Ning WANG ; Zhiying WU ; Minting LIN ; Shenxing MURONG
Chinese Journal of Neurology 2011;44(8):568-573
Objective To analyze the dystrophin gene in patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and their family members by multiplex ligation-dependent probe amplification (MLPA) method and to evaluate the application of this method in the mutations detection. Methods The whole dystrophin gene (79 exons) was analyzed by MLPA in 355 patients with DMD/BMD, the mothers of 46 patients with deletion mutation and the mothers of 8 patients with duplication mutation. The results were verified by PCR and sequencing when single exon deletion was found. Results One hundred and ninety cases were found to have deletion of one or more dystrophin exons, and 34 patients were identified to have duplication mutations. In 46 mothers of patients with deletion mutations, 28 were identified the mutations;and of 8 mothers of patients with duplication mutations, 6 were identified the mutations. There was no statistical significance between the carrier incidences in the 2 groups. A 23 bp deletion of AGGGAACAGATCCTGGTAAAGCA fragment in exon 17 was found in a patient. Conclusions Comparing with the traditional quantitative methods, MLPA can detect the deletion and duplication mutation in all the 79 exons of dystrophin gene in DMD/BMD patients, and can identify the carrier status in their family members. Furthermore, MLPA is not apt to be interfered by the concentration and purity of DNA template.
8.Detection mitochondrial DNA A3243G mutation loads by the real-time amplification refractory mutation system quantitative polymerase chain reaction
Xiaozhen LIN ; Wanfin CHEN ; Ning WANG ; Zhiying WU ; Minting LIN ; Shenxing MURONG
Chinese Journal of Neurology 2009;42(3):197-200
Objective To evaluate the quantitative technique of real-time amplification refractory mutation system quantitative PCR( RT ARMS-qPCR)in the detection of the mitochondrial DNA A3243G mutation load.To investigate the mutation load in different tissues in patients with mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS).Methods Wild type and mutant-type (A3243G) of mitochondrial DNA were cloned into plasmid pMD18-T to construct express vectors. Thirteen standard controls having different proportions of mutation loads were developed by mixing wild-type and mutant-type cloned plasmid DNA in different ratios. The mutation loads in the tissues of blood, muscle, hair follicles and urine from seven patients with MELAS and one carrier, and blood samples in 53 unaffected subjects were detected by lit ARMS-qPCR and PCR-RFLP. ResultsIn standard controls, there was a linear correlation between the expected values and results of mutation loads detected by both methods of PCR-RFLP (R21 = 0. 885 ) and RT ARMS-qPCR (R22 = 0. 991 ) . The results detected by RT ARMS-qPCR were closer to the expected values. The detection of mutation loads in tissues from the patients revealed higher values by liT ARMS-qPCR method than by PCR-RFLP and RT ARMS-qPCR was more sensitive in detecting the lower A3243G mutation load. The mutation load in muscle, hair follicles or urinary sedimem is higher than that in leukoeytas.Conclusion The RT ARMS-qPCR provides a convenient,rapid, sensitive and reliable quantitative detection of heteroplasmic mutant mtDNA A3243G in different tissues.
9.Mutation analysis of senataxin gene in sporadic amyotrophic lateral sclerosis
Huiling XIONG ; Wenzu CHEN ; Zhiying WU ; Zhenhua ZHAO ; Ning WANG ; Minting LIN ; Shenxing MURONG
Chinese Journal of Neurology 2010;43(2):90-92
Objective To investigate the spectrum of senataxin gene mutations in Chinese patients with sporadic amyotrophic lateral sclerosis (SALS). Methods Sixty sporadic SALS patients and 200 unrelated normal individuals were screened for mutations of senataxin by PCR-sequencing methodology. Results Two silent mutations, Asp844Asp and Phe998Phe, were identified in two SALS patients, respectively. They were not found in controls. However, a homology search of senataxin gene in different species revealed that these two amino acids were not evolutionarily conserved, indicating that the mutations were not pathogenic. Additional 19 polymorphisms were detected. Conclusion The identification of two silent mutations and 19 polymorphisms has further broadened the spectrum of mutations and polymorhpisms in senataxin.
10.Mutation and polymorphism analysis of SPG4 and SPG3A in Chinese patients with hereditary spastic paraplegia
Kun ZHAO ; Zhiying WU ; Ning WANG ; Guixian ZHAO ; Minting LIN ; Shenxing MURONG
Chinese Journal of Neurology 2009;42(4):253-257
Objective To screen the mutation and analysis its characteristics of SPG4 and SPG3A in Chinese patients with hereditary spastic paraplegia (HSP).Methods Mutation and polymorphism of the SPG4 and SPG3A were screened in the index eases of 26 autesomal dominant families (AD-HSP) and 30 sporadic cases by combination of DHPLC and sequencing analysis, then the index cases of 26 AD-HSP were further confirmed with direct sequencing.Results One novel mutation of SPG4, 1616 + 1g→t, was identified in the index ease from an AD-HSP family.Three symptomatic patients and 2 pre-symptomatic patients were found in this family by sequencing analysis.No mutation of SPG3A was detected.In addition, 8 novel SPG4 polymorphisms and 3 novel SPG3A polymorphisms were identified.Conclusions The study has broadened the mutation and polymorphism spectrums of SPG4 and SPG3A.Mutation of these two genes is less common in this group of patients.