1.Clinical phenotype and analysis of CHD7 gene variants in three children patients with CHARGE syndrome.
Chinese Journal of Medical Genetics 2021;38(1):42-46
OBJECTIVE:
To explore the genetic basis for three children patients with CHARGE syndrome.
METHODS:
The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.
RESULTS:
All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo.
CONCLUSION
Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.
CHARGE Syndrome/genetics*
;
Child
;
DNA Helicases/genetics*
;
DNA-Binding Proteins/genetics*
;
Genetic Variation
;
Humans
;
Mutation
;
Phenotype
2.Genetic and phenotypic analysis of a patient with phosphogylcerate dehydrogenase deficiency.
Chinese Journal of Medical Genetics 2021;38(2):170-173
OBJECTIVE:
To explore the genetic basis for a child with ocular anomaly, microcephaly, growth retardation and intrauterine growth restriction.
METHODS:
The patient underwent ophthalmologic examinations including anterior segment photography, fundus color photography, and fundus fluorescein angiography. The patient and her parents were subjected to whole exome sequencing. Candidate variants were verified by Sanger sequencing and bioinformatic analysis.
RESULTS:
The patient was found to have bilateral persistent pupillary membrane and coloboma of inferior iris, in addition with macular dysplasia and radial pigmentation near the hemal arch of the temporal retina. She was found to have carried compound heterozygous missense variants of the PHGDH gene, namely c.196G>A and c.1177G>A, which were respectively inherited from her father and mother. Bioinformatic analysis suggested both variants to be pathogenic.
CONCLUSION
The patient was diagnosed with phosphoglycerate dehydrogenase deficiency. Above finding has enriched the phenotypic spectrum of the disease with ocular manifestations.
Carbohydrate Metabolism, Inborn Errors/genetics*
;
Child
;
Coloboma
;
Female
;
Humans
;
Microcephaly/genetics*
;
Mutation
;
Phenotype
;
Phosphoglycerate Dehydrogenase/genetics*
;
Psychomotor Disorders/genetics*
;
Seizures/genetics*
;
Whole Exome Sequencing
3.Analysis of epidemic characteristics of common allergens in 11 641 patients from 2013 to 2017
Ping LIU ; Qihui TAO ; Zhiyan LI ; Zhenru FENG ; Cunling YAN
Chinese Journal of Laboratory Medicine 2019;42(5):371-374
Objectives In order to provide valuable information for the diagnosis and treatment of allergic diseases,the prevalence and trend changes of common allergens in Beijing were investigated and analyzed.Methods This study was a retrospective data collection study.A total of 11 641 patients with allergen examinations were collected from Peking University First Hospital from 2013 to 2017.The positive rate of each allergen was counted according to age,season and year.The epidemiological characteristics and trends were analyzed.Results In the past five years,20 636 total IgE and 45 620 allergen-specific IgE were collected,and the total positive rate of total IgE was 47.8% (9 874/20 636).The top three positive rates of inhaled allergens were Dermatophagoides farina (28.1%,509/1 812),Dermatophagoides pteronyssinus (26.8%,503/1 876) and Mugwort (24.7%,240/971).The top three positive rates of food allergen were egg (17.3%,188/10 88),milk (16.7%,186/1 114) and wheat (15.3%,127/829).The positive rate of inhaled allergens (phad as an example) increased year by year.The positive rate of food allergens (fx5 as an example) reached its peak in 2015 (16.3%,511/3 139) and decreased slightly in the last two years (2016:13.0%,571/ 4 396;2017:7.4%,330/4 461).In inhaled allergens,the positive rate of weed pollen increased significantly in autumn.The positive rates of mx2 and dust mites were higher in summer.Food allergen did not change significantly with the seasons.Conclusions This study shown the distribution of allergens in patients with allergic diseases to a certain extent.It provided epidemiological data and clinical evidence for the prevention and treatment of allergic diseases.
4.Computed tomographic manifestations of pulmonary aspergillosis after organ transplantation and differential diagnosis with bacterial infection
Xihong GE ; Hang LI ; Yan SUN ; Mingyue WANG ; Guangfeng GAO ; Miaomiao LONG ; Xiaobin LIU ; Jing YU ; Xiaoming GONG ; Jing TAO ; Zhiyan LU ; Wen SHEN
Chinese Journal of Organ Transplantation 2019;40(4):200-204
Objective To summarize the computed tomographic (CT) manifestations of pulmonary aspergillosis after organ transplantation and compare different signs between pulmonary aspergillosis and bacterial pneumonia.Methods CT images of pulmonary aspergillosis (n =62) and bacterial pneumonia (n =68) in post-transplantation patients were reviewed.The signs were categorized with consolidation,mass,large nodule (≥1crn),small nodule and bud-in-tree pattern.Some detailed useful differentiating signs such as halo sign,air bronchogram sign,reversed halo sign,hypodensity sign and cavitation were also analyzed.Results CT patterns of pulmonary aspergillosis included consolidation,mass,large nodule,small nodule and bud-in-tree pattern.The most common was large nodule (75.8%),followed by consolidation (48.4%)and mass (29.0%).And small nodule (16.1 %) and bud-in-tree (12.9%) patterns were concurrent.For consolidation pattern,the proportion of bacterial pneumonia (69.1%) was the larger;For mass pattern,the proportion of pulmonary aspergillosis (29.0%) was the larger.For large nodule pattern,there was no difference.The detail sign of large nodule in two groups had no difference In detailed signs of consolidation pattern,air bronchogram sign was more often seen in bacterial pneumonia while cavitation was more frequently found in pulmonary aspergillosis.In detailed signs of mass pattern,pulmonary aspergillosis often has single lesion (66.7%),cavitation (83.3%)and air crescent sign (77.8%) is more common.The proportion of halo sign was 30.7%.Conclusions CT manifestations of pulmonary aspergillosis are diverse after organ transplantation.There is some difference and yet overlap with bacterial pneumonia.
5.Diagnosis and treatment in holoprosencephaly
Chinese Journal of Plastic Surgery 2024;40(3):325-330
Holoprosencephaly (HPE) is a prevalent malformation of the human forebrain, with an increasing annual prevalence in China. Its etiology remains unclear, and its diagnosis and treatment are challenging due to the heterogeneity of clinical manifestations. This article summarizes and expounds the etiology, clinical manifestations, imaging and genetic diagnosis, as well as medical and surgical treatment of HPE. The aim is to enhance medical personnels’ understanding of this disease, and to facilitate early diagnosis and treatment of patients with HPE.
6.Diagnosis and treatment in holoprosencephaly
Chinese Journal of Plastic Surgery 2024;40(3):325-330
Holoprosencephaly (HPE) is a prevalent malformation of the human forebrain, with an increasing annual prevalence in China. Its etiology remains unclear, and its diagnosis and treatment are challenging due to the heterogeneity of clinical manifestations. This article summarizes and expounds the etiology, clinical manifestations, imaging and genetic diagnosis, as well as medical and surgical treatment of HPE. The aim is to enhance medical personnels’ understanding of this disease, and to facilitate early diagnosis and treatment of patients with HPE.
7.Temporal and spatial stability of the EM/PM molecular subtypes in adult diffuse glioma.
Jing FENG ; Zheng ZHAO ; Yanfei WEI ; Zhaoshi BAO ; Wei ZHANG ; Fan WU ; Guanzhang LI ; Zhiyan SUN ; Yanli TAN ; Jiuyi LI ; Yunqiu ZHANG ; Zejun DUAN ; Xueling QI ; Kai YU ; Zhengmin CONG ; Junjie YANG ; Yaxin WANG ; Yingyu SUN ; Fuchou TANG ; Xiaodong SU ; Chuan FANG ; Tao JIANG ; Xiaolong FAN
Frontiers of Medicine 2023;17(2):240-262
Detailed characterizations of genomic alterations have not identified subtype-specific vulnerabilities in adult gliomas. Mapping gliomas into developmental programs may uncover new vulnerabilities that are not strictly related to genomic alterations. After identifying conserved gene modules co-expressed with EGFR or PDGFRA (EM or PM), we recently proposed an EM/PM classification scheme for adult gliomas in a histological subtype- and grade-independent manner. By using cohorts of bulk samples, paired primary and recurrent samples, multi-region samples from the same glioma, single-cell RNA-seq samples, and clinical samples, we here demonstrate the temporal and spatial stability of the EM and PM subtypes. The EM and PM subtypes, which progress in a subtype-specific mode, are robustly maintained in paired longitudinal samples. Elevated activities of cell proliferation, genomic instability and microenvironment, rather than subtype switching, mark recurrent gliomas. Within individual gliomas, the EM/PM subtype was preserved across regions and single cells. Malignant cells in the EM and PM gliomas were correlated to neural stem cell and oligodendrocyte progenitor cell compartment, respectively. Thus, while genetic makeup may change during progression and/or within different tumor areas, adult gliomas evolve within a neurodevelopmental framework of the EM and PM molecular subtypes. The dysregulated developmental pathways embedded in these molecular subtypes may contain subtype-specific vulnerabilities.
Humans
;
Brain Neoplasms/pathology*
;
Neoplasm Recurrence, Local/metabolism*
;
Glioma/pathology*
;
Neural Stem Cells/pathology*
;
Oligodendrocyte Precursor Cells/pathology*
;
Tumor Microenvironment