1.Therapeutic effect of lacrimal balloon surgery on lacrimal duct obstruction in infants
International Eye Science 2017;17(9):1796-1798
AIM:To evaluate the clinical efficacy and safety of balloon dilatation in infants with lacrimal passage obstruction.METHODS:Totally 86 patients (116 eyes) with lacrimal duct obstruction from July 1, 2015 to June 30, 2016 were randomly divided into two groups according to the digital table.The observation group (43 cases, 60 eyes) were operated with balloon dilatation and the control group (43 cases, 56 eyes) were treated with duct exploratory operation.The patients were followed up for 6mo to compare the efficacy.RESULTS:At the 6mo postoperatively, the primary cure rate and total cure rate in the observation group were significantly higher than those in the control group.There was significant difference between the two groups (P<0.05).CONCLUSION:Balloon dilatation operation is safe, and its clinical efficacy is better than lacrimal duct exploratory operation, is an effective way to treat lacrimal duct obstruction in infants.
2.Application on the thickness of nerve fiber layer of the optic disc in pathologic myopia eyes by OCT
Zhi-Cheng, SHI ; Xiao-Liu, LUO ; Yu-Ai, LIU
International Eye Science 2014;(6):1100-1102
AIM: To analyze the application on frequency domain optical coherence tomography ( OCT ) technology of pathologic myopia optic disc neurosensory retinal thickness changes and its relationship with axis oculi, sex and age, and help for the early diagnosis of pathological myopia and primary open angle glaucoma.
METHODS:Collected 96 eyes of normal eyes ( axis oculi 23-24mm) and 153 eyes of pathologic myopia eyes ( axis oculi 25-27mm 80 eyes, >27mm 73 eyes). We measured the thickness of nerve fiber layer of the optic disc by OCT and analyzed their relationship with axis oculi, sex and age with multiple linear regression analysis.
RESULTS: The observation group showed significant smaller average thickness of peripapillary, superior, inferior, nasal than the control group ( P<0. 05 ); the difference in the temporal quadrant between the groups were no statistically significant differences (P>0. 05); The partial correlation coefficient of peripapillary average thickness of nerve fiber layer and axis oculi was -1. 31, gender was 5. 21, age was -0. 12.
CONCLUSION:The thickness of nerve fiber layer of the optic disc in the pathologic myopia eyes are decreased than normal eyes, axis oculi, sex and age are influenced factors. The pathologic myopia patients should use different index combined with optic nerve fiber layer thickness decreased to help for the diagnosis of early primary open angle glaucoma.
3.Developmental Characters of Neural Stem Cells in Occipital of Cortex from Human Fetal Brain at Different Ages
bo, HU ; ai-hua, LI ; yu-lin, AN ; zhi-chun, FENG
Journal of Applied Clinical Pediatrics 2006;0(14):-
Objective To investigate the developmental characters of neural stem cells(NSCs) in occipital of cortex from human fetal brain at different age.Methods Ninety cases of embryoes at gestational age 16-32 weeks and by induction of labor with water bag were collected for determining distribution,shapes,growth modes and the number of NSCs in the occipital of cortex with immunohisto- chemical method under light microscope.Results It was noted that NSCs existed in the occipital of cortex from human fetal brain at different ages.NSCs mainly distributed in layers of cone cells and inner granule cells.NSCs existed in the occipital of cortex of different fetal age included middling round cells,NSCs had enations from 0 to 1.Nucli were larger than plasm.Each NSC had nucleoli from 2-4 and rarefaction chromatin.Most of NSCs distributed in three growth modes including crowd,cluster and clone,occasionally with a single growth mode among other nerve cells.There were no differences including distribution,shapes,growth modes and the number of NSCs in the occipital of cortex between groups,but,NSCs gradually decreased with increasing of age.Conclusion NSCs exists in the occipital of cortex from different gestational age,and the number of NSCs decreases with increasing of age.
4.The 16S rDNA Sequence Analysis and Phenotypical Study of Strain F12-11-1-2
Xiao-Yu LIU ; Qiang-Zhi XU ; Yu YANG ; Feng AI ; Bing-Hua JIAO ;
Microbiology 1992;0(01):-
The strain F12-11-1-2 was isolated from the East China Sea,which had antimitosis activity using Pyricularia oryzae mode.Ac- cording to phenotypical study,salt-aggregation test and 16S rDNA sequence analysis,the strain F12-11-1-2 has been identified to be Bacillus subtilis.
5.Serological monitoring reports of a population at high risk of brucellosis in Qian'an County of Hebei Province in 2011
Ai-min, ZHAO ; Cui-ling, WANG ; Chang-ning, GENG ; Xin, WANG ; Juan, YU ; Zhi-yong, WANG
Chinese Journal of Endemiology 2013;32(4):439-441
Objective To study the current situation of human brucellosis infection in a population at high risk in Qian'an,and to provide a scientific basis for prevention and control of the disease.Methods Towns with centralized residents working in sheep breeding,transporting,slaughtering and processing in Jianchangying,Muchangkou and Xiaguanying of Qian'an were selected.In each selected town,2-3 villages with relatively centralized households working in sheep farming,transportation and slaughtering were chosen.All of the people who contacted the sheep or their excrement were chosen as monitoring objects,and serological antibody was tested with rose Bengal plate test(RBPT) and serum agglutination test(SAT).Regional,gender,age and occupational distribution of brucellosis were analyzed.Results A total of 367 blood samples were tested,46 of them were positive in both RBPT and SAT with a ratio of 12.53% (46/367).Male positive rate [13.51% (30/222)] was slightly higher than that of females [11.03%(16/145)].The rate in Jianchangying was higher than that of other two towns with a ratio of 13.38%(40/299).The veterinary population had the highest ratio of 33.33%(1/3).Conclusions It is necessary to carry out the surveillance on brucellosis and to further strengthen communication with the animal husbandry department,and strengthen protection on key population.At the same time,in order to control the spread of the disease,extensive health education and intervention measures should be carried out.
6.Relationship between reduced expression of surfactant protein B and neonatal respiratory distress syndrome in twenty Han ethnic group neonates in China
Xiao-Juan YIN ; Fen-Ping LUO ; Ai-Hua LI ; Yu-Lin AN ; Zhi-Chun FENG
Chinese Journal of Pediatrics 2008;46(z1):35-39
Objective To investigate the relationship between expression of surfactant protein B (SP-B) gene product and neonatal respiratory distress syndrome (NRDS) in Han ethnic group.Methods Unrelated 20 cases with NRDS of Han ethnic group were selected as NRDS group while unrelated 20 cases of Han ethnic group with other diseases were selected as a control. The cases in the control group had congenital heart disease or bronchopulmonary dysplasia or persistent pulmonary artery hypertension. Blood sample was taken from each case. Lung tissues were taken from the patients in half an hour after their death in the two groups. Expression of SP-B in the lung tissues was determined with immunohistochemical technique. Genetic deficiency variant of SP-B intron Ⅳ was screened with polymerase chain reaction (PCR).Results Two cases at gestational age of 26 weeks, one at 34 weeks and two at 42 weeks in the NRDS groups had lower expression level of SP-B in the lung tissues than those at the same age in the the control group. Expression of SP-B in the lung tissues of the control group increased with gestational age, but no such phenomenon was found in NRDS group. Further two cases at gestational age 42 weeks of NRDS group had genetic deficiency variant of SP-B intron Ⅳ with gene analysis of five cases who had lower expression of SP-B. Clinical data suggest that patients at 42 weeks of gestational age had severe illness.Conclusion Decrease of SP-B expression may be involved in occurrence of NRDS, genetic deficiency variant of SP-B intron Ⅳ exists in NRDS cases of Han ethnic group of China.
7.Effect of GBE50 on delayed rectifier potassium current of ventricular myocytes in ischemic guinea pig.
Ai-Hua LIU ; Zhi-Xiong ZHANG ; Xing-Yu WANG
Chinese Journal of Applied Physiology 2010;26(4):444-448
OBJECTIVEGinkgo biloba extract 50 (GBE50) is a new multicomponent drug with a polyvalent action extracted from the leave of Ginkgo biloba. The aim of this experiment was to study the effects of GBE50 on delayed rectifier potassium current (I(K)) in ventricular myocytes under normal and simulated ischemia conditions in guinea pigs.
METHODSSingle ventricular myocytes were isolated by an enzymatic dissociation method. I(K) were recorded by whole-cell patch clamp technique in voltage clamp mode. GBE50 was added to the perfusion chamber from low to high concentrations (25, 50,100 mg/L) in normal condition. Different concentrations of GBE50 (25, 50, 100 mg/L) were prepared with simulated ischemic fluid.
RESULTS(1) Under normal condition, 100 mg/L GBE50 decreased I(K) (n = 7, P < 0.05). (2) Under ischemia condition, it was observed that I(K) was inhibited (n = 8, P < 0.05). (3) Perfusion with ischemia solution containing 50 mg/L (n = 8, P > 0.05) and 100 mg/L GBE50 (n = 6, P > 0.05) could reverse the decrease of I(K).
CONCLUSIONGBE50 significantly decreased I(K) in a concentration-dependent manner. GBE50 could alleviate the electrophysiological heterogeneity of myocardium to prevent ischemic myocardium from arrhythmia.
Animals ; Cells, Cultured ; Delayed Rectifier Potassium Channels ; drug effects ; Ginkgo biloba ; Guinea Pigs ; Myocardial Ischemia ; metabolism ; physiopathology ; Myocytes, Cardiac ; drug effects ; physiology ; Patch-Clamp Techniques ; Plant Extracts ; pharmacology
8.Investigation on nurses' cognitive of patient safety culture in hospital
Yu-E LIU ; Ping ZHANG ; Ai-Hui DENG ; Ling-Ling HE ; Zhi-Min WANG ; Li DAI
Chinese Journal of Modern Nursing 2011;17(11):1308-1311
Objective To explore the level of patient safety culture of nurses, so as to provide more objective information for the developmental measures to improve patient safety culture. Methods 1 866 nurses from six grade-3 hospitals of a province were investigated by patient safety culture assessment scale. Results The total scores of patient safety culture of nurses was 3.57 ± 0.42, belongs to the middle-level. 5 factors in descending order according to the questionnaire scores was teamwork climate, safety climate, job Satisfaction,perception of management and stress recognition. The lower scores were the punishment of adverse events, job stress, work intensity, the staffing and so on. Conclusions It is very important that nurse managers should focus on improving a safer system in nursing, find out the potential risks, create a positive patient safety culture,and reduce or prevent adverse events of nursing in order to promote patient safety.
9.Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis
Zhu JI-TING ; Lin HAN ; Wu XUAN ; Li ZHI-WEN ; Lin AI-YU
Chinese Medical Journal 2019;132(23):2827-2834
Background: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATITA-GAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOV A)in R software.Results: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each <1.41%).ITS genotype was 4efined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P = 0.0014)between infectious group and control group was observed.Conclusions: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.
10.Expression of endo-beta-mannanase gene from Trichoderma reesei in Pichia pastoris.
Yue-Hua WEI ; Ai-Jun MAO ; Yong-Zhi HE ; Yu QIAO ; Zhi-Yang DONG
Chinese Journal of Biotechnology 2005;21(6):878-883
Complete mannanase gene with two introns was cloned from Trichoderrna reesei by PCR. The two introns were then removed by overlap extension PCR. The gene encoding the mature mannanase protein was inserted into the expression vector pPIC9K, downstream of a alpha-factor signal peptide sequence. The resultant recombinant vector was named pM242. After linearized with Sac I , pM242 was transformed to Pichia pastoris GS115 by electroporation. After screening, the recombinant strain Gpmf25 that expresses the secretory protein at high level was obtained. The activity of the recombinant mannanase reached 12.5 IU/mL. Optimum pH and temperature for the recombinant enzyme were 5.0 and 80 degrees C, respectively. The enzyme was stable at pH 5.0-6.0 and maintained over 50% of original activity after incubation at 70 degrees C for 30 min.
Fungal Proteins
;
biosynthesis
;
genetics
;
Hydrogen-Ion Concentration
;
Pichia
;
genetics
;
metabolism
;
Recombinant Proteins
;
biosynthesis
;
genetics
;
Temperature
;
Trichoderma
;
enzymology
;
genetics
;
beta-Mannosidase
;
biosynthesis
;
genetics