OBJECTIVE: To analyze the demographic and clinical characteristics of inpatients with osteoporotic vertebral compression fractures (OVCF) and provide a basis for clinical prevention and treatment. METHODS: A retrospective analysis was performed on the clinical data of 744 inpatients diagnosed with OVCF between January 2017 and December 2021 who met the inclusion criteria. Among them, 146 were male and 598 were female, with age ranging from 50 to 95 years (mean, 69.37 years). The demographic characteristics (gender, age, ethnicity, occupation, regional distribution, urban-rural distribution, and seasonal incidence) and clinical features [causes of injury, history of vertebral fractures, smoking and drinking history in males, comorbidities (hypertension, diabetes, coronary atherosclerotic heart disease, cerebral infarction), body mass index (BMI), blood lipid levels, menopausal age in females, vertebral bone mineral density T-value, number of vertebral fractures, and fracture segment distribution] of OVCF patients were analyzed. Multiple linear regression was used to analyze the independent risk factors of vertebral osteoporosis. RESULTS: The demographic analysis indicated that female patients with OVCF were significantly younger than male patients ( P<0.05). Significant differences were observed in the age distribution of OVCF between males and females ( P<0.05), with the highest proportion of male patients in the 70-79 years group (37.0%) and the highest proportion of female patients in the 60-69 years group (40.0%). From 2017 to 2021, the age of onset for OVCF gradually increased, with a similar trend observed for both genders. The distribution of occupations between genders also showed significant differences ( P<0.05); with the top three occupations for males being farmers (48.6%), retirees (24.7%), and workers (13.7%), while for females, the leading occupations were farmers (51.5%), retirees (19.4%), and service workers (10.0%). Female OVCF patients had higher BMI, vertebral bone mineral density T-value, history of vertebral fractures, hypertension prevalence, and blood lipid levels compared to male patients ( P<0.05). No significant difference between the males and the females was found in ethnicity, seasonal distribution, regional distribution, urban-rural distribution, causes of injury, number of vertebral fractures, or prevalence of comorbidities (except hypertension) ( P>0.05). Among the 744 OVCF patients, a total of 1 309 vertebrae were involved, with 628 thoracic vertebrae (48.0%) and 681 lumbar vertebrae (52.0%). The most common fracture segments were L ₁ (22.5%), T ₁₂ (21.2%), followed by L ₂ (12.2%) and T ₁₁ (10.2%). No significant gender difference was observed in the distribution of fracture segments ( P>0.05). Multiple linear regression analysis indicated that older age, female, and lower BMI were independent risk factors for vertebral osteoporosis ( P<0.05). CONCLUSION The age of onset of OVCF patients is increasing year by year. The number of fractured vertebral bodies, age distribution of morbidity, occupational distribution, BMI, history of vertebral fracture, hypertension, and blood lipid levels are related to gender. The occurrence of OVCF is mainly in the thoracolumbar segment. The female, older age, and lower BMI are independent risk factors of osteoporosis.
Humans ; Male ; Female ; Aged ; Middle Aged ; Retrospective Studies ; Spinal Fractures/etiology* ; Aged, 80 and over ; Osteoporotic Fractures/etiology* ; Fractures, Compression/etiology* ; Risk Factors ; Bone Density ; China/epidemiology* ; Osteoporosis/epidemiology* ; Comorbidity ; Inpatients ; Sex Factors ; Age Factors

Transarterial radioembolization (TARE) is a widely utilized therapeutic approach for hepatocellular carcinoma (HCC), however, the clinical implementation is constrained by the stringent preparation conditions of radioembolization agents. Herein, we incorporated the superstable homogeneous iodinated formulation technology (SHIFT), simultaneously utilizing an enhanced solvent form in a carbon dioxide supercritical fluid environment, to encapsulate radionuclides (such as ¹³¹I,¹⁷⁷Lu, or ¹⁸F) with lipiodol for the preparation of radiolipiodol. The resulting radiolipiodol exhibited exceptional stability and ultra-high labeling efficiency (≥99%) and displayed notable intratumoral radionuclide retention and in vivo stability more than 2 weeks following locoregional injection in subcutaneous tumors in mice and orthotopic liver tumors in rats and rabbits. Given these encouraging findings, ¹⁸F was authorized as a radiotracer in radiolipiodol for clinical trials in HCC patients, and showed a favorable tumor accumulation, with a tumor-to-liver uptake ratio of ≥50 and minimal radionuclide leakage, confirming the feasibility of SHIFT for TARE applications. In the context of transforming from preclinical to clinical screening, the preparation of radiolipiodol by SHIFT represents an innovative physical strategy for radionuclide encapsulation. Hence, this work offers a reliable and efficient approach for TARE in HCC, showing considerable promise for clinical application (ChiCTR2400087731).

Objective To investigate the role of RNA-binding motif protein X-linked(RBMX)in regulating the proliferation,migration,invasion and glycolysis in human bladder cancer cells.Methods A lentivirus vectors system and RNA interference technique were used to construct bladder cancer 1376 and UC-3 cell models with RBMX overexpression and knockdown,respectively,and successful cell modeling was verified using RT-qPCR and Western blotting.Proliferation and colony forming ability of the cells were evaluated using EdU assay and colony-forming assay,and cell migration and invasion abilities were determined using Transwell experiment.The expressions of glycolysis-related proteins M1 pyruvate kinase(PKM1)and M2 pyruvate kinase(PKM2)were detected using Western blotting.The effects of RBMX overexpression and knockdown on glycolysis in the bladder cancer cells were assessed using glucose and lactic acid detection kits.Results RT-qPCR and Western blotting confirmed successful construction of 1376 and UC-3 cell models with RBMX overexpression and knockdown.RBMX overexpression significantly inhibited the proliferation,clone formation,migration and invasion of bladder cancer cells,while RBMX knockdown produced the opposite effects.Western blotting results showed that RBMX overexpression increased the expression of PKM1 and decreased the expression of PKM2,while RBMX knockdown produced the opposite effects.Glucose consumption and lactate production levels were significantly lowered in the cells with RBMX overexpression(P<0.05)but increased significantly following RBMX knockdown(P<0.05).Conclusion RBMX overexpression inhibits bladder cancer progression and lowers glycolysis level in bladder cancer cells by downregulating PKM2 expression,suggesting the potential of RBMX as a molecular target for diagnosis and treatment of bladder cancer.

BACKGROUND:Osteoporosis vertebral compression fracture is a common fracture secondary to osteoporosis,and there is currently a lack of effective predictive indicators and methods for osteoporosis vertebral compression fracture. OBJECTIVE:To investigate the predictive effects of paravertebral muscle degeneration,functional cross-sectional area,and percentage of fat infiltration on osteoporotic vertebral compression fractures. METHODS:The 224 patients with osteoporosis diagnosed from January 2018 to June 2022 were included.They were followed up for more than 2 years.They were divided into fracture group and non-fracture group according to the presence and absence of vertebral fracture.The detailed information of demographics,body mass index,bone mineral density and so on were collected.The functional cross-sectional area and percentage of fat infiltration of bilateral Psoas major muscle and extensor dorsi(Erector spinae muscles muscle and multifidus muscle)at the level of lower endplate of L2 vertebral body were measured and calculated. RESULTS AND CONCLUSION:(1)224 patients were ultimately included,of which 126 had fractures as the fracture group and 98 had no fractures as the non-fracture group.There was no statistically significant difference in age,gender,height,body mass,body mass index,and fracture segment between the two groups(P>0.05).(2)The bone mineral density of the fracture group was significantly lower than that of the non-fracture group(P<0.05).Functional cross-sectional areas of Psoas major muscle and extensor dorsi in the fracture group were significantly lower than those in the non-fracture group(P<0.05).The percentage of fat infiltration of the extensor dorsi in the fracture group was significantly higher than that in the non-fracture group(P<0.05).There was no significant difference in percentage of fat infiltration of Psoas major muscle between the two groups(P>0.05).(3)Receiver operating characteristic analysis showed that the vertebral bone mineral density,percentage of fat infiltration of extensor dorsi,functional cross-sectional area of extensor dorsi and percentage of fat infiltration of Psoas major muscle were 0.903 g/cm2,35.426%,418.875 mm2,and 6.375%,respectively.The areas under curve were 0.634,0.755,0.876,and 0.585,respectively.(4)These findings indicate that paravertebral muscle degeneration is strongly associated with the occurrence of osteoporotic vertebral compression fractures.The functional cross-sectional area of extensor dorsi muscle can effectively predict the occurrence of osteoporotic vertebral compression fractures,which is helpful for early prevention and treatment of osteoporotic vertebral compression fractures.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

Objective To develop an ultra-performance liquid chromatography-mass spectrometry(UPLC-MS/MS)method for the simultaneous quantification of dolutegravir,raltegravir,efavirenz,lamivudine and tenofovir in human plasma and to apply it to the therapeutic monitoring.Methods Dolutegravir-D5,raltegravir-D4,efavirenz-D5,lamivudine-13 C-15 N2 and tenofovir-D7 were used as internal standard,respectively.All samples were extracted using the protein precipitation method with acetonitrile and then diluted for analysis.Chromatographic separation was performed on Shim-pack XR-ODS Ⅲ(2.0 mmx50 mm,1.6 μm)column.Mobile phases A and B consisted of 0.1％formic acid in water and acetonitrile respectively.A programmed mobile phase gradient was used at a flow rate of 0.3 mL·min-1 and column temperature of 40 ℃.The tandem mass spectrometer was equipped with an electrospray ionization(ESI)source operating in multiple reaction monitoring(MRM)modes.After methodological validation,it can be used for therapeutic drug monitoring in HIV patients.Results There was good linearity in the validated concentration ranges of 62.5-3 000 ng·mL-1 for dolutegravir,10-500 ng·mL-1 for raltegravir,125-6 000 ng·mL-1for efavirenz,10-500 ng·mL-1 for lamivudine and 10-500 ng·mL-1 for tenofovir with the linear correlation coeffificients of determination(R2)of all higher than 0.998.The accuracy of both intra-day and inter-day studies ranged from 94.0％-109.3％,and the relative standard deviations were less than 7％.The IS-normalized matrix factor and extraction recoveries of all analytes were 95.7％-106.0％and 98.7％-104.5％at all concentrations.All analytes were stable in plasma at a certain storage environment.The trough blood concentrations of dolutegravir,efavirenz,lamivudine and tenofovir were 107.7-2 366.0,740.0-3 410.0,38.5-1 229.3,31.6-224.4ng·mL-1 in HIV patients,respectively.Conclusion The method is highly aceurate,easy to perform,low-cost,and suitable for therapeutic drug monitoring of dolutegravir,raltegravir,efavirenz,lamivudine and tenofovir in HIV patients.

Clinical data of one patient diagnosed with kaposiform hemangioendothelioma (KHE) in the spinal canal and mediastinum at the Children′s Hospital, Zhejiang University School of Medicine in October 2022 were retrospectively analyzed.Additionally, a literature review on mediastinal KHE was performed to summarize prior clinical characteristics and treatments.The patient, a 25-day-old boy, presented with refractory thrombocytopenia.Multiple chest radiographs suggested significant widening of the mediastinum and atypical atelectasis in the left upper lung, and enhanced chest CT and magnetic resonance imaging suggested KHE.After cocktail therapy with Prednisolone, Vincristine and Sirolimus, platelets increased to normal, and coagulation function improved.After 3 months of follow-up, hematologic parameters were stable, the mass became smaller, and no side effects occurred.

BACKGROUND:Osteoporotic vertebral compression fracture is a common fracture secondary to osteoporosis.At present,there is no effective prediction index and method for osteoporotic vertebral compression fracture. OBJECTIVE:To investigate the predictive effect of the comprehensive index of lumbar vertebral body bone strength on osteoporotic vertebral compression fracture. METHODS:233 patients with osteoporosis were divided into a fracture group and a non-fracture group according to whether a vertebral fracture occurred.The demography,body mass index,vertebral bone mineral density and other details were collected.Lateral X-ray films of the lumbar spine were photographed.The vertebral body width,vertebral body length,sacral slope,pelvic tilt,pelvic incidence,lumbar compressive strength index and the lumbar impact strength index were measured,calculated,and analyzed by univariate and multivariate,and the receiver operating characteristic curve was analyzed.The survival analysis was conducted according to the cut-off value. RESULTS AND CONCLUSION:(1)All patients were followed up for 2-4 years,with an average of 3.1 years.During the follow-up period,99 cases(38 cases of L1 vertebral body,61 cases of L2 vertebral body)had fractures(fracture group),and 134 cases(52 cases of L1 vertebral body,82 cases of L2 vertebral body)had no fractures(non-fracture group).Univariate analysis showed that there was no significant difference in age,sex,height,body mass,body mass index and fracture segment between the two groups(P>0.05).(2)Lumbar compressive strength index and lumbar impact strength index in the fracture group were lower than those in the non-fracture group(P<0.05).Pelvic incidence and pelvic tilt in the fracture group were higher than those in the non-fracture group(P<0.05).(3)Multivariate analysis showed that lumbar compressive strength index,lumbar impact strength index and pelvic tilt were risk factors for osteoporotic vertebral compression fractures(P<0.05).(4)Receiver operating characteristic curve analysis showed that the cutoff values of vertebral bone mineral density,lumbar compressive strength index,lumbar impact strength index,pelvic tilt and pelvic incidence were 0.913 5 g/cm2,1.932,0.903,21.5° and 55°,respectively;areas under the curve were 0.630,0.800,0.911,0.633 and 0.568,respectively.(5)According to the survival analysis(with osteoporotic vertebral compression fracture as the end point),the average survival time of the patients with lumbar impact strength index≥0.903 was significantly longer than that of the patients with lumbar impact strength index<0.903(P<0.05).(6)These findings conclude that the comprehensive index of lumbar vertebral body bone strength is more accurate than the bone mineral density of the vertebral body and spine-pelvis sagittal parameters in predicting osteoporotic vertebral compression fractures,which is helpful for early prevention and treatment of osteoporotic vertebral compression fractures.

Objective To investigate the role of RNA-binding motif protein X-linked(RBMX)in regulating the proliferation,migration,invasion and glycolysis in human bladder cancer cells.Methods A lentivirus vectors system and RNA interference technique were used to construct bladder cancer 1376 and UC-3 cell models with RBMX overexpression and knockdown,respectively,and successful cell modeling was verified using RT-qPCR and Western blotting.Proliferation and colony forming ability of the cells were evaluated using EdU assay and colony-forming assay,and cell migration and invasion abilities were determined using Transwell experiment.The expressions of glycolysis-related proteins M1 pyruvate kinase(PKM1)and M2 pyruvate kinase(PKM2)were detected using Western blotting.The effects of RBMX overexpression and knockdown on glycolysis in the bladder cancer cells were assessed using glucose and lactic acid detection kits.Results RT-qPCR and Western blotting confirmed successful construction of 1376 and UC-3 cell models with RBMX overexpression and knockdown.RBMX overexpression significantly inhibited the proliferation,clone formation,migration and invasion of bladder cancer cells,while RBMX knockdown produced the opposite effects.Western blotting results showed that RBMX overexpression increased the expression of PKM1 and decreased the expression of PKM2,while RBMX knockdown produced the opposite effects.Glucose consumption and lactate production levels were significantly lowered in the cells with RBMX overexpression(P<0.05)but increased significantly following RBMX knockdown(P<0.05).Conclusion RBMX overexpression inhibits bladder cancer progression and lowers glycolysis level in bladder cancer cells by downregulating PKM2 expression,suggesting the potential of RBMX as a molecular target for diagnosis and treatment of bladder cancer.

Objective By observing the effects of"three methods and three points"tuina technique on the expression of interleukin-17F(IL-17F),interleukin-17 receptor C(IL-17RC),activator 1 of nuclear transcription factor-κB(Act1),tumour necrosis factor receptor-associated factor 6(TRAF6)and M1 microglial cell expression in the spinal dorsal horn of rats with mild chronic compressive injury(minor CCI)model,we explored the immediate analgesic mechanism of tuina on peripheral neuropathic pain(pNP).Methods Thirty-six SD rats were divided into the sham group,the model group and the tuina group according to the random number method,twelve rats in each group,and the minor CCI model was replicated by ligating the right sciatic nerve.The rats in the tuina group were subjected to pointing,plucking and kneading at the BL37,BL57 and GB34 points on the affected side using a tuina simulator,while the sham group and the model group were only grasped and restrained,and were intervened for one time.The mechanical pain test and cold plate test were used to evaluate the response of rats to mechanical stimulation and cold stimulation after immediate intervention.The protein expression of IL-17F and TRAF6 in the spinal dorsal horn of rats in each group was detected by Western blotting.The mRNA expression of IL-17F,IL-17RC,Act1 and TRAF6 in the spinal dorsal horn of rats in each group was detected by real-time PCR.The average fluorescence intensity of M1 microglia in the spinal dorsal horn of rats in each group was detected by immunofluorescence.Results Behavioral results showed that before intervention,compared with the sham group,paw mechanical withdraw threshold(PMWT)decreased and cold sensitivity threshold(CST)increased in the model group and the tuina group;after tuina intervention,PMWT in the tuina group was increased,and CST was decreased compared with the model group;after intervention,PMWT in the tuina group was increased,while CST was decreased(P＜0.05).RT-PCR results showed that compared with the sham group,mRNA expression levels of IL-17F,IL-17RC,TRAF6 and Act1 in the spinal dorsal horn of the model group were increased;compared with model group,the mRNA expression levels of above indexes in the tuina group were decreased(P＜0.05).Western boltting results showed that compared with the sham group,the expression levels of IL-17F and TRAF6 protein in the spinal dorsal horn of the model group were increased;compared with the model group,the expression levels of IL-17F and TRAF6 protein in the tuina group decreased(P＜O.05).Immunofluorescence results showed that the mean fluorescence intensity of CD40 in the spinal dorsal horn of model group was enhanced compared with the sham group;compared with the model group,the mean fluorescence intensity of CD40 in the tuina group was decreased(P＜0.05).Conclusion The"three methods and three points"tuina technique can produce immediate analgesia by inhibiting the expression of IL-17F,IL-17RC,Act1,TRAF6 and the activation of M1 microglia in the dorsal horn of the spinal cord after one intervention.