Objective:To compare the therapeutic effects of partial nephrectomy (PN) and cryoablation (CA) in patients with stage cT 1N 0M 0 renal cell carcinoma (RCC). Methods:A retrospective analysis was conducted on clinical data of patients with stage cT 1N 0M 0 RCC who underwent CA and PN treatment at The First Affiliated Hospital of Naval Medical University and Shanghai Ninth People's Hospital between March 2011 and December 2019. There were 50 cases in the CA group (36 from The First Affiliated Hospital of Naval Medical University and 14 from the Shanghai Ninth People's Hospital), and 1 323 cases in the PN group (all from The First Affiliated Hospital of Naval Medical University). PN included open surgery, laparoscopic surgery, or robotic surgery performed under general anesthesia through the abdominal or retroperitoneal approach. CA included laparoscopic surgery under general anesthesia and percutaneous treatment guided by CT or ultrasound under local anesthesia. Propensity score matching was performed based on baseline data of the patients to obtain balanced samples between the two groups using a 1∶2 nearest-neighbor matching method. After matching, comparisons were made between the two groups in terms of perioperative conditions, overall survival (OS), and recurrence-free survival (RFS). Results:After PSM, patient distributions were closely balanced in baseline data such as gender (male/female: 28/19 cases in CA group and 58/36 cases in PN group), age [66.0(53.0, 75.0) years vs. 59.5(50.0, 69.3) years], body mass index[ (24.1 ± 6.4) kg/m 2 vs. (24.1 ± 3.1) kg/m 2], Charlson comorbidity index [1(0, 2) vs. 1(0, 2)], history of malignant tumors [19.1% (9/47) vs. 17.0% (16/94)], preoperative estimated glomerular filtration rate (eGFR) [85.2(65.5, 97.1) ml/(min·1.73m 2) vs. 87.0(73.4, 100.4) ml/(min·1.73m 2)], and R. E.N.A.L. score [6(5, 7) vs. 7(6, 8)] between CA(n=47) and PN(n=94) group. There were significant differences in operative time [97.5(81.2, 117.5) min vs. 145.0(110.2, 185.0) min, P<0.001], estimated blood loss [85.0(50.0, 100.0) ml vs. 100.0(75.0, 200.0)ml, P=0.021], length of hospital stay [3.0(2.0, 4.0) days vs. 7.6(5.0, 9.0) days, P<0.001] between the CA and the PN group. No significant differences were observed in the incidence of postoperative complications [4.3% (2/47) vs. 5.3% (5/94), P=0.784], the eGFR within one week after surgery [83.7(65.6, 106.6) ml/(min·1.73m 2) vs. 83.2(66.7, 97.7) ml/(min·1.73m 2), P=0.645], the median follow-up time [ 93 (67, 126) months vs. 85 (68, 139) months, P=0.955], the RFS rate[81.8% vs. 96.8%, P=0.074], or the OS rate [85.7% vs. 97.8%, P=0.190] between the CA and the PN group. Conclusions:For patients with cT 1N 0M 0 stage RCC, CA and PN demonstrate comparable oncologic treatment efficacy, while CA offering the advantages of shorter surgical time, shorter hospital stay, and less blood loss.

Focal therapy for renal cell carcinoma is a precision treatment technique that directly targets and destroys cancerous lesions while preserving the maximum amount of surrounding healthy kidney tissue through localized intervention. It is primarily indicated for early-stage renal cell carcinoma in patients with tumors ≤4 cm in diameter (T 1a), particularly for those at higher surgical risk. Compared to traditional radical nephrectomy and partial nephrectomy, focal therapy offers several advantages, including lower physical demands on the patient, minimally invasive nature, reduced risk of complications, and faster recovery. The focal therapy techniques currently utilized in clinical practice include cryoablation, radiofrequency ablation, microwave ablation, irreversible electroporation, high-intensity focused ultrasound, and stereotactic body radiotherapy. This article reviews the principles of various focal therapy techniques, patient selection, and the oncological outcomes, complications, and renal function preservation associated with these focal therapies.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

BACKGROUND:Osteoporotic vertebral compression fracture is a common fracture secondary to osteoporosis.At present,there is no effective prediction index and method for osteoporotic vertebral compression fracture. OBJECTIVE:To investigate the predictive effect of the comprehensive index of lumbar vertebral body bone strength on osteoporotic vertebral compression fracture. METHODS:233 patients with osteoporosis were divided into a fracture group and a non-fracture group according to whether a vertebral fracture occurred.The demography,body mass index,vertebral bone mineral density and other details were collected.Lateral X-ray films of the lumbar spine were photographed.The vertebral body width,vertebral body length,sacral slope,pelvic tilt,pelvic incidence,lumbar compressive strength index and the lumbar impact strength index were measured,calculated,and analyzed by univariate and multivariate,and the receiver operating characteristic curve was analyzed.The survival analysis was conducted according to the cut-off value. RESULTS AND CONCLUSION:(1)All patients were followed up for 2-4 years,with an average of 3.1 years.During the follow-up period,99 cases(38 cases of L1 vertebral body,61 cases of L2 vertebral body)had fractures(fracture group),and 134 cases(52 cases of L1 vertebral body,82 cases of L2 vertebral body)had no fractures(non-fracture group).Univariate analysis showed that there was no significant difference in age,sex,height,body mass,body mass index and fracture segment between the two groups(P>0.05).(2)Lumbar compressive strength index and lumbar impact strength index in the fracture group were lower than those in the non-fracture group(P<0.05).Pelvic incidence and pelvic tilt in the fracture group were higher than those in the non-fracture group(P<0.05).(3)Multivariate analysis showed that lumbar compressive strength index,lumbar impact strength index and pelvic tilt were risk factors for osteoporotic vertebral compression fractures(P<0.05).(4)Receiver operating characteristic curve analysis showed that the cutoff values of vertebral bone mineral density,lumbar compressive strength index,lumbar impact strength index,pelvic tilt and pelvic incidence were 0.913 5 g/cm2,1.932,0.903,21.5° and 55°,respectively;areas under the curve were 0.630,0.800,0.911,0.633 and 0.568,respectively.(5)According to the survival analysis(with osteoporotic vertebral compression fracture as the end point),the average survival time of the patients with lumbar impact strength index≥0.903 was significantly longer than that of the patients with lumbar impact strength index<0.903(P<0.05).(6)These findings conclude that the comprehensive index of lumbar vertebral body bone strength is more accurate than the bone mineral density of the vertebral body and spine-pelvis sagittal parameters in predicting osteoporotic vertebral compression fractures,which is helpful for early prevention and treatment of osteoporotic vertebral compression fractures.

BACKGROUND:Osteoporosis vertebral compression fracture is a common fracture secondary to osteoporosis,and there is currently a lack of effective predictive indicators and methods for osteoporosis vertebral compression fracture. OBJECTIVE:To investigate the predictive effects of paravertebral muscle degeneration,functional cross-sectional area,and percentage of fat infiltration on osteoporotic vertebral compression fractures. METHODS:The 224 patients with osteoporosis diagnosed from January 2018 to June 2022 were included.They were followed up for more than 2 years.They were divided into fracture group and non-fracture group according to the presence and absence of vertebral fracture.The detailed information of demographics,body mass index,bone mineral density and so on were collected.The functional cross-sectional area and percentage of fat infiltration of bilateral Psoas major muscle and extensor dorsi(Erector spinae muscles muscle and multifidus muscle)at the level of lower endplate of L2 vertebral body were measured and calculated. RESULTS AND CONCLUSION:(1)224 patients were ultimately included,of which 126 had fractures as the fracture group and 98 had no fractures as the non-fracture group.There was no statistically significant difference in age,gender,height,body mass,body mass index,and fracture segment between the two groups(P>0.05).(2)The bone mineral density of the fracture group was significantly lower than that of the non-fracture group(P<0.05).Functional cross-sectional areas of Psoas major muscle and extensor dorsi in the fracture group were significantly lower than those in the non-fracture group(P<0.05).The percentage of fat infiltration of the extensor dorsi in the fracture group was significantly higher than that in the non-fracture group(P<0.05).There was no significant difference in percentage of fat infiltration of Psoas major muscle between the two groups(P>0.05).(3)Receiver operating characteristic analysis showed that the vertebral bone mineral density,percentage of fat infiltration of extensor dorsi,functional cross-sectional area of extensor dorsi and percentage of fat infiltration of Psoas major muscle were 0.903 g/cm2,35.426%,418.875 mm2,and 6.375%,respectively.The areas under curve were 0.634,0.755,0.876,and 0.585,respectively.(4)These findings indicate that paravertebral muscle degeneration is strongly associated with the occurrence of osteoporotic vertebral compression fractures.The functional cross-sectional area of extensor dorsi muscle can effectively predict the occurrence of osteoporotic vertebral compression fractures,which is helpful for early prevention and treatment of osteoporotic vertebral compression fractures.

Objective:To investigate the safety and prognosis of partial nephrectomy (PN) in the treatment of highly malignant non-clear renal cell carcinoma (nccRCC).Methods:Clinical data of 47 patients with cT 1N 0M 0 high malignant nccRCC treated in Changhai Hospital from March 2016 to March 2022 were retrospectively analyzed. All patients received PN. There were 34(72.3%) males and 13(27.7%) females. The mean age was (53.5±15.0) years, and average BMI, was(23.7±3.4)kg/m 2.The maximum tumor diameter was (29.8±12.6) mm, and R. E.N.A.L. score was 7(5-9), with 37(78.7%) cases of T 1a and 10(21.3%) cases of T 1b. The mean estimated glomerular filtration rate (eGFR) before surgery was (96.3±25.5) ml/ (min·1.73m 2). All patients underwent PN, including 1 patient (2.1%) undergoing open surgery, 29 patients (61.7%) undergoing laparoscopic surgery, and 17 patients (36.2%) undergoing robotic surgery. There were a total of 22(46.8%) cases of papillary cell carcinoma(pRCC)type Ⅱ, 4(8.5%) cases of collecting duct carcinoma (cdRCC), 9(19.1%) cases of MiT family translocated renal cell carcinoma (tRCC), 5(10.6%) cases of mucoid tubular and spindle cell carcinoma (mtSCC)and 7(14.9%) cases of unclassified renal cell carcinoma (uRCC). The surgical conversion rate, positive margin rate, operative time, intraoperative blood loss, complications, and postoperative hospital stay were analyzed. Preoperative and postoperative eGFR were analyzed, and overall survival (OS) and cancer specific survival (CSS) were calculated. Results:All the operations were successfully completed. No radical operation or open operation was performed, with operation time of(100±60) min and intraoperative blood loss of(100±59) ml. There were no intraoperative complication and 1 case (2.1%) suffered from postoperative complication. Postoperative hospital stay were 5 (4-6) days. The mean eGFR after surgery was (86.5±27.1) ml/(min·1.73m 2), and the difference was statistically significant ( P=0.041). In this study, the mean follow-up time was (45.7±20.9)months, and no adjuvant therapy was used after surgery. During the follow-up period, 2 patients died, who all of them were kidney cancer-related death, and both OS and CSS were 95.7% (45/47). Conclusions:PN is safe, feasible and has a good prognosis in the treatment of high malignant T 1 nccRCC. For tumors with clear imaging boundaries and complete envelope, complete tumor resection is more likely, postoperative follow-up should be strict, and no remedial radical or systemic treatment was required.

Objective:To analyze the molecular epidemiological characteristics of Campylobacter fetus subsp. testudinum ( Cft). Methods:Fifteen strains of Cft collected in our laboratory from 2010 to 2022 were subjected to whole-genome sequencing. Their epidemiological characteristics were analyzed based on the global genome data of Cft on GenBank database. MLST-GrapeTree software was used to obtain the genetic structure of Cft strains. A phylogenetic tree was constructed using core-genome single nucleotide polymorphism (cgSNP) analysis, and the sequence clusters were identified using rhierBAPS. Virulence genes and drug resistance genes of Cft strains were annotated using CARD, ResFinder and VFDB database. Their susceptibility to antibiotics was tested using E-test method and the results were analyzed using the CLSI-M45 sensitivity standard for Campylobacter jejuni/ Campylobacter coli. Results:Based on average nucleotide identity (ANI) analysis, the genome data of 41 Cft strains including 24 isolated from human, 13 from animals and four of unknown sources were collected from GenBank database. Among the 24 human-derived strains, 20 were linked to Asian descent and only one was linked to Caucasian descent (spouse of Asian descent), showing statistically significant differences in human ethnicity. All of the 13 animal-derived strains were originated from reptilian sources, including six from turtles, four from snakes and three from lizards. MLST revealed that ST46 was the predominant ST in China, while ST15 was the major sequence type in the United States. Grapetree analysis also demonstrated that the genetic diversity in China was greater than that in the United States. The phylogenetic tree constructed based on cgSNP and BAPS identified six distinct sequence clusters. The Chinese isolates were scattered in diverse sequence clusters and closely related to animal-derived strains, while the American isolates mainly belonged to ST15. The genes encoding virulence factors such as flagella, glycosylation systems and adhesins were carried by all of the 41 Cft strains (100.00%). The invasion-related virulence genes, such as the genes encoding the IV type secretion system ( virB4, virB9, virD4) and the resistance-related tetO efflux pump gene were specifically identified in the emerging ST74 clones. In vitro drug susceptibility testing of 15 Chinese isolates revealed 46.67% of the Cft strains were resistant to ciprofloxacin and 100.00% were sensitive to erythromycin. Conclusions:The global sequence clusters of Cft isolates showed a great genetic diversity. Most of the people with Cft infection had basic immune diseases and might have eaten or had contact with reptiles. Notably, the Chinese domestic infection of ST46 and the emerging ST74 should arouse our more attention.

Objective:To enhance the early recognition of Prader-Willi syndrome by summarizing the clinical characteristics of Prader-Willi syndrome (PWS) during perinatal period.Methods:Through a nationwide cross-sectional study in the Department of Pediatrics, Peking Union Medical College Hospital, Peking Union Medical College, Chinese Academy of Medical Sciences,226 children diagnosed as PWS by molecular genetics were recruited from September 2019 to March 2020. Clinical data including fetuses Age, birth weight, fetal movement, fetal position, amniotic fluid, mode of bith, crying, muscle tension, feeding, and cryptorchidism were collected to analyze the clinical characteristics of Chinese PWS patients in the perinatal period, and according to the mode of birty, birth weight and genotypes to perform subgroup analysis. The clinical manifestations of different subtypes were statistically analyzed by t test, χ 2 test or Mann-Whitney U test. Results:Among the 226 PWS patients, 120 were males, and 106 were females. Among them, 100 (44.2%) patients were small for gestational age. Decreased fetal movement was the most common manifestation 202 cases (89.4%) during pregnancy, and other manifestations included polyhydramnios 71 cases (31.4%) and abnormal fetal position 58 cases (25.7%). One hundred and eighty-five (81.9%) patients were delivered by cesarean section and the frequency of abnormal fetal position was significantly higher (30.8%(57/185) vs. 2.4%(1/41),χ2=14.161, P<0.01). As for abnormal manifestations after birth included hypotonia 221 cases (97.8%),220 cases (97.3%) showing weak crying, 116 cases among the total 120 males patients (96.7%) wanifested with cryptordnildism and 206 feeding difficulties (91.2%). In terms of genetic subtype, most of them (184/226, 81.4%) had a paternal deletion, while maternal age (35±5 vs. 29±5, t=-6.591, P<0.01) and the frequency of polyhydramnios (47.6% (20/42) vs. 27.7% (51/185), χ2=6.286, P=0.012) were significantly higher in the non-deletion group. Conclusions:The main manifestations of PWS patients during the perinatal period are hypotonia, weak crying, feeding difficulties, decreased fetal movement, cryptorchidism and those patients are more likely to be born by cesarean section. In newborns with these characteristics, pediatricians should be aware of the possibility of PWS. In terms of the relationship between genotypes and phenotypes, polyhydramnios is more frequently observed in the non-deletion group.

Objective: To investigate the effect of metformin on autophagy in muscle cells exposed to palmitic acid, and to explore its mechanism. Methods: L6 rat myoblasts were incubated with palmitic acid at various concentrations(0.1, 0.2, 0.4, 0.6 mmol/L) and metformin(0.5, 1, 2, 5, 10 mmol/L) for 24 h. CCK8 method was used to detect the survival rate of muscle cells. After muscle cells were treated with palmitic acid and metformin for 24 h, mRNA and protein expressions of microtubule-associated protein11ight chain3(LC3Ⅱ), Beclin 1, p62, and silent mating type information regulation2 homolog-3(SIRT3) were detected by RT-PCR and Western blot, respectively. AMP-activated protein kinase(AMPK) phosphorylation level was detected by Western blot. Results: Palmitic acid dose-dependently decreased the survival rate of muscle cells, which was attenuated by metformin at the concentration of 2 mmol/L. After muscle cells were incubated with 0.4 mmol/L palmitic acid and 2 mmol/L metformin for 24 h, palmitic acid significantly reduced the mRNA and protein expressions of LC3Ⅱ, Beclin1, and SIRT3 as well as phosphorylation level of AMPK(all P<0.05), and increased p62 mRNA and protein expressions(P<0.05). Those effects were all antagonized by metformin(all P<0.05). Conclusions Metformin treatment may promote the autophagy of muscle cells exposed to palmitic acid through AMPK/STRT3 pathway.

More and more studies have found that diabetes is closely related to white matter hyperintensities. This article reviews the relationship between diabetes and white matter hyperintensities, the effect of white matter hyperintensities on cognitive impairment in patients with diabetes, and the relationship between the two and stroke.