The distance fmm skin to the lumber epidural space was measured in 60 male patients receiving epidural analgesia. The mean distance was found to be 4.45cm. The epidural depths were identified most frequently at 4.0 to 4.5cm deep and over 90% of total cases were less than 5.5cm deep. The epidural depths had correlations with weight and PI(P < 0.001), but not correlated with height.
Adult* ; Analgesia, Epidural ; Epidural Space* ; Humans ; Male* ; Skin*

BACKGROUND: The management of vertiginous patients is a great challenge to emergency physicians. We evaluated the diagnostic value of a diffusion-weighted image(DWI) in differentiating central vertigo from the peripheral vertigo in patients who presented no neurological symptoms other than risk factors for stroke. METHODS: From March 2000 to February 2001, we retrospectively analyzed the cases of 68 patients who visited the emergency department with symptoms of isolated vertigo and who had risk factors for stroke. DWIs, computed tomograms(CT), and medical records were reviewed, and the final diagnose, the DWIs and the CT readings, the risk factors for stroke, and the time it took waiting for a DWI or CT scan were analyzed. RESULTS: Of the 68 patients, 21(30.8%) had central vertigo: 15 vertebrobasilar transient ischemic attacks(VB-TIA), 4 brain stem infarctions, 1 cerebellar infarction, and 1 cerebellopeduncular infarction. The DWI showed a 28.6% sensitivity, a 97.9% specificity, and an 85.7% positive predictive value in diagnosing central vertigo. It also had a 100% sensitivity in detecting infarctions. CONCLUSION: A DWI had a comparable sensitivity to MRI in detecting central vertigo and small, but potentially, lethal infarctions in our patient population. We recommend clinical application of DWI in the emergency department evaluation of isolated vertigo patients with risk factors for stroke.
Brain Stem Infarctions ; Emergencies ; Emergency Service, Hospital ; Humans ; Infarction ; Magnetic Resonance Imaging ; Medical Records ; Reading ; Retrospective Studies ; Risk Factors* ; Sensitivity and Specificity ; Stroke* ; Tomography, X-Ray Computed ; Vertigo*

Colorectal cancer is the third most common malignancy in Korea. In contrast, pericolic or mesenteric lymphoma is relatively rare. We experienced an extremely rare case of synchronous primary colon cancer in the ascending colon with T-cell lymphoma in the pericolic lymph node. A 79-year-old woman presented with complaints of epigastric and right lower abdominal pain combined with anorexia and nausea. Colonoscopic evaluation and biopsy were performed, and the diagnosis was cecal adenocarcinoma. She underwent right hemicolectomy with lymph node dissection. The pathology report revealed adenocarcinoma in cecum with metastasis to 1 regional lymph node out of 37 lymph nodes. In addition, there was malignant angioimmunoblastic T-cell lymphoma in 1 pericolic lymph node. There was no evidence of lymphoma in ileum, cecum and ascending colon, so the possibility of early phase of lymphoma was suggested.
Abdominal Pain ; Adenocarcinoma ; Aged ; Anorexia ; Biopsy ; Cecum ; Colon ; Colon, Ascending ; Colonic Neoplasms ; Colorectal Neoplasms ; Female ; Humans ; Ileum ; Korea ; Lymph Node Excision ; Lymph Nodes ; Lymphoma ; Lymphoma, T-Cell ; Nausea ; Neoplasm Metastasis ; T-Lymphocytes

Desmoplastic fibroma of bone is an extremely rare tumor that was first described by Jaffe in 1958. It histologically resembles the desmoid tumor of soft tissue. It is known as locally aggressive tumor but we experienced definitely benign and resembling simple bone cyst radiographically. We report a case of desmoplastic fibroma of bone and it should be included in the differential diagnosis list of any lytic bone lesion. The radiograph, MR imaging features, radiological and pathological differential diagnosis of the case are described, and literatures are reviewed.
Bone Cysts ; Diagnosis, Differential ; Female ; Fibroma, Desmoplastic ; Fibromatosis, Aggressive ; Humans

PURPOSE: Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: Forty-eight familial FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. To identify unknown mutations, regions containing the exons for SCN1A gene was performed with two primer(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG) by touchdown PCR method, and to identify known mutations, regions containing exons of the SCN1A gene were amplified by PCR using suitable primer sets. Ten reported mutations of SCN1A were screened by SNaPshot method. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: Among 48 FS patients, thirty(62.5%) showed simple FSs, and eighteen(37.5 %) had complex FS+. Three patients(6.3%) were younger than 12 months old, twenty- nine(60.4%) between 12 and 36 months old, and sixteen(33.3%) older than 36 months old. The ratio of female to male was 0.66:1.0. In the phenotypes of FSs, forty-five patients (93.8%) had generalized tonic-clonic seizures, one patient(2.1%) myoclonic seizures and two patients(4.2%) atonic seizures. In EEG findings of FSs, thirty-eight(79.2%) patients had normal findings, and ten(20.9%) patients had mild aspecific abnormalities. Mutational analysis detected no mutations of SCN1A. CONCLUSION: Our study demonstrated that SCN1A is not frequently involved in common FSs and sugggested any involvement of specific FS genes.
Child ; Child, Preschool ; DNA ; Electroencephalography ; Epilepsies, Myoclonic ; Epilepsy ; Epilepsy, Generalized ; Exons ; Female ; Humans ; Infant ; Male ; Neurology ; Phenotype ; Polymerase Chain Reaction ; Seizures ; Seizures, Febrile* ; Sodium Channels

PURPOSE: Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: Forty-eight familial FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. To identify unknown mutations, regions containing the exons for SCN1A gene was performed with two primer(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG) by touchdown PCR method, and to identify known mutations, regions containing exons of the SCN1A gene were amplified by PCR using suitable primer sets. Ten reported mutations of SCN1A were screened by SNaPshot method. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: Among 48 FS patients, thirty(62.5%) showed simple FSs, and eighteen(37.5 %) had complex FS+. Three patients(6.3%) were younger than 12 months old, twenty- nine(60.4%) between 12 and 36 months old, and sixteen(33.3%) older than 36 months old. The ratio of female to male was 0.66:1.0. In the phenotypes of FSs, forty-five patients (93.8%) had generalized tonic-clonic seizures, one patient(2.1%) myoclonic seizures and two patients(4.2%) atonic seizures. In EEG findings of FSs, thirty-eight(79.2%) patients had normal findings, and ten(20.9%) patients had mild aspecific abnormalities. Mutational analysis detected no mutations of SCN1A. CONCLUSION: Our study demonstrated that SCN1A is not frequently involved in common FSs and sugggested any involvement of specific FS genes.
Child ; Child, Preschool ; DNA ; Electroencephalography ; Epilepsies, Myoclonic ; Epilepsy ; Epilepsy, Generalized ; Exons ; Female ; Humans ; Infant ; Male ; Neurology ; Phenotype ; Polymerase Chain Reaction ; Seizures ; Seizures, Febrile* ; Sodium Channels

OBJECTIVE: This study was performed to investigate the influences of extraction and nonextraction treatment on smile esthetics by measuring dental arch width changes. METHODS: Pretreatment and posttreatment study models of 30 first premolar extraction cases and 30 nonextraction cases were randomly selected to determine whether extraction treatment results in narrow dental arches, and a consequent unaesthetic smile. Arch widths were measured from the cusp tips of the canines and the first molars. Posterior arch widths were also measured at a constant arch depth derived by averaging randomly chosen nonextraction models. RESULTS: The intercanine widths increased significantly in the extraction sample, whereas the intermolar widths decreased significantly. The arch width at a standardized arch depth was significantly wider in the extraction subjects. CONCLUSION: These results elucidate that constriction in arch width is not a materialized consequence of extraction treatment. It leads to postulate that an esthetically compromising effect from narrow dental arches on smile is hardly anticipated with extraction treatment.
Bicuspid ; Constriction ; Dental Arch ; Esthetics ; Molar

No abstract available.
Quetiapine Fumarate ; Stroke

PURPOSE: In acyanotic congenital heart disease of children with left to right shunt, 99mTc- Macroaggregate albumin (MAA) was employed to determine the scintigraphic severity of pulmonary parenchymal damage. METHODS: These data of lung perfusion scan using 99mTc-MAA were compared with hemodynamic values obtained from cardiac catheterization. RESULTS: The mean Pulmonary arterial pressure (> or = 30mmHg), total pulmonary resistance (> or = 2 Wood unit) & ratio of pulmonary vascular resistance/systemic resistance (Rp/Rs > or = 0.2) were proportionally related to higher perfusion ratio of upper and lower lung field. The diagnostic values of perfusion ratio of upper & lower field of both lung (cut off value > or = 0.8) for pulmonary hypertension were as follows : 60-65% of sensitivity, 75-90% of specificity, 72-86% of positive predictive value & 68-69% of negative predictive value. The mottled perfusion defect was frequently found in patients with pulmonary hypertension (mean pulmonary arterial pressure > or = 30mmHg, Rp > or = 2 Wood unit). The degree of perfusion defect as indicator of severe pulmonary parenchymal damage was utilized clinically as determinator of operability and morbidity for acyanotic shunt lesions perioperatively. CONCLUSION: The scintigraphic severity determined by 99mTc-MAA lung perfusion scan could be valid for evaluating the extent of pulmonary parenchymal damage in acyanotic congenital heart disease complicated by pulmonary hypertension.
Arterial Pressure ; Cardiac Catheterization ; Cardiac Catheters ; Child ; Child* ; Heart Defects, Congenital* ; Hemodynamics ; Humans ; Hypertension, Pulmonary ; Infant* ; Lung* ; Perfusion* ; Sensitivity and Specificity ; Syncope* ; Wood

Neurofibromatosis is characterized by multiple cutaneous neurofibromas, cafe-au-lait spots and a broad spectrum of clinical, pathologic and radiologic finding. The incidence of malignant neoplasms complicating neurofibromatosis has never been satisfactorily estabilished ; estimates range from 3% to 15%. The malignant tumors are usually derived from neural crest tissue. Gastrointestinal involvement appears to be rare and usually consists of neurofibromas, ganglioneuromas and leiomyomas. Hepatobiliary involvement in neurofibromatosis is rare and mostly located at the periampullary region. Most of theses tumors are carcinoids or less frequently neurofibromas. The authors report a case of peripheral cholangiocarcinoma associated with neurofibromatosis type 1.
Cafe-au-Lait Spots ; Carcinoid Tumor ; Cholangiocarcinoma* ; Ganglioneuroma ; Incidence ; Leiomyoma ; Neural Crest ; Neurofibroma ; Neurofibromatoses* ; Neurofibromatosis 1*