Objective To explore the application of subdermal vascular network skin graft in severed finger reunion with small area skin defects.Methods Modified subdermal vascular network,which was inversion thin and middle thick,was used to repair defect of severed finger reunion without exposure of blood vessel.There were 10 patients and 14 fingers,including 7 patients and 10 fingers injured in the dorsal sid with 5 fingers' extensor tendon exposed,and 3 patients and 4 fingers injured in the palmar side with 2 patients' flexor tendon exposed.The defect area was ranged from 1.0 cm × 0.8 cm to 3.0 cm × 1.5 cm.Results In 6 larger subdermal vascular network,skin's edge became blue and blister appeared in the middle.The others was good with skin texture and aspect.Conclusions Modified subdermal vascular network skin graft is safe and effective choose to solve severed finger reunion with smnall area skin defects.

Objective To find the optimal route of eontralateral C7 nerve transfer for brachial plexus avulsion injuries through autopsy. Methods The bilateral brachial plexus were exposed on 30 sides of 15 cadaverie specimens of adult. The C7 nerve root was sectioned at the junction site of trunk and division, and then dissected proximally to the foramina. The max length of anterior and posterior division of C7 was measured. The distance between the roof of C7 and the upper trunk and the lower trunk at the affected side through vertebral body route, prespinal route and a subcutaneous tunnel on the anterior surface of the neck was measured. Results The max length of anterior and posterior division of C7 was (7.67±1.06) cm and (7.79±1.36) cm respectively. The distance between the roof of C7 and the upper trunk at the affected side through vertebral body route, prespinal route and a subcutaneous tunnel on the anterior surface of the neck was (6.97±0.56) cm and (10.04±0.94) cm and (16.56±1.24) cm respectively, there were statistical significance among them (P < 0.01). The distance between the roof of C7 and the lower trunk at the affected side through vertebral body route and prespinal route and a subcutaneous tunnel on the anterior surface of the neck was (6.82±0.92) cm、(9.91±0. 83) cm and (17.64±0.97) cm, with a significant difference (P<0.01). Conclusion The best way of contralateral C7 nerve transfer for the treatment of brachial plexus injury was through the vertebral body route from the point of anatomy.

We analyzed the laboratory detection results from the first case of human infected with avian influenza (H5N6) in Hubei Province,in order to provide a better basis for preventing and controlling human avian influenza in the future and a detected strategy for the detection of suspected cases of human avian influenza for the staff in the laboratory.The case data of epidemiological survey and related laboratory detection results of specimens of infection virus from the different time piont and kinds of specimens were analyzed by descriptive epidemiological methods.The H5N6 nucleic acid from the only early sputum specimens were detected,and while the others were not detected.In conclusion the different specimens of the doubtful H5N6 case should be collected,and the early sputum samples are very important and should be collected and detected.

OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.

We have researched the viscoelastic properties of the cancellous bones of the os calcaneus, os lunatum and os capitalum. The compressing stress relaxation experiment and the creep experiment in the vertical, horizontal and 45 degree directions on the os calcaneus were performed. The data and curve of the compressing stress relaxation and creep were obtained. By masing regression analysis we worked out the compressing reduced stress relaxation and creep functions and curves. The results show that the quantities of compressing stress relaxation and creep of the calcaneus in the vertical direction are larger than those in the other two directions. The initial quantities of creep of the os capitalum are larger than those of the os lunatum, and there are no significant different between the quantities of stress relaxation of the cancellous bones of the os lunatum and os capitalum.
Adult ; Calcaneus ; physiology ; Elasticity ; Humans ; Linear Models ; Lunate Bone ; physiology ; Male ; Models, Biological ; Regression Analysis ; Skull ; physiology ; Stress, Mechanical ; Weight-Bearing ; physiology

AIM: To study the effect of Yupingfeng Powder(YPFP) on rat's allergic rhinitis induced by stimulating ovalbumin.and reveal the influence on Th1,Th2 and Th1/Th2 proportion. METHODS: 8-week-old BALB/c mice were sensitized by means of intranasal and systemic intraperitoneal injection application of OVA,6 subjects were administered including 2,500 mg/kg extracts of YPFP for 7 days in early stage(interference group);6 mice were administered YPFP in after challenge(therapy group);the placebo group were given saline.After 7 days,Th1 and Th2 in splenocyte were detected by flow cytometry(FCM) and nasobuccal mucosa pathology were observed. RESULTS: When compared with Th2 of animal model group(9.86?1.40),there was a significant decrease expressing Th2 after PFP treatment(3.41?0.72,P

Objective To explore the prevalence of food intolerance and its determinants in healthcare elderly in China.Methods A cross sectional survey was carried out from August 1st,2008 to June 30th,2009,that including 736 60-year-olds from a Health Management Research Institute,Chinese PLA General Hospital.Data was double entried in computer and organized by EpiData 3.0.Non conditional logistic regression model was used for odd ratio (OR)and 95％CI,with the use of SPSS 13.0.Results The three leading foodstuff on intolerance were crab,egg and shrimp,with the prevalence rates as 35.9％,28.8％ and 15.1％ respectively.Results from the multiple regression analysis showed that the crab intolerance was associated with Helicobacter pylori infections (P＜0.05).The OR (95％CI) of Helicobacterpylori infections (DOB≥4) was 1.544 (1.139-2.091).Conclusion The three leading intolerance foods were egg,crab and shrimp.Crab intolerance was associated with Helicobacter pylori infections.To reduce the risk of crab intolerance,it was necessary to control the infection caused by Helicobacter pylori.