1.Enrichment of Wee1/CDC2 and NF-κB Signaling Pathway Constituents Mutually Contributes to CDDP Resistance in Human Osteosarcoma
Zhengbo HU ; Lugen LI ; Wenxing LAN ; Xiao WEI ; Xiangyuan WEN ; Penghuan WU ; Xianliao ZHANG ; Xinhua XI ; Yufa LI ; Liqi WU ; Wenhu LI ; Xiaohong LIAO
Cancer Research and Treatment 2022;54(1):277-293
Purpose:
Osteosarcoma (OS) universally exhibits heterogeneity and cisplatin (CDDP) resistance. Although the Wee1/CDC2 and nuclear factor кB (NF-κB) pathways were reported to show abnormal activation in some tumor cells with CDDP resistance, whether there is any concrete connection is currently unclear. We explored it in human OS cells.
Materials and Methods:
Multiple OS cell lines were exposed to a Wee1 inhibitor (AZD1775) and CDDP to assess the half-maximal inhibitory concentration values. Western blot, coimmunoprecipitation, confocal immunofluorescence, cell cycle, and Cell Counting Kit-8assays were performed to explore the connection between the Wee1/CDC2 and NF-κB pathways and their subsequent physiological contribution to CDDP resistance. Finally, CDDP-resistant PDX-OS xenograft models were established to confirm that AZD1775 restores the antitumor effects of CDDP.
Results:
A sensitivity hierarchy of OS cells to CDDP and AZD1775 exists. In the highly CDDP-tolerant cell lines, Wee1 and RelA were physically crosslinked, which resulted in increased abundance of phosphorylated CDC2 (Y15) and RelA (S536) and consequent modulation of cell cycle progression, survival, and proliferation. Wee1 inhibition restored the effects of CDDP on these processes in CDDP-resistant OS cells. In addition, animal experiments with CDDP-resistant PDX-OS cells showed that AZD1775 combined with CDDP not only restored CDDP efficacy but also amplified AZD1775 in inhibiting tumor growth and prolonged the median survival of the mice.
Conclusion
Simultaneous enrichment of molecules in the Wee1/CDC2 and NF-κB pathways and their consequent coactivation is a new molecular mechanism of CDDP resistance in OS cells. OS with this molecular signature may respond well to Wee1 inhibition as an alternative treatment strategy.
2.Fecal microbiota transplantation as a novel therapy for severe psoriasis
Guang YIN ; Jianfeng LI ; Yufa SUN ; Xiao DING ; Jiaqi ZENG ; Ting ZHANG ; Lihua PENG ; Yunsheng YANG ; Hua ZHAO
Chinese Journal of Internal Medicine 2019;58(10):782-785
[Summary] To explore the therapeutic effect of fecal microbiota transplantation (FMT) for severe psoriasis. A patient, male, 36 years old, diagnosed as severe plaque psoriasis for 10 years and irritable bowel syndrome (IBS) for 15 years, was administrated twice FMT via both upper endoscopy and colonoscopy with a 5‐week interval. The following items were used to evaluate responses: body surface area (BSA), psoriasis area and severity index (PASI), dermatology life quality index (DLQI), histological examination, intestinal symptoms, adverse reactions and serum level of tumor necrosis factor (TNF)‐α. After second FMT treatment for 5 weeks, aforementioned items were improved greatly compared with those before treatment. Moreover, IBS was completely relieved and no adverse reactions were observed during the treatment and follow‐up. In conclusion, FMT could be a novel therapy for psoriasis. Further clinical trials are needed to provide solid evidences.
3. Fecal microbiota transplantation as a novel therapy for severe psoriasis
Guang YIN ; Jianfeng LI ; Yufa SUN ; Xiao DING ; Jiaqi ZENG ; Ting ZHANG ; Lihua PENG ; Yunsheng YANG ; Hua ZHAO
Chinese Journal of Internal Medicine 2019;58(10):782-785
To explore the therapeutic effect of fecal microbiota transplantation (FMT) for severe psoriasis. A patient, male, 36 years old, diagnosed as severe plaque psoriasis for 10 years and irritable bowel syndrome (IBS) for 15 years, was administrated twice FMT via both upper endoscopy and colonoscopy with a 5-week interval. The following items were used to evaluate responses: body surface area (BSA), psoriasis area and severity index (PASI), dermatology life quality index (DLQI), histological examination, intestinal symptoms, adverse reactions and serum level of tumor necrosis factor (TNF)-α. After second FMT treatment for 5 weeks, aforementioned items were improved greatly compared with those before treatment. Moreover, IBS was completely relieved and no adverse reactions were observed during the treatment and follow-up. In conclusion, FMT could be a novel therapy for psoriasis. Further clinical trials are needed to provide solid evidences.
4.Advances of research in cancer-associated inflammation and tumor microenvironments
Zhimin WEI ; Yufa SUN ; Gang LI ; Zhefeng LIU
Chinese Journal of Clinical Oncology 2018;45(21):1117-1121
Cancer-associated inflammation is one of the key features of cancer. Many cytokines are involved in inflammation and its regulation and play important roles in many factors affecting tumor biology. Inflammation participates in the construction of tumor mi-croenvironments (TMEs) by changing the homeostasis of tumor tissues. The interaction of cytokines secreted by TME-infiltrating cells forms a complex network of cytokines that play a role in tumor progression through various mechanisms such as inflammation promo-tion, immune editing, and immune escape. This review aims at analyzing the research progress on the relationship between inflamma-tion, cytokine networks, and TMEs
5.Expression of asparagine synthetase in relapsed or refractory extranodal NK/T cell lymphoma
Shaojie WU ; Yufa LI ; Yujue WANG
Journal of Southern Medical University 2017;37(4):465-469
Objective To detect the expression level of asparagine synthetase (ASNS) in patients with relapsed or refractory extranodal NK/T cell lymphoma and explore its clinical significance. Methods Ten patients with relapsed or refractory extranodal NK/T cell lymphoma admitted in our department from January, 2013 to January, 2016 were analyzed. The diagnoses were confirmed by pathological and immunohistochemical examination following failed chemotherapies in all cases. Branched DNA-liquidchip technique (bDNA-LCT) was used for detecting ASNS mRNA expression in paraffin-embedded tissue sections in the 10 cases of relapsed or refractory extranodal NK/T cell lymphoma and in 5 cases of chronic rhinitis. The correlations were analyzed between ASNS expression and the clinicopathological features and outcomes of the patients with failed chemotherapy regimens containing asparaginasum. Results Six out of the 10 patients with relapsed or refractory extranodal NK/T cell lymphoma died due to diseaseprogression. The expression level of ASNS was significantly higher in the lymphoma tissues than in tissue specimens of chronic rhinitis (P<0.05). The expression level of ASNS was associated with the International Prognostic Index (P=0.023) in patients with relapsed or refractory extranodal NK/T cell lymphoma, and Kaplan-Meier curve showed that a high ASNS expression was correlated with a reduced overall survival and progression-free survival of the patients. Conclusion Asparaginasum-based chemotherapy regimens are recommended for treatment of relapsed or refractory extranodal NK/T cell lymphoma with low ASNS expressions.
6.Endoscopic ultrasonography-guided lauromacrogol ablation for pancreatic cystic neoplasms: a prospective study
Chen DU ; Ningli CHAI ; Enqiang LINGHU ; Huikai LI ; Yufa SUN ; Wei XU ; Zhenjuan LI ; Lei JIANG ; Lihua SUN
Chinese Journal of Digestive Endoscopy 2017;34(9):653-657
Objective To evaluate the safety and effectiveness of endoscopic ultrasonography (EUS)-guided ablation with lauromacrogol for pancreatic cystic neoplasms(PCNs). Methods A total of 38 patients with PCNs admitted to Chinese PLA General Hospital from April 2015 to March 2017 were prospectively enrolled to receive EUS-guided ablation with lauromacrogol. Adverse events, such as pancreatitis,fever,bleeding and abdominal pain, were monitored during and after the procedure. Patients were followed up with contrast-enhanced CT or MRI in 3 months,6 months,1 year and 2 year after ablation. Results Thirty-eight patients were enrolled in the study, and 8 of them underwent a second ablation;so, there were 46 treatments. There were 24 females and 14 males with mean age being 53.9±14.7 years. Mild acute pancreatitis occurred in 2 cases and moderate fever occurred in 1 case. The adverse events rate was 6.5%(3/46). Among the 29 patients with complete follow-up of 5 months(2-17 months), the medium tumor volume before operation was 7 564.40 mm3(301.38-87 082.87 mm3)while 542.84 mm3(0-18 202.58 mm3)after the operation(P=0.000). A total of 14 had complete remission(CR)and 8 had partial remission(PR)in 29 patients. The remission effective rate was 48.3%(14/29),40.0%(8/20)in the cysts of the head/uncinate and 66.7%(6/9)in the body/tail(P=0.353). The medium surface area of CR group seemed smaller than that of non-CR group(1 194.27 mm2VS 1 764.09 mm2, P=0.023). Conclusion EUS-guided ablation with lauromacrogol for PCNs is safe and effective. Cysts of smaller surface are more likely to be cured than larger ones.
7.Expression of asparagine synthetase in relapsed or refractory extranodal NK/T cell lymphoma
Shaojie WU ; Yufa LI ; Yujue WANG
Journal of Southern Medical University 2017;37(4):465-469
Objective To detect the expression level of asparagine synthetase (ASNS) in patients with relapsed or refractory extranodal NK/T cell lymphoma and explore its clinical significance. Methods Ten patients with relapsed or refractory extranodal NK/T cell lymphoma admitted in our department from January, 2013 to January, 2016 were analyzed. The diagnoses were confirmed by pathological and immunohistochemical examination following failed chemotherapies in all cases. Branched DNA-liquidchip technique (bDNA-LCT) was used for detecting ASNS mRNA expression in paraffin-embedded tissue sections in the 10 cases of relapsed or refractory extranodal NK/T cell lymphoma and in 5 cases of chronic rhinitis. The correlations were analyzed between ASNS expression and the clinicopathological features and outcomes of the patients with failed chemotherapy regimens containing asparaginasum. Results Six out of the 10 patients with relapsed or refractory extranodal NK/T cell lymphoma died due to diseaseprogression. The expression level of ASNS was significantly higher in the lymphoma tissues than in tissue specimens of chronic rhinitis (P<0.05). The expression level of ASNS was associated with the International Prognostic Index (P=0.023) in patients with relapsed or refractory extranodal NK/T cell lymphoma, and Kaplan-Meier curve showed that a high ASNS expression was correlated with a reduced overall survival and progression-free survival of the patients. Conclusion Asparaginasum-based chemotherapy regimens are recommended for treatment of relapsed or refractory extranodal NK/T cell lymphoma with low ASNS expressions.
8.Establishing a predictive model for aspirin resistance in aging male with coronary heart disease
Weijun HAO ; Jian CAO ; Linggen GAO ; Jianhua LI ; Xinli DENG ; Yufa SUN ; Li FAN
Chinese Journal of Geriatrics 2016;35(4):365-370
Objective To quantify the risk factors for aspirin resistance so as to increase the prognosis for risk of coronary heart disease,and to establish a predictive model for aspirin resistance in order to guide the clinical anti-platelet therapy.Methods A total of 938 elderly male patients with stable coronary heart disease (CHD) receiving oral aspirin therapy (>75 mg/d) over 2 months were included in this study.Their clinical data were collected.Logistic regression analysis was performed to establish a predictive model and risk score for aspirin resistance.Hosmer Lemeshow (H-L) test and an area under the receiver operating characteristic (ROC) curve (the area under the ROC curve) were performed to test the calibration and discrimination of the model.Results Seven risk factors were included in the predictive model,including serum creatinine (>110 μmol/L:score of 1),fasting blood glucose (>7.0 mmol/L:score of 1),hyperlipidemia (score of 1),number of coronary arteries in lesion (2 branches:score of 2,≥≥3 branches:score of 4),body mass index[(20-25) kg/m2:score of 2,>25 kg/m2:score of 4],percutaneous coronary intervention (score of 2),smoking (score of 3).H-L test showed P≥0.05 and the area under the ROC curve>0.70 in this model.Conclusions the risk factors for aspirin resistance,and establishing a valid predictive model for aspirin resistance,could provide an important reference for anti-platelet therapy in CHD patients.
9.Establishment of a multiplex real time quantitative PCR method for CMV promoter nucleic acid sequences detection
Yufa MIAO ; Sanlong WANG ; Xiaobing ZHOU ; Yan HUO ; Xingchao GENG ; Jianjun LYU ; Jufeng WANG ; Bo LI
Chinese Journal of Pharmacology and Toxicology 2014;(2):296-301
OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.
10.Role of homeobox gene A5 in multidrug resistance of human small cell lung cancer cells.
Faman XIAO ; Zhenzhu CHEN ; Xiangping ZENG ; Yifeng BAI ; Linlang GUO ; Yufa LI
Journal of Southern Medical University 2013;33(11):1665-1668
OBJECTIVETo investigate the role of homeobox gene A5 (HOXA5) in multidrug resistance of human small cell lung cancer (SCLC) cells and the possibility of using HOXA5 as the therapeutic targets for SCLC treatment.
METHODSWe examined HOXA5 mRNA and protein expressions in chemosensitive human SCLC cells (H69) and the multidrug-resistant SCLC cells (H69AR) using quantitative real-time PCR and immunoblotting. HOXA5 expression was then enhanced or suppressed by transfection of the cells with HOXA5 expression plasmids or small interference RNA (siRNA), and the chemosensitivity of transfected cells to cisplatin (DDP) and etoposide (VP-16) was evaluated using cell counting kit-8 (CCK8) assay.
RESULTSH69 cells showed a 8.99-fold higher expression of HOXA5 than H69AR cells. HOXA5 knockdown caused obvious reductions in the chemosensitivity of H69 cells to DDP and VP-16 with increased cells in G0/G1 phase; conversely, HOXA5 enhancement resulted in an increased sensitivity of H69AR cells to DDP and VP-16.
CONCLUSIONHOXA5 may play an important role in multidrug resistance of SCLC and can be a potential therapeutic target in clinical treatment of SCLC.
Antineoplastic Agents ; pharmacology ; Antineoplastic Agents, Phytogenic ; pharmacology ; Cell Line, Tumor ; Cell Survival ; drug effects ; Cisplatin ; pharmacology ; Drug Resistance, Multiple ; Drug Resistance, Neoplasm ; Etoposide ; pharmacology ; Homeodomain Proteins ; genetics ; metabolism ; Humans ; Immunoblotting ; Lung Neoplasms ; metabolism ; pathology ; Plasmids ; RNA, Messenger ; metabolism ; RNA, Small Interfering ; genetics ; Real-Time Polymerase Chain Reaction ; Small Cell Lung Carcinoma ; metabolism ; pathology ; Transfection

Result Analysis
Print
Save
E-mail